ID: 1096403542

View in Genome Browser
Species Human (GRCh38)
Location 12:51326257-51326279
Sequence CAGAATAAACCCTAATCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096403542_1096403548 13 Left 1096403542 12:51326257-51326279 CCAGGCGATTAGGGTTTATTCTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1096403548 12:51326293-51326315 GTGATGCCCTGGAAGAGGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 305
1096403542_1096403547 12 Left 1096403542 12:51326257-51326279 CCAGGCGATTAGGGTTTATTCTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1096403547 12:51326292-51326314 GGTGATGCCCTGGAAGAGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 342
1096403542_1096403545 2 Left 1096403542 12:51326257-51326279 CCAGGCGATTAGGGTTTATTCTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1096403545 12:51326282-51326304 TGTTAGCTTTGGTGATGCCCTGG 0: 1
1: 0
2: 2
3: 10
4: 114
1096403542_1096403551 29 Left 1096403542 12:51326257-51326279 CCAGGCGATTAGGGTTTATTCTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1096403551 12:51326309-51326331 GGCAGGGTGATGAAAATAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 272
1096403542_1096403544 -9 Left 1096403542 12:51326257-51326279 CCAGGCGATTAGGGTTTATTCTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1096403544 12:51326271-51326293 TTTATTCTGGATGTTAGCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 243
1096403542_1096403546 8 Left 1096403542 12:51326257-51326279 CCAGGCGATTAGGGTTTATTCTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1096403546 12:51326288-51326310 CTTTGGTGATGCCCTGGAAGAGG 0: 1
1: 0
2: 1
3: 15
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096403542 Original CRISPR CAGAATAAACCCTAATCGCC TGG (reversed) Intergenic
904248514 1:29205477-29205499 CAGAATTAACCCTTAAGGCCAGG - Intronic
917320816 1:173779644-173779666 CAGGATAAATCCTAAAAGCCAGG - Intronic
918328721 1:183435268-183435290 ATGAATAAACACTAATCACCTGG - Intergenic
924944951 1:248839685-248839707 CAGAGTAAATCCTAAGCACCGGG + Intronic
1075539661 10:123301499-123301521 CATAATAAACCCAACTGGCCTGG - Intergenic
1088645643 11:111914070-111914092 CTGAATAAACCCAAATCTCAGGG + Exonic
1095709410 12:45272406-45272428 CAGAATAAATCCTAATTTGCAGG - Intronic
1096403542 12:51326257-51326279 CAGAATAAACCCTAATCGCCTGG - Intergenic
1097517133 12:60619554-60619576 CAGCAGAAACCCTAATAGCCAGG + Intergenic
1104898309 12:132175065-132175087 CAAAATAAACCCTGGTAGCCGGG + Intergenic
1107269742 13:38601488-38601510 CAGAATAGACCCTGACCCCCAGG + Intergenic
1108540246 13:51436856-51436878 CAGCATAAACACTATTTGCCTGG - Intronic
1128645462 15:69375547-69375569 GAGATAAAACCCTTATCGCCTGG - Intronic
1129009095 15:72398598-72398620 AAGAATAACCCCTGATCCCCAGG - Intronic
1130925389 15:88381844-88381866 CAAAATAAAATCTAATCGCCAGG + Intergenic
1137859748 16:51834417-51834439 CAGAGTAAACCGTAATCTCTGGG + Intergenic
1139745285 16:69069188-69069210 CAGAATTAAGCCTAATGGTCAGG - Intronic
1141736974 16:85860391-85860413 CAGAATGGATCCTAATCCCCAGG - Intergenic
1155088191 18:22477662-22477684 CAGAAGAAACCTTAAATGCCAGG - Intergenic
1159320470 18:66840712-66840734 CAGCAGAAACCTTAATAGCCAGG + Intergenic
1161787422 19:6335838-6335860 AAGAAAAAATCCTAAGCGCCAGG + Intergenic
1167023590 19:46897585-46897607 CAGAATACACTCAAATCCCCTGG - Intergenic
925896791 2:8478355-8478377 CTGACTAAACCCTAAGCCCCAGG + Intergenic
932819044 2:74884186-74884208 CAGAATAAAACCTAATCCAATGG - Intronic
937730123 2:125220526-125220548 CAGCAGAAACCCTAAAGGCCAGG - Intergenic
1181773190 22:25141629-25141651 GGGAAAAAACCCTAATCACCAGG + Intronic
1182398733 22:30057464-30057486 CAGAATGAACCCAAATGGGCCGG + Intergenic
963400437 3:144790966-144790988 CAGAAAGAACCCTGATCTCCTGG - Intergenic
966618731 3:181940691-181940713 CAAAATCAACCCAAATCTCCAGG - Intergenic
974181037 4:58385286-58385308 CAGAAGAAACCCTACAAGCCGGG - Intergenic
977017446 4:91709453-91709475 CAGCAGAAACCCTACTGGCCAGG + Intergenic
984288727 4:177766143-177766165 CAGAATAACCCATGATCTCCTGG - Intronic
993431605 5:87839651-87839673 CAGCATAAACCTTAAAAGCCAGG - Intergenic
1002950567 6:1806334-1806356 CAGCATAAACCCTAATCTAAAGG - Intronic
1004398273 6:15265653-15265675 CAGAATACTCCTTAATTGCCTGG - Intronic
1004632006 6:17430830-17430852 AAAAATAACCCCTAATGGCCGGG - Intronic
1014960925 6:127683404-127683426 CAGCATAAACCCTCAGGGCCAGG + Intergenic
1016513934 6:144872960-144872982 AATAATAATCCCTAATCTCCTGG + Intergenic
1018277005 6:162143725-162143747 CAGAATAAACACTTTTCTCCTGG - Intronic
1019440540 7:1044213-1044235 CAGAATATACCCTAATCTGCAGG - Intronic
1021405105 7:20257342-20257364 CAAAATAAACTCTAAGCTCCAGG - Intergenic
1039529012 8:38243076-38243098 CAGAATATACCCAAATCACAGGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1045280259 8:100743727-100743749 CAGAATAAACCATGCTGGCCAGG + Intergenic
1055687489 9:78792672-78792694 CAGAATATACTCTCATCACCTGG - Intergenic
1185433244 X:21575-21597 CAAAATAAACATTAATGGCCGGG + Intergenic
1185442448 X:233643-233665 CAAAATAAACATTAATGGCCGGG + Intergenic
1189199471 X:39180289-39180311 CAGAATAAACCCTAATCAAATGG - Intergenic
1192933932 X:75838907-75838929 CAGAAAAAACCCTATTTCCCTGG - Intergenic
1193087226 X:77457655-77457677 CAAAATAAACACAAATCGGCTGG + Intergenic
1194206141 X:91014217-91014239 CACCAGAAACCCTAATAGCCAGG - Intergenic
1194520070 X:94908412-94908434 CAGAATAAAGCCTACTGGCCTGG + Intergenic
1200551897 Y:4589033-4589055 CACCAGAAACCCTAATAGCCAGG - Intergenic