ID: 1096403128

View in Genome Browser
Species Human (GRCh38)
Location 12:51323910-51323932
Sequence TCAGGGGCCCCGAAGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096403128_1096403138 7 Left 1096403128 12:51323910-51323932 CCCAGACCCTTCGGGGCCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1096403138 12:51323940-51323962 GCCCGCCCCTCCTGCCCGGCCGG 0: 1
1: 0
2: 4
3: 48
4: 478
1096403128_1096403140 8 Left 1096403128 12:51323910-51323932 CCCAGACCCTTCGGGGCCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1096403140 12:51323941-51323963 CCCGCCCCTCCTGCCCGGCCGGG 0: 1
1: 0
2: 9
3: 89
4: 868
1096403128_1096403150 25 Left 1096403128 12:51323910-51323932 CCCAGACCCTTCGGGGCCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1096403150 12:51323958-51323980 GCCGGGCTCGGCCTCGGCCTCGG 0: 1
1: 2
2: 13
3: 43
4: 347
1096403128_1096403144 13 Left 1096403128 12:51323910-51323932 CCCAGACCCTTCGGGGCCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1096403144 12:51323946-51323968 CCCTCCTGCCCGGCCGGGCTCGG 0: 1
1: 0
2: 2
3: 42
4: 454
1096403128_1096403147 19 Left 1096403128 12:51323910-51323932 CCCAGACCCTTCGGGGCCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1096403147 12:51323952-51323974 TGCCCGGCCGGGCTCGGCCTCGG 0: 1
1: 0
2: 2
3: 18
4: 190
1096403128_1096403136 3 Left 1096403128 12:51323910-51323932 CCCAGACCCTTCGGGGCCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1096403136 12:51323936-51323958 CCCTGCCCGCCCCTCCTGCCCGG 0: 1
1: 1
2: 24
3: 133
4: 897

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096403128 Original CRISPR TCAGGGGCCCCGAAGGGTCT GGG (reversed) Intronic
900523089 1:3115622-3115644 GCGGGGGCCACGGAGGGTCTTGG + Intronic
900576619 1:3385749-3385771 TCAGAGGCCCCGGAGGCTCTAGG - Intronic
902238662 1:15074007-15074029 TCAGGGGCCCTGAAGGCGCTGGG - Intronic
903179796 1:21599453-21599475 TCAGGGGCCCCACAGGAGCTTGG - Intronic
903363499 1:22792164-22792186 CCAGTGGCCCAGAAGTGTCTGGG + Intronic
904586694 1:31584705-31584727 TCAGAGGCCTCGAAGGCTGTGGG - Exonic
905337933 1:37258146-37258168 ACAGTGGCCTCCAAGGGTCTGGG + Intergenic
906555712 1:46711322-46711344 TCAGGTACCCCGAAGGGGCAAGG + Intronic
909948685 1:81693142-81693164 TCAGGGGAGCAGAAGGCTCTTGG - Intronic
912243966 1:107941504-107941526 TCACAGGCCCCGAAGGATGTTGG - Intronic
913318722 1:117574254-117574276 ACAGGGGCCCCGAAGGCTGATGG - Intergenic
915367686 1:155324728-155324750 GCTGTGTCCCCGAAGGGTCTTGG - Intronic
915598517 1:156908468-156908490 TCAGGGGCCGGGAGGGGCCTGGG + Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
918017959 1:180656097-180656119 CCAGGGGCTCAGAAGGGTATTGG - Intronic
918041356 1:180916072-180916094 CCCGGGGCCCCAAAGTGTCTTGG - Intronic
922062591 1:222106380-222106402 CCAGGGACCCAGAAGGCTCTGGG + Intergenic
922250548 1:223845716-223845738 TGAGGTGCCCCGGAGGGTCGCGG + Exonic
923563284 1:235057994-235058016 TCAGGGGCCAGGAAGGCTCAGGG - Intergenic
924795294 1:247288442-247288464 TCAGGGGCCCTGCAGGCTCACGG + Intergenic
924822319 1:247505162-247505184 TCAGTGGCCCAGCAGGGCCTTGG + Intergenic
1073065912 10:100759145-100759167 TCAGTGGCCCTGCAAGGTCTTGG + Intronic
1076992735 11:284263-284285 TCAGGGCCTCAGAAAGGTCTCGG - Exonic
1077179731 11:1206978-1207000 TCAGGGCCCCTGCAGGGTCTGGG - Intergenic
1077184493 11:1230173-1230195 TGAGGGTCCCAGGAGGGTCTGGG - Intronic
1077415051 11:2420965-2420987 GCAGGGGCTCAGAAGGGTTTGGG - Intronic
1077466838 11:2737393-2737415 CCAGGGGCCCCCGTGGGTCTGGG - Intronic
1084204511 11:67584009-67584031 TCAGGGGGCCCGGAGCGCCTCGG + Intronic
1085399665 11:76228261-76228283 TCACGGGCCCCGAGGCCTCTGGG + Intergenic
1087060290 11:93970635-93970657 TCATGGGCACCAAGGGGTCTGGG + Intergenic
1089634791 11:119805165-119805187 TCTGGGGGCCCCAAGGCTCTAGG + Intergenic
1089792443 11:120954563-120954585 TCAAGGGCCCTGAAAAGTCTTGG + Intronic
1090912592 11:131134474-131134496 TCAGGGGAGCAGAAGGCTCTTGG + Intergenic
1091750515 12:3018987-3019009 TCAGTGGTCCCGATGGGCCTTGG - Intronic
1091910926 12:4230097-4230119 ACATGGGCCCCCAAGGGTCAAGG - Intergenic
1092881695 12:12892028-12892050 TCAGAGGACCCGAAGGTACTGGG + Intronic
1094350189 12:29515601-29515623 TCAGGGGACCCGATGAGTCTGGG - Intronic
1096111627 12:49032237-49032259 TTGGGGGCCCAGAAGGTTCTGGG + Exonic
1096403128 12:51323910-51323932 TCAGGGGCCCCGAAGGGTCTGGG - Intronic
1102573157 12:113839923-113839945 TCATGGGCCCCAAAAGGTTTAGG - Intronic
1111559265 13:89923776-89923798 TCAGAGACTCCGCAGGGTCTCGG + Intergenic
1118312619 14:64704787-64704809 ACGGGGGCCGCGAAGGGACTGGG - Intronic
1118819056 14:69333214-69333236 TCAGGGGCCTGGGAGGCTCTTGG + Intronic
1118941988 14:70346934-70346956 TTAGATGCCCCGAGGGGTCTGGG - Intronic
1121190623 14:92026183-92026205 TCAGGGTCCCTGAAGGACCTCGG + Intronic
1123463153 15:20493107-20493129 TCAGGGGCCCTGAATGTTTTTGG - Intergenic
1123654905 15:22507307-22507329 TCAGGGGCCCTGAATGTTTTTGG + Intergenic
1124273992 15:28310508-28310530 TCAGGGGCCCTGAATGTTTTCGG - Intronic
1124308816 15:28602507-28602529 TCAGGGGCCCTGAATGTTTTTGG + Intergenic
1127966204 15:63924656-63924678 CCAGGGGCCCCAGAGGGCCTGGG - Intronic
1128554963 15:68625165-68625187 TCAGGTGCCACGCAGGGTTTAGG + Intronic
1134419105 16:14070128-14070150 TCAGGAGCCCTGGAGGTTCTAGG - Intergenic
1140078483 16:71723446-71723468 GCAGGGGCGGCGAAGGGTCCGGG + Intronic
1140282288 16:73565853-73565875 TCAGGGGACCAGTGGGGTCTTGG + Intergenic
1140873505 16:79128604-79128626 GCAGTGGCACAGAAGGGTCTGGG + Intronic
1141658174 16:85427199-85427221 TCAGGCACCCTGGAGGGTCTGGG - Intergenic
1141963714 16:87426704-87426726 TCAGGGGTCTCCAAAGGTCTGGG - Intronic
1144311263 17:14016188-14016210 TCAGGTACCCCAAAGGGCCTTGG + Intergenic
1149459147 17:56813123-56813145 TCAGGGACCCGGCAGGGGCTGGG - Intronic
1149781514 17:59400079-59400101 TCCCGGGTCCCGAGGGGTCTGGG - Exonic
1151668016 17:75556661-75556683 GCAGGGGCACAGAAGGGCCTAGG - Intronic
1152337427 17:79706663-79706685 TCGGGGGCTCCTGAGGGTCTGGG - Intergenic
1152797052 17:82313692-82313714 TCAGGGGCTCCGGAGCCTCTGGG + Intergenic
1153925755 18:9833331-9833353 ACAGGGGCCCGGAAGTGTCAGGG + Intronic
1156174354 18:34525226-34525248 TCAGGGGCCCCAGAGGTTCAGGG + Intronic
1157658456 18:49416918-49416940 TCTGGGGCTCTGAAGGGTGTAGG - Intronic
1161106188 19:2445201-2445223 TCAGGGGCCCAGAGGGGTCTGGG - Intronic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162579388 19:11519248-11519270 GCAAGGGCCCCGCAGGGTCGAGG + Intronic
1163842218 19:19618470-19618492 GCAGGGGCCACGCAGGGTCGTGG - Intronic
1166204317 19:41259338-41259360 TCAGGAGCTGGGAAGGGTCTCGG - Intronic
1166808027 19:45498579-45498601 GCAGGGCCCCCGAAGGGCCTCGG + Exonic
1167752731 19:51390555-51390577 CCCGGGCCCCCGAAGGATCTCGG - Exonic
925277838 2:2662851-2662873 TCAGGGCCTCCCAGGGGTCTGGG - Intergenic
925355384 2:3237561-3237583 TCAGGGGTCCGCTAGGGTCTTGG + Intronic
929593658 2:43162466-43162488 TCAGGGGTCAGGAAGGGTTTGGG - Intergenic
934610278 2:95730371-95730393 GCAAGGGCCCCAGAGGGTCTGGG + Intergenic
935547754 2:104418772-104418794 TCAGGGCCCCCGCATGGGCTTGG - Intergenic
937223703 2:120356416-120356438 TCAGGGGCCCCTATGGGGATGGG - Intergenic
937229674 2:120390351-120390373 TCAGGAGCACAGAGGGGTCTGGG + Intergenic
937697691 2:124826465-124826487 TCAGGGGCCAGGGAGGGGCTGGG - Intronic
938195598 2:129324708-129324730 TCAGGGGCCCAGGACTGTCTGGG - Intergenic
941512566 2:166431464-166431486 TCAGGGGCACTGGAGGGTCGGGG - Intronic
945948579 2:216017597-216017619 TCAGGTGCCCAGAGGGCTCTTGG - Intronic
947485684 2:230546390-230546412 ACAGGGGCCCCAGAGGATCTGGG - Intergenic
948781437 2:240324171-240324193 CCTGGGGCCCCGAAGGGCCGAGG - Intergenic
1170817898 20:19730181-19730203 TCAGGGGGCCAGCAGGCTCTGGG + Intergenic
1172583152 20:36064423-36064445 GCTGGGGCTCCGGAGGGTCTGGG + Intergenic
1180137180 21:45869381-45869403 CCAGGGTGCCCGAGGGGTCTGGG - Intronic
1180301358 22:11038870-11038892 TCAGTGACCCCCAAGTGTCTAGG - Intergenic
1182526451 22:30923332-30923354 TCAGTGTCCCCGAAGGGTGAAGG - Intergenic
1183090655 22:35519703-35519725 TCAGGGTCCACAAGGGGTCTGGG + Intergenic
1183258044 22:36775836-36775858 TCAGTGGCCGCGACGGGACTGGG + Exonic
952316848 3:32238921-32238943 CCAGGGACCCCGGCGGGTCTGGG - Exonic
957049265 3:75398788-75398810 CCAGGGACACTGAAGGGTCTCGG - Intergenic
961315531 3:126032890-126032912 AGAGAGGCCCAGAAGGGTCTAGG + Intronic
961881585 3:130065269-130065291 CCAGGGCCACTGAAGGGTCTCGG - Intergenic
968572676 4:1350329-1350351 TAAGGGGCACGGTAGGGTCTGGG - Intronic
968809449 4:2793329-2793351 TCAGGGGTCCCGGCAGGTCTTGG + Intronic
969822329 4:9730213-9730235 CCAGGGCCACTGAAGGGTCTCGG + Intergenic
970051479 4:11919364-11919386 TCAGAGGTCCCCAAGTGTCTTGG - Intergenic
974012163 4:56617002-56617024 TCAGGCTCCCCTCAGGGTCTTGG - Intergenic
985066097 4:186123806-186123828 TCAAGGACCGTGAAGGGTCTGGG - Intronic
985220984 4:187705325-187705347 ACAGGGGCCAGGAAGAGTCTGGG - Intergenic
995744462 5:115389597-115389619 TCAGGAGCCCCGAGGGGTGGGGG + Intergenic
998038204 5:138934108-138934130 TCAGGAGCCCCGAGGGGTGGGGG - Exonic
1002107618 5:176887857-176887879 TCAGGAGGCCCTAGGGGTCTGGG - Intronic
1007357051 6:41328712-41328734 TCAGTGGCCCTAGAGGGTCTTGG + Intergenic
1013604856 6:111738421-111738443 TCAGGTGCCCCCAAGGCTCATGG + Intronic
1018848310 6:167570510-167570532 TATGGGGCCTCGCAGGGTCTCGG + Intergenic
1024603617 7:51008038-51008060 TGTGGGGCCCAGAAGGGACTTGG - Intergenic
1024699250 7:51889389-51889411 TCAGGGACACCGAAGGCTTTGGG + Intergenic
1029114312 7:98229483-98229505 ACAGGGGCCCCTTGGGGTCTGGG + Intronic
1033426271 7:141247436-141247458 TCAGGGTCCCTCATGGGTCTGGG - Intronic
1035699977 8:1631042-1631064 TCCGGGTGCCCCAAGGGTCTGGG + Intronic
1039583191 8:38683474-38683496 TCTGGGACCCCTCAGGGTCTTGG + Intergenic
1049021718 8:139961632-139961654 TCTGGGGCCCCCAAGGGTGCAGG - Intronic
1050417217 9:5430242-5430264 TCAGGGTCTGTGAAGGGTCTGGG - Intronic
1052419564 9:28224659-28224681 TCAGAGGCCAGGAAGGGTATGGG - Intronic
1061773659 9:132946091-132946113 TCAAGGGCCCAGGAGGGTTTGGG - Intronic
1061974834 9:134062784-134062806 TCAGGGTCTCCCACGGGTCTGGG + Intronic
1062031933 9:134365714-134365736 TGAGGGGCCCGGCAGAGTCTCGG + Intronic
1062127520 9:134871562-134871584 TCCCTGGTCCCGAAGGGTCTGGG - Intergenic
1062141050 9:134959380-134959402 TCAGGTGCCCTGGGGGGTCTTGG + Intergenic
1062621782 9:137426089-137426111 GCAGGGGCTCCGAAGGTTCCTGG + Intronic
1188009815 X:25043671-25043693 TCAGGGGCAGCCAAGGGGCTGGG + Intergenic