ID: 1096404037

View in Genome Browser
Species Human (GRCh38)
Location 12:51329818-51329840
Sequence GGCCCCCAGAGTCACCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 2, 2: 10, 3: 36, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096404036_1096404037 -8 Left 1096404036 12:51329803-51329825 CCAAGCAATGGAGGGGGCCCCCA 0: 1
1: 0
2: 0
3: 19
4: 176
Right 1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 10
3: 36
4: 250
1096404033_1096404037 -1 Left 1096404033 12:51329796-51329818 CCATTCACCAAGCAATGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 10
3: 36
4: 250
1096404029_1096404037 17 Left 1096404029 12:51329778-51329800 CCATGGACAGAATACTTGCCATT 0: 1
1: 0
2: 0
3: 7
4: 190
Right 1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 10
3: 36
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096404037 Original CRISPR GGCCCCCAGAGTCACCCTGC AGG Exonic
900402847 1:2479675-2479697 GGGGCCCAGCGTCCCCCTGCTGG - Intronic
900616440 1:3567684-3567706 GACCCAGAGCGTCACCCTGCAGG + Intronic
900868747 1:5287013-5287035 GTCCCCAAGATTCCCCCTGCTGG - Intergenic
901701563 1:11047173-11047195 GGCGCCCACAGCCTCCCTGCAGG - Intronic
901805567 1:11736425-11736447 GCCCCTCAGTGTCGCCCTGCTGG - Intronic
903007708 1:20309537-20309559 GGTCCCCAAACACACCCTGCGGG - Intronic
903034357 1:20485001-20485023 CGCCCCCAGGGTGACCCAGCCGG + Intronic
903312509 1:22470795-22470817 GGCCCTCAGACTCCACCTGCCGG + Intronic
904035640 1:27557184-27557206 GGACCCGAGGGTCACCCTGCCGG + Intronic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
904256960 1:29260147-29260169 GCGCCCCAGCGACACCCTGCCGG - Intronic
905034874 1:34911492-34911514 GGCCCCCAGCTTCACCATTCGGG - Intronic
905308149 1:37033128-37033150 GGCCGCCCAAGGCACCCTGCAGG - Intronic
906315934 1:44786432-44786454 GACCCCCAGAGGCTCCCGGCGGG + Intronic
906561085 1:46757460-46757482 TGGCCCCAGAGTCATTCTGCTGG + Intergenic
908356617 1:63329463-63329485 GGCCTCCGGGGTCACCCTGGAGG + Intergenic
909608913 1:77532793-77532815 TGCCCCCAACATCACCCTGCTGG - Intronic
913251713 1:116917344-116917366 TGCCACCAGAGTCTCCCAGCTGG - Intronic
919690453 1:200524075-200524097 GGCACCCAGTGTCCCCTTGCTGG + Intergenic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
922241085 1:223755868-223755890 GCCCCCCACAGCCAGCCTGCAGG + Intronic
923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG + Intronic
923529200 1:234800189-234800211 GCCACCCAGAGTCCCCGTGCTGG - Intergenic
924039510 1:239970864-239970886 GGCTCCCAGAGTCAGCATGCTGG + Intergenic
924044407 1:240012430-240012452 GTCCCCCAGAGTTAGCATGCTGG - Intergenic
1062848449 10:725730-725752 GGGCTCCAGACACACCCTGCTGG - Intergenic
1062973261 10:1664758-1664780 GGCCCCCAGAGTCAGCCGCATGG - Intronic
1065963428 10:30752530-30752552 GGCCTCCACAGTCCCCCTTCTGG - Intergenic
1067556745 10:47278150-47278172 GGTCCCCAGGGTGACCCCGCCGG + Intergenic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1070946292 10:80394718-80394740 GGCCCACTGAGTCACTGTGCTGG - Intergenic
1072415879 10:95246449-95246471 GGCACCCAGGGTCACCCCGTAGG - Intronic
1074085657 10:110207724-110207746 GGCCCCCAGGGAGACCCGGCCGG - Exonic
1074112748 10:110434009-110434031 CGCCCGCAGAGCCTCCCTGCAGG + Intergenic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1075020599 10:118949299-118949321 GCTCCCCAGAGTCACTCAGCTGG + Intergenic
1075172316 10:120127459-120127481 TGCCCCCAGTGCCACCCAGCTGG - Intergenic
1075713828 10:124544576-124544598 GGCCAACAGTCTCACCCTGCAGG + Intronic
1076764314 10:132624830-132624852 GCCCCACAGTGTCACCCTCCTGG + Intronic
1077019223 11:410162-410184 GGCTCAAAGAGACACCCTGCTGG - Intronic
1077158139 11:1100586-1100608 GGCTCTCAGAGTCACCAGGCAGG - Intergenic
1077265700 11:1648473-1648495 GGCCCGCAGGGTCCCACTGCGGG + Intergenic
1077265701 11:1648475-1648497 GGCCCGCAGTGGGACCCTGCGGG - Intergenic
1077315923 11:1919329-1919351 GGTCCCCAGAGCCAGGCTGCCGG - Intergenic
1078427222 11:11261718-11261740 GGGCCCCAGTCTCACCCTGGAGG + Intergenic
1078889191 11:15538769-15538791 GGCTCCCAGAGTTCCCCAGCAGG + Intergenic
1081991321 11:47339179-47339201 GGGCCCCACAGGGACCCTGCTGG + Intronic
1082003990 11:47409745-47409767 GGCAGCCAGAGACACCCAGCTGG + Intronic
1083293005 11:61700154-61700176 GGCCCCCAGAGCCCTCCTGTTGG + Intronic
1083614810 11:64021156-64021178 GGTGCCCAGAGTCACTCAGCTGG + Intronic
1083638890 11:64134904-64134926 GGCCCTCAGAGTCTCCCTCCAGG + Intronic
1083755558 11:64789948-64789970 GGCCCCCATAGTGTGCCTGCAGG - Exonic
1083818338 11:65150741-65150763 GTCAGCCAGAGTCACCCTGCTGG + Intergenic
1083829515 11:65222475-65222497 GGCTTCCAGAGTCATCCCGCTGG + Intergenic
1084062594 11:66685958-66685980 TGCCCCCAGTGTCACCCGTCGGG - Exonic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084681588 11:70669530-70669552 GGCCTCCAGAGCCACCGGGCAGG + Intronic
1085694358 11:78691261-78691283 GTCCTCCAGGGTCACGCTGCTGG - Intronic
1086291068 11:85309810-85309832 GGGCACCAGACTCAGCCTGCAGG - Intronic
1088786469 11:113186627-113186649 GGCCCCCAGAGTGCCGATGCGGG - Intronic
1088818305 11:113436074-113436096 GGTCCCCGGTGTCAGCCTGCTGG - Intronic
1089387397 11:118077298-118077320 GGGCCCCACACTCACCATGCTGG - Exonic
1089494429 11:118901186-118901208 GGCCTCCAGAGAATCCCTGCTGG + Exonic
1091369071 11:135043834-135043856 TGCTCCCTGAGTCTCCCTGCAGG + Intergenic
1091774413 12:3175104-3175126 TGCCCCCAGCCTCGCCCTGCAGG - Intronic
1095908983 12:47406437-47406459 GGCCCAAAAAGTCACCATGCTGG - Intergenic
1096105935 12:48997198-48997220 GGCCCCCGAAGTAAACCTGCGGG - Exonic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1102614903 12:114145109-114145131 GGCCTCAACTGTCACCCTGCAGG - Intergenic
1103230732 12:119328309-119328331 TGCCCCCAGTGGTACCCTGCAGG - Intergenic
1103714328 12:122935220-122935242 GGCCCACAGGGTCACCCTCAGGG - Intronic
1103848741 12:123917573-123917595 GTCCCCCACAGTCACGCTGAAGG + Exonic
1104516620 12:129432907-129432929 GGCCCCTTGGGTCACCTTGCAGG + Intronic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1104747571 12:131219785-131219807 GACCCCGAGGGTCAGCCTGCTGG + Intergenic
1105068345 12:133218760-133218782 GGTCCCCAGAGTTCCCCTGGGGG - Exonic
1107727951 13:43318950-43318972 GCCCCACAGAGTCAACCTGGAGG + Intronic
1109815545 13:67578154-67578176 AGCCCCCAAAGTCATCATGCGGG + Intergenic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1113960682 13:114124074-114124096 GGTCCCGAGAGACACCGTGCCGG - Intronic
1113967768 13:114164158-114164180 GGCCCCCTCGGTCCCCCTGCCGG - Intergenic
1114385274 14:22247613-22247635 AGCTCCCAGAGTCTTCCTGCTGG + Intergenic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1115544455 14:34453191-34453213 GGCCCTCATCCTCACCCTGCAGG - Intronic
1116871058 14:50069639-50069661 GGCCCCCAGATTGAACCTGTAGG + Intergenic
1119410790 14:74428896-74428918 AGCCCCCAGTGTTACCCTTCTGG - Intergenic
1119668940 14:76504296-76504318 GGCCACCAGAGGCACCTGGCTGG + Intergenic
1120743397 14:88132195-88132217 GGTCCCCAGAGTTACACTGATGG - Intergenic
1121226210 14:92323543-92323565 GGCCGCCAGCGCCACCGTGCCGG + Intronic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1122297326 14:100712833-100712855 GGTCCCCAGGGCCACCCAGCAGG + Intergenic
1123110955 14:105866653-105866675 GGCCCCCTCAGGCACCGTGCGGG + Intergenic
1125417341 15:39467364-39467386 TGCTCCCAGAGCCCCCCTGCTGG + Intergenic
1125827513 15:42688919-42688941 GGACCTCAGAATCACCTTGCTGG + Exonic
1127635078 15:60861397-60861419 GGTCCTCAGAGTAACCCTGGAGG + Intronic
1128232741 15:66046932-66046954 GGTCCCCAGGTTCCCCCTGCAGG + Intronic
1128918506 15:71589550-71589572 GGCCCCATGTGTCACCCTGTTGG + Intronic
1129724935 15:77896884-77896906 GGCCACCAATGTCTCCCTGCTGG + Intergenic
1131254479 15:90852957-90852979 GGCCCTTCGAGTCACCTTGCTGG - Intergenic
1132008076 15:98249076-98249098 GGGACCCACAGTCACCCTGCTGG - Intergenic
1132704564 16:1237513-1237535 GCCCTCCCGAGTCACCCTGAGGG + Intergenic
1132706949 16:1248912-1248934 GCCCTCCCGAGTCACCCTGAGGG - Intergenic
1132976313 16:2712799-2712821 GGCCGCCCGAGTCGCCCTGCGGG + Exonic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133130632 16:3674291-3674313 GGACAACAGAGTCACCCTGAGGG + Intronic
1133325114 16:4937327-4937349 GGCCTCCGGAGTCCCCCGGCTGG - Intronic
1133804851 16:9117601-9117623 TGTCCCCAGAGTAACCCTGTAGG + Exonic
1134090693 16:11390300-11390322 GGCCCCCAGGGCCGCCCTGATGG + Exonic
1135063482 16:19290218-19290240 GGCCCCCAAGGTCTCCCAGCTGG - Intronic
1135381013 16:21996251-21996273 GGTGACCCGAGTCACCCTGCAGG + Intronic
1136247283 16:28983251-28983273 GGCTCCCAGCATCACCCAGCAGG - Exonic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1136870002 16:33798271-33798293 TGCCCCCAAAGTGACACTGCGGG - Intergenic
1138599687 16:58047122-58047144 GGCACCTGGGGTCACCCTGCCGG + Intergenic
1139974192 16:70795884-70795906 GGCCCCCACTGTCTCACTGCTGG - Intronic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140472813 16:75224698-75224720 GGCCGCCAGAGTCGCCCTGTGGG - Exonic
1140473629 16:75227983-75228005 GGCTGTCGGAGTCACCCTGCAGG - Intergenic
1142067420 16:88070823-88070845 GGCGCCCAGAGCAAACCTGCTGG - Intronic
1142217059 16:88834927-88834949 GGCCTCCGGGGTCACCCTTCGGG + Intronic
1203102168 16_KI270728v1_random:1317783-1317805 TGCCCCCAAAGTGACACTGCGGG + Intergenic
1142811823 17:2399154-2399176 GCCCCCCAGAATCCCCCGGCAGG - Intronic
1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG + Intergenic
1142925304 17:3231260-3231282 GTCCCCCAGAGCCACCATGTGGG - Intergenic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1143875521 17:9987934-9987956 GGCCCCCAGTGGCCTCCTGCTGG + Intronic
1144830502 17:18128424-18128446 CGCCCCCAGGATCACCTTGCTGG - Intronic
1144944489 17:18962830-18962852 TGCCCCCTGTTTCACCCTGCTGG + Intronic
1145118259 17:20232118-20232140 GGACCCCAGAGTCCCCGTGTTGG - Intronic
1146685984 17:34841909-34841931 AGCCCCCAGCCTCACTCTGCAGG - Intergenic
1147637862 17:41974868-41974890 GGCCTCCAGAGGCACCATGGAGG - Exonic
1147924044 17:43935839-43935861 GGATCCCAAAGTAACCCTGCAGG + Intergenic
1148901946 17:50884993-50885015 GGCCACCACACTCACCCAGCAGG + Intergenic
1151445452 17:74160687-74160709 GGGCCTCAGAGTCACCGTGTAGG - Intergenic
1152419315 17:80183627-80183649 GGCCCCCAGCTTTAACCTGCTGG - Intronic
1152609378 17:81308144-81308166 GGTCCTCACAGGCACCCTGCAGG + Intergenic
1152634923 17:81426996-81427018 GGCTCCCAGCGACACCCTGGTGG + Intronic
1155085546 18:22454296-22454318 TGACCCCAGAGTCCCCGTGCTGG + Intergenic
1157276484 18:46314367-46314389 GTCTCCCAGAGTTCCCCTGCAGG + Intergenic
1159124471 18:64207168-64207190 TGCCCCCAGAGCCTACCTGCTGG - Intergenic
1159586539 18:70288674-70288696 GGCCCCCAGAGTCCCTGTCCTGG - Intergenic
1159619415 18:70620168-70620190 GGTCCACAGACCCACCCTGCTGG - Intergenic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1161288474 19:3480446-3480468 GGCCCCCAGGGTCTCCATGACGG + Exonic
1162118330 19:8445450-8445472 GGCCCCCGAGGTCACCCTCCCGG - Intronic
1163288850 19:16365578-16365600 GTCCCCCAGGGTGCCCCTGCCGG - Intronic
1163626316 19:18391924-18391946 GACGCCCTGAGTCACCCAGCAGG + Exonic
1164455118 19:28400386-28400408 GGGCCCCAAAGCCACTCTGCTGG - Intergenic
1167516055 19:49923820-49923842 GGGCCCTAGAGCCAGCCTGCTGG - Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167689695 19:50977676-50977698 GTCCCCCTGAGTCACCCTAGAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
925212409 2:2061253-2061275 GGCCCCCACAGCCAGGCTGCAGG - Intronic
925918889 2:8625929-8625951 GGCACTCTGAGTCAGCCTGCAGG + Intergenic
926750895 2:16197686-16197708 GGCCCAGCCAGTCACCCTGCTGG + Intergenic
927882128 2:26696301-26696323 GGCTCCCCCAGTCACCCAGCTGG + Intronic
928232177 2:29507892-29507914 GGCCCCCAGCGTGGCTCTGCCGG + Intronic
929856280 2:45640877-45640899 GGCTTCCACAGTCACCCTGAAGG - Intergenic
930026844 2:47034269-47034291 TGCCCCCTGAGGCCCCCTGCAGG - Intronic
932413035 2:71558466-71558488 GGCACCATGAGTCACCTTGCAGG - Intronic
933899816 2:86841389-86841411 GGCACCCAGAGCCAGGCTGCAGG - Intronic
933990402 2:87629801-87629823 GGCCTGCTGAGTCACACTGCAGG - Intergenic
935780742 2:106507836-106507858 GGCACCCAGAGCCAGGCTGCAGG + Intergenic
936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG + Intergenic
938063888 2:128270872-128270894 TGCCCTCAGAGTCACCCTTGGGG - Intronic
946010156 2:216558064-216558086 GGCTCCCAGAGGCCCTCTGCTGG + Intronic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
948350972 2:237340632-237340654 GGCCCAGAGAGTCATCCTGCAGG - Exonic
948482602 2:238259641-238259663 GGCTCCCAGGCACACCCTGCTGG + Intronic
948513702 2:238489595-238489617 GGCCACCACAGTGAGCCTGCCGG + Intergenic
948806609 2:240455907-240455929 GGCCCCCTGAGGCCCGCTGCAGG - Intronic
1168813377 20:720680-720702 GGCCTGCAGAGTCACCCTCTAGG + Intergenic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1170570898 20:17632025-17632047 AACTCCCACAGTCACCCTGCAGG + Intronic
1170750067 20:19137484-19137506 TGTTCCCAGGGTCACCCTGCTGG - Intergenic
1171440874 20:25161953-25161975 GTCCCCCAGAGCCATCCTTCAGG + Intergenic
1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG + Intergenic
1174107288 20:48171796-48171818 GGGCCCCAAAGCCCCCCTGCTGG + Intergenic
1175807064 20:61835576-61835598 GGCCCACAGAGGCAGCCTCCTGG + Intronic
1175909267 20:62396908-62396930 GGCCCCAAGCAACACCCTGCTGG + Intronic
1176050053 20:63114315-63114337 GTCCCCCAGAGACACACTGGAGG + Intergenic
1176107524 20:63396396-63396418 GGCCCACAGCATCAACCTGCTGG - Intergenic
1179411901 21:41168512-41168534 CGCGGCCAGAGTCCCCCTGCAGG - Exonic
1179567078 21:42255975-42255997 GTCCCCCAGAGTGAACCAGCTGG + Intronic
1179978868 21:44886202-44886224 AGCCCCCAGAAGCACCCGGCCGG + Exonic
1180077954 21:45472697-45472719 GGCTCTCAGCGTCACACTGCGGG - Intronic
1180824236 22:18851914-18851936 GGCCACCAGGGTGACCCGGCTGG - Intronic
1180831197 22:18907020-18907042 TACCACCAGAGTCAGCCTGCCGG - Intronic
1181124664 22:20695068-20695090 GGCCACCAGGGTGACCCGGCTGG - Intergenic
1181188500 22:21122634-21122656 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1181210700 22:21287859-21287881 GGCCACCAGGGTGACCCGGCTGG - Intergenic
1181398810 22:22639029-22639051 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1181400505 22:22647797-22647819 GTCCCCCAGAGTCCCCTTCCTGG - Intronic
1181501541 22:23318385-23318407 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1181648867 22:24247994-24248016 GTCCCCCAGAGTCCCCTTCCTGG + Intergenic
1181650612 22:24257030-24257052 GGCCACCAGGGTGACCCGGCTGG - Intergenic
1181702484 22:24628895-24628917 GTCCCCCAGAGTCCCCTTCCTGG - Exonic
1181706769 22:24653708-24653730 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184512246 22:44940571-44940593 GGCCCCCAGAGAAACAGTGCTGG + Intronic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185010202 22:48308713-48308735 GCTGCCCAGAGTCACCCAGCGGG + Intergenic
1185193714 22:49454922-49454944 GGCCCCCAGGGTAGCCCTGATGG - Intronic
1203216247 22_KI270731v1_random:7571-7593 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1203274373 22_KI270734v1_random:77818-77840 GGCCACCAGGGTGACCCGGCTGG - Intergenic
1203281284 22_KI270734v1_random:132291-132313 TACCACCAGAGTCAGCCTGCCGG - Intergenic
953142738 3:40244638-40244660 GGCTCCCTGTTTCACCCTGCAGG - Intronic
954698751 3:52441033-52441055 GGCCCCCAGCATCATTCTGCAGG + Exonic
969529953 4:7725143-7725165 GGTCCCCACAGCCCCCCTGCAGG + Exonic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
973254350 4:48094039-48094061 GGCTCCCTGACTCACCCAGCTGG + Intronic
974831291 4:67192827-67192849 GACCCCAAGAGTCACACTGCCGG + Intergenic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
978318530 4:107466986-107467008 GGCCCCCACAGTCACCTTGAGGG + Intergenic
983533132 4:168832036-168832058 AGCCTCCTGAGTCACCCGGCGGG + Intronic
985679034 5:1246428-1246450 GGCCCCCTGAGCCACCCGGGCGG - Intergenic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
988717281 5:33840736-33840758 GATCCCCAGGGCCACCCTGCAGG + Intronic
989716405 5:44468347-44468369 GGCCCCAAGAGGCACCTTGTTGG + Intergenic
993501564 5:88672838-88672860 TGCCCGCAGAGTCCCGCTGCGGG - Intergenic
994492451 5:100463913-100463935 CGCCCACAGAGTCTCCCTGATGG - Intergenic
997665953 5:135629615-135629637 CGCCCACAGAGTCAGCCTGCTGG - Intergenic
998135419 5:139671734-139671756 GGCCCTGAGAGCCACCCTCCAGG + Intronic
998339843 5:141407918-141407940 GGCGCCCAGAGGCTCCGTGCGGG - Intronic
1001556643 5:172641494-172641516 GCTCTCCAGAGTCACCCAGCGGG - Intronic
1002280011 5:178124410-178124432 TGGCCCCAGAGCCACCCAGCCGG - Exonic
1004263685 6:14130643-14130665 GGCCTCCTGAGTCAACCTTCTGG - Intronic
1006167106 6:32071422-32071444 GGCTCCCACATCCACCCTGCAGG + Intronic
1006434792 6:34020464-34020486 TGCTGCCAGAGTCACCCTGGGGG + Intronic
1007951400 6:45875760-45875782 GGACTCTAGAGCCACCCTGCTGG - Intergenic
1009950624 6:70391658-70391680 GTCCCCCAGAGTTCCCCAGCAGG + Intergenic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1012301269 6:97591557-97591579 GGCTCCCAAGGTCACCCTGAGGG - Intergenic
1013270113 6:108537472-108537494 TGCCCCGAGGGTCACCCAGCTGG - Intergenic
1017428546 6:154347301-154347323 TGACCCCAGAGTCAAACTGCTGG + Intronic
1018694646 6:166382440-166382462 GGCGCCCACTGTCACCCTGCCGG + Intronic
1018694663 6:166382496-166382518 AGCGCCCACTGTCACCCTGCCGG + Intronic
1019419605 7:944902-944924 GTCACCCAGAGTCACCCCCCCGG - Intronic
1019911425 7:4102637-4102659 GGCCACCAGAGCCTCCCAGCAGG + Intronic
1021600090 7:22356567-22356589 GGCCCCCAGATTCAGGCTGCGGG - Intronic
1023876287 7:44288071-44288093 GGCCCCTAGAGTGTCCCAGCAGG + Intronic
1024417028 7:49119613-49119635 GGACCCCAGAGCAACCTTGCCGG - Intergenic
1025747356 7:64255090-64255112 GACACCCAGAGTCCCCCTCCAGG - Intronic
1029209851 7:98898081-98898103 GAAACCCAGAATCACCCTGCTGG + Intronic
1029260185 7:99296910-99296932 TGCCCTCAGACTCACCCTGCAGG - Intergenic
1029359973 7:100081532-100081554 GGCCCGCAGGGTCCCCCGGCCGG - Intronic
1030106075 7:105988451-105988473 GGGTCCACGAGTCACCCTGCTGG + Intronic
1031026551 7:116685987-116686009 GGCCACCAGGGTCCCCCTCCTGG + Intronic
1032080194 7:128854794-128854816 GGCCCCCAGCGCCAGCCTCCCGG - Exonic
1032538490 7:132684316-132684338 GGCCCCCTCAGACACCCTGGAGG - Intronic
1033007394 7:137581704-137581726 AGCTCCCAGAGTCATCCTGAAGG + Intronic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1033605862 7:142928243-142928265 GGCCCCCTGACTCATCCTGGTGG - Intronic
1036634310 8:10538469-10538491 GCCCCCCACTGTCACCCTGTGGG - Exonic
1036643250 8:10597140-10597162 GGCACCCTGGGTCACCATGCTGG + Intergenic
1036751313 8:11445237-11445259 GGTCCCCAGAGCCAGCCAGCAGG + Intronic
1037886742 8:22599589-22599611 GGCCCCCAGACACTCCCAGCGGG - Intronic
1038612657 8:29069988-29070010 GTCCCCCAGAGGCACTTTGCGGG + Exonic
1039922805 8:41905163-41905185 GGCCTGCAGACTCACCCTGGTGG - Intergenic
1040870954 8:52100176-52100198 GGCCCCCAGAGCTCCCCTGTCGG - Intergenic
1043052806 8:75404356-75404378 CGCCCCCACCCTCACCCTGCTGG + Intergenic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1048635345 8:136289450-136289472 GGCCCCCAGAGTTAGCCTGTCGG + Intergenic
1048906523 8:139094487-139094509 GGCCTCCACATTCAGCCTGCTGG - Intergenic
1049221482 8:141430672-141430694 GGAGCCCAGAGTCAGCCTGGAGG + Intronic
1049315341 8:141964067-141964089 TGGCCCCAGCGTCACCCTGAGGG + Intergenic
1049369582 8:142257465-142257487 GGCTCCCAGAGTCTCCTGGCTGG - Intronic
1051655693 9:19379830-19379852 CGCCCCCAGAGTCATTCCGCGGG - Intronic
1053819146 9:41948361-41948383 GGATCACAGAGCCACCCTGCCGG + Intronic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1057218628 9:93243695-93243717 GGGACCCAGCGTCAACCTGCCGG - Intronic
1057492744 9:95534518-95534540 GTTGCCCAGAGTCTCCCTGCAGG + Intergenic
1060890947 9:127187959-127187981 GGCCCACAGAATCAACCTCCAGG + Intronic
1060985272 9:127815908-127815930 GGCCCCCACAGTGAGCATGCCGG - Intronic
1061397226 9:130349698-130349720 GGTGCCCAGACTCAGCCTGCTGG + Intronic
1061584717 9:131558307-131558329 GGCCCCCAGATTCCCTCTGCAGG - Intergenic
1061808085 9:133147613-133147635 GTCCCCCAGAGGGACCCTGCCGG + Intronic
1061955739 9:133960429-133960451 GGCACTCAGGGTCAGCCTGCAGG - Intronic
1061979211 9:134090516-134090538 GGCCCCAAAAGACACCCTCCTGG + Intergenic
1062177049 9:135169136-135169158 GGCATCCAGGGTCAACCTGCCGG - Intergenic
1186652612 X:11577352-11577374 GTCTCGCAGAGTCTCCCTGCAGG - Intronic
1187251037 X:17598101-17598123 AGCCCCCTGAGTCTACCTGCTGG - Intronic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1190279771 X:48922086-48922108 GGCCCCCAGACAGACCCTGCTGG + Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic
1200151648 X:153954192-153954214 GGCACCCAGCGTCACCCCCCAGG - Exonic