ID: 1096396407

View in Genome Browser
Species Human (GRCh38)
Location 12:51269903-51269925
Sequence ACAGCCTGCCAAGCCTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096396396_1096396407 18 Left 1096396396 12:51269862-51269884 CCCTCCGGGCCTGCTTTCGCCGT 0: 1
1: 0
2: 2
3: 2
4: 52
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1096396394_1096396407 20 Left 1096396394 12:51269860-51269882 CCCCCTCCGGGCCTGCTTTCGCC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1096396401_1096396407 9 Left 1096396401 12:51269871-51269893 CCTGCTTTCGCCGTCCAGGGCGC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1096396395_1096396407 19 Left 1096396395 12:51269861-51269883 CCCCTCCGGGCCTGCTTTCGCCG 0: 1
1: 0
2: 2
3: 1
4: 97
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1096396404_1096396407 -5 Left 1096396404 12:51269885-51269907 CCAGGGCGCGGTCCGCGCACAGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1096396398_1096396407 14 Left 1096396398 12:51269866-51269888 CCGGGCCTGCTTTCGCCGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1096396403_1096396407 -1 Left 1096396403 12:51269881-51269903 CCGTCCAGGGCGCGGTCCGCGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1096396393_1096396407 23 Left 1096396393 12:51269857-51269879 CCGCCCCCTCCGGGCCTGCTTTC 0: 1
1: 0
2: 0
3: 21
4: 399
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1096396397_1096396407 17 Left 1096396397 12:51269863-51269885 CCTCCGGGCCTGCTTTCGCCGTC 0: 1
1: 0
2: 1
3: 6
4: 49
Right 1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096396407 Original CRISPR ACAGCCTGCCAAGCCTCACT GGG Intronic
900762746 1:4483728-4483750 CCCGCCTGCCAACCCTCACTTGG - Intergenic
902665184 1:17932699-17932721 ACAACTTGCCAAACCTCTCTGGG - Intergenic
906207954 1:43997071-43997093 ACAGCCTGACAAGTAACACTGGG + Intronic
912834782 1:112986501-112986523 GCAGCAGCCCAAGCCTCACTTGG + Intergenic
913093261 1:115494218-115494240 CCAGCTTGCCATGGCTCACTTGG + Intergenic
915852920 1:159347183-159347205 ACACCCTCCCAAGACTAACTAGG + Intergenic
919788004 1:201272338-201272360 ACAGCCTGCCCAGCCTGATGGGG - Intergenic
920002155 1:202807700-202807722 CCAGCCTGCCGAGCCTCGCCGGG + Intronic
920053133 1:203175366-203175388 CCAGCCTCCCCAGCCTCTCTGGG + Exonic
921669944 1:217914149-217914171 ACAGACTGCCAAGCTTACCTGGG - Intergenic
922831191 1:228555425-228555447 ACAGCCGGCCCAGCCTCGCGGGG - Intergenic
923074173 1:230594557-230594579 GCAGCCTGCCAACCAACACTGGG - Intergenic
1062801894 10:387201-387223 ACAGCCTTCCAGGGCTCACGTGG - Intronic
1063301319 10:4851404-4851426 ATAGCCTGGCAGTCCTCACTAGG + Intergenic
1065117226 10:22494875-22494897 ACAACCTGCCATGTCTTACTGGG - Intergenic
1065229749 10:23585384-23585406 GGAGGCTGCCAAGCCTCAGTGGG + Intergenic
1066489931 10:35884584-35884606 ACTGCCTGACAAGGCTCACGTGG - Intergenic
1067319305 10:45202500-45202522 ACAGCTTGCCGAGTCTCATTGGG - Intergenic
1068213331 10:53951763-53951785 TCAGCCTGGCAGGCTTCACTTGG + Intronic
1068632789 10:59314783-59314805 GCAGCATGCCAAGCCTCTCAGGG - Intronic
1069900615 10:71704812-71704834 CCTCCCTGCCAAGCCACACTTGG - Intronic
1072299407 10:94044730-94044752 ACAACCTGCCCAGCCCCACATGG + Intronic
1072957023 10:99896184-99896206 ACAGCCTGCCTGGCGTCAATTGG - Intronic
1073300931 10:102470611-102470633 TCAGCCTGCCAAGTCTGACACGG + Intronic
1073600104 10:104838377-104838399 ACAGCCTTCCAAACGCCACTGGG - Intronic
1074869573 10:117566114-117566136 TCATCCTGCCAAGCCTCCCTCGG - Intergenic
1076811355 10:132888254-132888276 ACACCCTGCCACCCCTCACCTGG + Intronic
1079567242 11:21897932-21897954 ACACCCTGCCTAGACTTACTGGG - Intergenic
1082723299 11:56705523-56705545 ACTGCCATCCAATCCTCACTGGG + Intergenic
1089443669 11:118534901-118534923 ACAGCAGGCCATGCCACACTTGG - Exonic
1090118069 11:123995997-123996019 ACAGCCTGTGAAGTCTTACTGGG + Intergenic
1090144197 11:124302016-124302038 ACAGCCTGCCAGGCTTCTCCAGG + Intergenic
1091651221 12:2311574-2311596 ACAGCGTGAGAAGCCTAACTGGG + Intronic
1091990608 12:4952696-4952718 TCAGGCTGCCAAGACTCACTAGG - Intergenic
1094340129 12:29401822-29401844 AGAGACAGACAAGCCTCACTGGG + Intergenic
1096396407 12:51269903-51269925 ACAGCCTGCCAAGCCTCACTGGG + Intronic
1101677157 12:106927506-106927528 CCACCATGCCCAGCCTCACTAGG + Intergenic
1101937925 12:109073740-109073762 AGAGCCTGCCAATCCACAGTGGG - Intronic
1102020444 12:109678624-109678646 ACAGCCTGCCCAGCCCTACTTGG - Intergenic
1102064495 12:109962545-109962567 ACAGCCTGCAGTGCCTCCCTGGG + Intronic
1102454845 12:113065076-113065098 CCAGCCTGCCAGGCCCCAGTGGG - Intronic
1103879472 12:124154985-124155007 ACAGCCATTCAGGCCTCACTGGG - Intronic
1103917748 12:124384682-124384704 ACAGCCTGCTCACCCTCTCTGGG + Intronic
1110698928 13:78524378-78524400 ACAAGCTGTCAAGCCTAACTGGG - Intergenic
1111727293 13:92028821-92028843 ACAGCCTTTCAACTCTCACTAGG - Intronic
1112241737 13:97688428-97688450 TCAGGCTGCAAAGCCTCACCAGG + Intergenic
1112644588 13:101315295-101315317 AGAGCCAGCAAAGGCTCACTGGG + Intronic
1117435593 14:55712672-55712694 ACAGTGTGCCAGGCCGCACTGGG + Intergenic
1119869764 14:78006994-78007016 AGACCCTGCTAAGCCTCACCTGG - Intergenic
1121267516 14:92613987-92614009 ACAACCTGCTGAGCCTCTCTGGG + Intronic
1122043354 14:99006463-99006485 ACTGCTGGCCAAGACTCACTGGG - Intergenic
1122440809 14:101730700-101730722 AGAGCCTGCCAGGCCCCACCTGG - Intronic
1122886651 14:104713306-104713328 CCAGCCGGCCCAGCCTCACCAGG - Exonic
1123830423 15:24130385-24130407 TTAGCCTGCCCAGCATCACTGGG + Intergenic
1123841284 15:24249842-24249864 TTAGCCTGCCCAGCATCACTGGG + Intergenic
1123850676 15:24352991-24353013 TTAGCCTGCCCAGCATCACTGGG + Intergenic
1123855550 15:24407226-24407248 TTAGCCTGCCCAGCATCACTGGG + Intergenic
1123860451 15:24460797-24460819 TTAGCCTGCCCAGCATCACTGGG + Intergenic
1123864081 15:24499416-24499438 TTAGCCTGCCCAGCATCACTGGG + Intergenic
1126141471 15:45442909-45442931 AAAGCCTCCCAAGCCATACTAGG + Intronic
1126287253 15:47027366-47027388 CTAGCCAGGCAAGCCTCACTGGG + Intergenic
1128172578 15:65525889-65525911 GCAGCCTTCCCAGCCTCATTTGG - Intergenic
1131131224 15:89901684-89901706 ACAGTCTGCCAAGTCTTACCTGG - Exonic
1133857064 16:9559449-9559471 ACACCCAGCCAAGCCCCAGTAGG - Intergenic
1135027038 16:19006535-19006557 ACAGTCTACAAAGCCTGACTTGG + Intronic
1135877802 16:26219829-26219851 TTCGCCTGACAAGCCTCACTAGG + Intergenic
1135917006 16:26614298-26614320 TCAGCCTGGGGAGCCTCACTTGG + Intergenic
1136909389 16:34133985-34134007 ACAGCCGGCCCAGCCCCACGGGG - Intergenic
1138795145 16:59958845-59958867 ACAGGCTGCAAAGACTCACTAGG + Intergenic
1139664303 16:68446110-68446132 GTCCCCTGCCAAGCCTCACTTGG + Intronic
1140381138 16:74488904-74488926 CCACCATGCCCAGCCTCACTTGG + Intronic
1141615257 16:85206558-85206580 CCAGCATGCCAAGCCCCACCTGG - Intergenic
1142142338 16:88478200-88478222 CCAGCCTGCCACGACTCTCTGGG + Intronic
1143509199 17:7386252-7386274 GCAGCCTCCCAAGCCCCTCTGGG - Intronic
1143983826 17:10894219-10894241 ACAGGCTGTCAGACCTCACTTGG + Intergenic
1147050509 17:37790812-37790834 ACAACCTTCCAAGGCTGACTGGG - Intergenic
1149551175 17:57541056-57541078 ACAGCCCCCGAAGCCTGACTTGG + Intronic
1151208752 17:72528063-72528085 AGAGGCTGCCAGGTCTCACTGGG + Intergenic
1151878259 17:76879531-76879553 ACAGCCTGCGTGGCCTCACTGGG - Intronic
1160551025 18:79693943-79693965 ACAGCCTGCCATGGCACAGTGGG + Intronic
1160865949 19:1255978-1256000 TCGGCCTGCCAGGCCTGACTTGG - Intronic
1161589354 19:5122095-5122117 CCAGTCTGACAGGCCTCACTGGG + Intronic
1162901376 19:13796905-13796927 AGAGCCTGCCCATCCACACTTGG - Intronic
1164873294 19:31664861-31664883 ACAGACTGCCTAGCCTAAGTTGG + Intergenic
1165483890 19:36083650-36083672 ACATCCTGCCAAACCTCAACAGG - Intronic
1167349300 19:48964792-48964814 ACAGCCTTCCAAGCTTCCCAAGG + Intergenic
1167411194 19:49344853-49344875 ACAGCTGGCCAAGTGTCACTAGG + Intronic
925480644 2:4269846-4269868 ACAGCCTGTAAACCCTCCCTGGG + Intergenic
926062606 2:9813660-9813682 ACAGGCTGCCCAGGCTCCCTGGG + Intergenic
927712157 2:25332704-25332726 ACTGACTGCCCAGCCCCACTGGG + Intronic
928735290 2:34281631-34281653 AGATACTGCCAAGCCTCATTTGG - Intergenic
932089923 2:68797420-68797442 GCAGCCTGCCAGGACTGACTGGG - Intronic
936058347 2:109278355-109278377 GCAGACTGGCAAGCCCCACTGGG - Intronic
945868483 2:215202537-215202559 CCACCGTGCCCAGCCTCACTGGG - Intergenic
946036166 2:216744061-216744083 AGCCCCTGCTAAGCCTCACTGGG - Intergenic
946596881 2:221315549-221315571 ACAGCCCCTCAAGCCTCACCTGG + Intergenic
948686304 2:239671930-239671952 TCAGGCTCCCAAGCCTCACCTGG - Intergenic
1173562820 20:44018335-44018357 GCAGCATGCCAAGCCTAACAGGG + Intronic
1176612051 21:8992181-8992203 ACAGACTCACAAACCTCACTGGG + Intergenic
1181381339 22:22507247-22507269 ACAGCCAGCTAAGCCACTCTTGG + Intronic
1181986806 22:26805547-26805569 TCAGCCTGTCTAGCCTCATTGGG - Intergenic
1182321951 22:29483370-29483392 ACAGTCGGTCCAGCCTCACTGGG - Exonic
1183295886 22:37029377-37029399 ACAGCCTGCCACGTGGCACTAGG + Exonic
1184301396 22:43562894-43562916 ACAGCAGGCCATGCCCCACTGGG - Intronic
1184501803 22:44879087-44879109 TCTGCCTGCCCAGCCTCACCTGG + Intergenic
1184578850 22:45398421-45398443 TCAGCCTGCCAGGCCGCACCTGG - Intronic
949112993 3:285536-285558 ACAGGCTCACAAGTCTCACTGGG + Intronic
953872968 3:46643592-46643614 ACAGCCTGAGAGGCCTCCCTGGG - Intergenic
954419699 3:50412273-50412295 ACAGCCAGCCTAGCCTCACAGGG - Intronic
954566383 3:51603644-51603666 GCAGCCTTCCAAGCCACAGTAGG - Intronic
954787354 3:53103726-53103748 TCAGCTTCCCCAGCCTCACTTGG - Intronic
955564150 3:60225968-60225990 ACAGAGCGCCCAGCCTCACTGGG - Intronic
957614630 3:82510406-82510428 TCAGCCTGGCAAGCTGCACTTGG - Intergenic
957762561 3:84577566-84577588 ACAACATACCAAGACTCACTTGG + Intergenic
960070365 3:113423381-113423403 TCTGCCTGCCAAGCCTCCCAAGG + Intronic
961194014 3:124986221-124986243 CCAGCCTCCCCAGCCTCATTGGG + Intronic
963060574 3:141221604-141221626 ACAGCCTGCCTAGCATCACACGG - Intergenic
964308633 3:155368483-155368505 CCACCATGCCCAGCCTCACTGGG + Intergenic
965534275 3:169808967-169808989 AGTGTCTGCCAAGCCTCAATGGG - Intronic
967649752 3:191972685-191972707 TCAGCCTGCCAGGCTGCACTTGG + Intergenic
969441079 4:7217155-7217177 GCAGCCTGACCAGCCTCATTGGG + Intronic
969680248 4:8639484-8639506 ACAGGGTACCAGGCCTCACTGGG + Intergenic
970387011 4:15566268-15566290 GGGGCCTGCCAAGCCTCACCAGG - Intronic
971349815 4:25845824-25845846 TCTGCCTGCCAAGCCTGGCTGGG + Intronic
971548428 4:27917063-27917085 AAAGTCTCCCAAGCCTCACTTGG - Intergenic
974410845 4:61539388-61539410 GCAGCCTGCCAAAGCCCACTGGG - Intronic
978229994 4:106386253-106386275 ACAGCCTGCCAGGTTTGACTAGG + Intergenic
980144973 4:128971637-128971659 ACAGACTGCCTACCCTCACATGG + Intronic
980219174 4:129893246-129893268 ACAGCTTGCCAAGGCTTTCTTGG - Intergenic
990878913 5:60518269-60518291 ACAGCCTGCCCAGGCTGAGTGGG + Intronic
992615086 5:78539742-78539764 ATAGCCTGCTAAGCCACACTGGG + Intronic
995688564 5:114798207-114798229 AGTGCCTGCAAAGCCTCAGTAGG - Intergenic
999235044 5:150085584-150085606 ACAGGCTGCCAAGTCTCAGGAGG - Intronic
999254535 5:150202708-150202730 GCAGGCTGCCAGGCCTCAGTGGG + Intronic
1007830125 6:44631346-44631368 ACAGCCTTCCAAGGCTGAGTTGG - Intergenic
1008495010 6:52124347-52124369 ACAGCCTGCTAAGACTGGCTGGG - Intergenic
1008626949 6:53326370-53326392 ACAGCCTACAATCCCTCACTTGG + Intronic
1014384860 6:120787026-120787048 TCAGCCTGGCAGGCTTCACTAGG - Intergenic
1014625057 6:123714749-123714771 CTAGACTGACAAGCCTCACTGGG + Intergenic
1017852184 6:158314370-158314392 ACAGCATGGGAAGTCTCACTAGG - Intronic
1019900624 7:4017934-4017956 AAAGCCTGCCACGCCGCACCCGG - Intronic
1020259201 7:6521256-6521278 CCACCATGCCCAGCCTCACTGGG + Intronic
1024728450 7:52228248-52228270 ACAGGCTGAGAAGCCTAACTTGG + Intergenic
1027963051 7:84971153-84971175 ACAGTTTGACAAGCCTCTCTGGG + Intergenic
1029176375 7:98667708-98667730 GCAGCCTGCCACGCCACACAGGG + Intergenic
1030312063 7:108078954-108078976 AGAGGCTCCCAAGCCCCACTAGG - Intronic
1033332749 7:140429785-140429807 ACAGCCTGCCGAGCCTCCTGTGG + Intergenic
1035339695 7:158152355-158152377 ACAGCTTCCCAGGCCCCACTAGG - Intronic
1035736988 8:1896004-1896026 AGTTCCTGCCAAGTCTCACTTGG - Intronic
1037446733 8:18972863-18972885 ACAGCATGGAAAGCATCACTGGG + Intronic
1037742336 8:21617471-21617493 TCACCGTGCCCAGCCTCACTGGG + Intergenic
1037897140 8:22665486-22665508 ACACCCTGCCATGCTGCACTGGG - Intronic
1040603626 8:48908930-48908952 ACAGCCAGACAAGCCCCTCTTGG - Intergenic
1047384368 8:124395657-124395679 ACTGCCTTCCAATCCCCACTGGG - Intergenic
1049287047 8:141781517-141781539 AGACCCTGCCGAGCCTCTCTCGG - Intergenic
1050260395 9:3835380-3835402 GGATCCTGCCAAGCCTGACTAGG - Intronic
1051822412 9:21182982-21183004 CCAGCCTGCCCAGCCTCCCCGGG - Intergenic
1051823648 9:21195037-21195059 CCAGCCTGCCCAGCCTCCCCGGG - Intergenic
1051825466 9:21213573-21213595 CCAGCCTGCCCAGCCTCCCCGGG - Intronic
1051827450 9:21235635-21235657 CCAGCCTGCCCAGCCTCCCCGGG - Intronic
1053100764 9:35370445-35370467 ACAGCTTGCCAAGGCCCAATGGG - Intronic
1055352378 9:75402822-75402844 ACAGCCTTCTCAGACTCACTGGG + Intergenic
1056819060 9:89824178-89824200 ACAGCCTGCCATGCCTGAGGTGG - Intergenic
1062371954 9:136244575-136244597 AAGTCCTGCCAAACCTCACTGGG + Intronic
1187264045 X:17714810-17714832 TCAGCCTGCCACGCCTTAATGGG - Intronic
1187366864 X:18672990-18673012 ACAGACTGCCAACCCAGACTGGG + Intergenic
1189041274 X:37543646-37543668 AGAGCCTCCCAAGACTCATTGGG - Intronic
1189699330 X:43700614-43700636 TCAGCCTGCTGAGCCTAACTGGG - Intronic
1191008749 X:55738933-55738955 ACTGCCCTCCAAGCCCCACTGGG - Intronic
1193553201 X:82924549-82924571 ACAGCCTGACATGGCTCACTTGG - Intergenic
1193995622 X:88363689-88363711 ACAGCCCTCCAATCCTCACTGGG + Intergenic
1200805660 Y:7431089-7431111 ACACCCTGCCAAGACTAACCAGG + Intergenic
1201935314 Y:19405688-19405710 TCAGCCTGGCAAGCTGCACTCGG + Intergenic