ID: 1096406598

View in Genome Browser
Species Human (GRCh38)
Location 12:51348416-51348438
Sequence GAGTGTGCCAGAATGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096406598_1096406611 22 Left 1096406598 12:51348416-51348438 CCCTCCAGCATTCTGGCACACTC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1096406611 12:51348461-51348483 TAGGGAACCCGGGGCCTCTTTGG 0: 1
1: 0
2: 0
3: 5
4: 97
1096406598_1096406608 11 Left 1096406598 12:51348416-51348438 CCCTCCAGCATTCTGGCACACTC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1096406608 12:51348450-51348472 GTGAGCTGCGCTAGGGAACCCGG 0: 1
1: 0
2: 0
3: 12
4: 112
1096406598_1096406610 13 Left 1096406598 12:51348416-51348438 CCCTCCAGCATTCTGGCACACTC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1096406610 12:51348452-51348474 GAGCTGCGCTAGGGAACCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1096406598_1096406607 4 Left 1096406598 12:51348416-51348438 CCCTCCAGCATTCTGGCACACTC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1096406607 12:51348443-51348465 AAGAGGGGTGAGCTGCGCTAGGG 0: 1
1: 0
2: 1
3: 10
4: 96
1096406598_1096406609 12 Left 1096406598 12:51348416-51348438 CCCTCCAGCATTCTGGCACACTC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1096406609 12:51348451-51348473 TGAGCTGCGCTAGGGAACCCGGG 0: 1
1: 0
2: 1
3: 7
4: 140
1096406598_1096406606 3 Left 1096406598 12:51348416-51348438 CCCTCCAGCATTCTGGCACACTC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1096406606 12:51348442-51348464 GAAGAGGGGTGAGCTGCGCTAGG 0: 1
1: 0
2: 2
3: 13
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096406598 Original CRISPR GAGTGTGCCAGAATGCTGGA GGG (reversed) Intergenic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900484663 1:2916543-2916565 GAATGTGTCTGAAGGCTGGAGGG - Intergenic
901026384 1:6280718-6280740 CATTGTGTAAGAATGCTGGAGGG - Intronic
904618785 1:31763578-31763600 GTCTGTGTCAGAATTCTGGAGGG + Intronic
907309809 1:53532755-53532777 GACTGTGGGAGAGTGCTGGAAGG + Intronic
910093042 1:83488093-83488115 GAGTGAGCCAGCATGCCAGAGGG - Intergenic
911162460 1:94694756-94694778 TACTGTGCCAGAAAGGTGGAAGG - Intergenic
911835492 1:102614120-102614142 GAATGTGCCAGTCTGCTTGATGG - Intergenic
911965208 1:104360146-104360168 AAGTGTACCAGAATGCTGAAAGG - Intergenic
913646931 1:120866070-120866092 GAGTGTTCAGGAATGATGGAAGG + Intergenic
914079716 1:144396794-144396816 GAGTGTTCAGGAATGATGGAAGG - Intergenic
914174618 1:145265331-145265353 GAGTGTTCAGGAATGATGGAAGG - Intergenic
914328928 1:146648142-146648164 GAGTGTGCCAGATGGGTTGATGG + Intergenic
914529345 1:148506819-148506841 GAGTGTTCAGGAATGATGGAAGG - Intergenic
917012255 1:170488113-170488135 GAGTGTGCCAGTCTTCTTGATGG - Intergenic
918250065 1:182695381-182695403 GAGTGTGCTAAAATGGAGGAAGG - Intergenic
918797249 1:188916714-188916736 TAGTGTGCCAGCAGGATGGATGG - Intergenic
919124479 1:193378700-193378722 GATTTTGGCAGACTGCTGGAAGG + Intergenic
920192394 1:204201939-204201961 GATTCTGCCACACTGCTGGATGG - Intronic
920197128 1:204236119-204236141 GAGTGTGGGATAATGGTGGAAGG + Intronic
921786069 1:219230892-219230914 GAGTCTGGCACAATGTTGGATGG - Intergenic
922188291 1:223295485-223295507 GAGTGTGCCATAATAGAGGATGG + Intronic
923788412 1:237090458-237090480 GAAGGTGCCACATTGCTGGAAGG + Intronic
923789806 1:237102351-237102373 GTGTGTGCCTGCATGCAGGATGG - Intronic
1062770777 10:98916-98938 GAGTGTGGGATAATGGTGGAAGG - Intergenic
1064550076 10:16491735-16491757 GAGAGTCCCAGCATTCTGGAGGG - Intronic
1067479898 10:46587845-46587867 GAGTGTGTCGGAAGGCTGTATGG - Intronic
1067614839 10:47753952-47753974 GAGTGTGTCGGAAGGCTGTATGG + Intergenic
1071630246 10:87213915-87213937 GAGTGTGTCGGAAGGCTGTATGG + Intergenic
1072452673 10:95551311-95551333 GAGGCTCCCAGAATGCAGGAAGG + Intronic
1075270225 10:121043021-121043043 GAGTGGGCCAGATTGCTGTGTGG + Intergenic
1080305299 11:30828602-30828624 GAGGGTGCCAGAAGACTTGAAGG - Intergenic
1080582408 11:33654881-33654903 TAGTCTGCCATCATGCTGGAGGG + Intronic
1083201073 11:61121438-61121460 GAGGGTGCCAGAAGGAGGGAAGG + Intronic
1084068361 11:66718463-66718485 CAGTATGCCAGCGTGCTGGAAGG - Intronic
1084758530 11:71253416-71253438 GAGTTTTCCAGTATTCTGGAAGG + Intergenic
1084950410 11:72662217-72662239 GAGTGGGGCAGAAAGCTGCAGGG + Intronic
1086157363 11:83682365-83682387 CAGTGAGCGAGAATGCTGCATGG - Intronic
1086278334 11:85158209-85158231 GGGTGTGCGATAATGGTGGAAGG + Intronic
1088871949 11:113897963-113897985 GAGTGTTCCAGAAAGATGGGAGG - Intergenic
1095774010 12:45992045-45992067 TAGTCTGCGAGAATGCAGGAAGG - Intronic
1096106481 12:48999277-48999299 GGGTGGGGCAGGATGCTGGATGG - Exonic
1096406598 12:51348416-51348438 GAGTGTGCCAGAATGCTGGAGGG - Intergenic
1096485388 12:51976921-51976943 GAGTGTGCCAGATTCCTGTGAGG + Intronic
1101263828 12:103063850-103063872 GAGTGTGGGATAATGGTGGAAGG + Intergenic
1101721036 12:107350970-107350992 CATTGTGCCATAGTGCTGGATGG + Intronic
1101855477 12:108439297-108439319 CAGTGTGCAACAATGCTGGCTGG + Intergenic
1103583696 12:121935636-121935658 GAGTGTGTCAAAAGGCTGGTAGG - Intronic
1104153123 12:126104422-126104444 GAGTGTGCCAGAATCATTTATGG - Intergenic
1105928535 13:25031292-25031314 GGGTCTACCATAATGCTGGACGG - Intergenic
1111988174 13:95086730-95086752 GAATGAGCCAGAAGGATGGATGG - Intronic
1112578432 13:100658050-100658072 AAGTATGCCAGTATGCTGGAGGG + Intronic
1114938245 14:27572705-27572727 GAGTGTGCCAGTCTACTTGATGG - Intergenic
1114965736 14:27957046-27957068 GGATGTGACATAATGCTGGAAGG - Intergenic
1116366743 14:44076379-44076401 GAGTGCTCCAGAATAATGGATGG - Intergenic
1117400988 14:55358438-55358460 GAGGGTGGGAGGATGCTGGAGGG - Intronic
1119948136 14:78716106-78716128 GACTGGGCCAGAATGCTGGGAGG + Intronic
1123772274 15:23540484-23540506 GATTGTGGCAGAAAGCTGGAGGG - Intergenic
1129572291 15:76700591-76700613 GAGTGTGCCAGCCTTCTTGATGG + Intronic
1130175102 15:81559883-81559905 GAGTGTGCCAGTCTACTTGATGG + Intergenic
1130444498 15:83987622-83987644 GAGTTTGCCAGAAAGGAGGAAGG + Intronic
1130530894 15:84747722-84747744 GAGTCTGGCAGAAGGCTGGGAGG - Intergenic
1130726677 15:86446163-86446185 GAGAGTGGCAGGTTGCTGGAGGG - Intronic
1131711776 15:95063104-95063126 GAGTGTGCCGGTATTCTTGATGG + Intergenic
1136228805 16:28875440-28875462 GAGTGAGGCAGGATGCTGAAAGG - Intergenic
1140004638 16:71062801-71062823 GAGTGTGCCAGATGGGTTGATGG - Intronic
1147059585 17:37864586-37864608 GAATGTGCCAGAATGCTGAGAGG - Intergenic
1148408857 17:47447076-47447098 GAATGTGCTAGAATGCTGAGAGG - Intergenic
1148955284 17:51348620-51348642 GAGTGTGCTAGCAAGATGGAAGG + Intergenic
1151244812 17:72786249-72786271 AAGTGTGCCAGAATAGTTGATGG + Intronic
1153251593 18:3127640-3127662 AAGTGTGCCTGAATGGTGAAAGG - Intronic
1153799631 18:8658000-8658022 GATTGGGCCAGAAAGCAGGAAGG - Intergenic
1154371260 18:13765277-13765299 GAGTGTGCCAGTTTTCTTGATGG - Intergenic
1155496188 18:26445255-26445277 CAGAATGCCAGAGTGCTGGAGGG - Intergenic
1162786773 19:13040026-13040048 GAAGCTTCCAGAATGCTGGAAGG + Intronic
1163313907 19:16530190-16530212 GCGTGTCCCAGAATGTTGGTGGG - Intronic
1164651270 19:29892576-29892598 GATGGTGCCAGGAGGCTGGAAGG - Intergenic
1166807859 19:45497597-45497619 CTGTGTGCCTGAATCCTGGATGG + Intronic
1166948394 19:46411313-46411335 GAGTGTGCCAGAAGGCTCTCCGG + Exonic
1167697360 19:51023111-51023133 GTGTGTGCCAGCGTGCAGGAAGG - Exonic
1168539659 19:57199617-57199639 GGGTGTGGGATAATGCTGGAAGG - Intronic
925308740 2:2867078-2867100 GAGTCTGCCGGGATGCTTGAGGG - Intergenic
925806499 2:7655626-7655648 GAGTGGGGCAGAATTCTGCATGG - Intergenic
928077020 2:28274161-28274183 GAGTGGGAGAGAAAGCTGGATGG - Intronic
928637286 2:33260811-33260833 GAGGCTGCCAGGATGCTGGCTGG - Intronic
930295442 2:49547811-49547833 GAGTGTGGGATAATGGTGGAAGG - Intergenic
931813799 2:65880492-65880514 GAGTGTGGCAGATTGCAGGGCGG - Intergenic
932194379 2:69770484-69770506 GAATGTGCCACAAGGCTGGCAGG + Intronic
932491555 2:72126333-72126355 GATTGTGCCAGGGTGCCGGAAGG - Intergenic
932500997 2:72182605-72182627 GAGTGTGCCAAGAAGCTGAATGG + Intronic
934077741 2:88442229-88442251 GAATGTGCCTGGAGGCTGGAAGG + Intergenic
935200651 2:100853767-100853789 ATGTGTGCCAGAAGGCTGAACGG - Intronic
935223530 2:101034960-101034982 GAGTGTGCCAGGAAGCATGAAGG + Intronic
935868448 2:107417910-107417932 GAGTTGGCCAGAAACCTGGAAGG - Intergenic
935943398 2:108264960-108264982 GAGTGGTCCATAATGCTGGTGGG - Exonic
937566063 2:123290435-123290457 GAATGTGACAAAATGCTTGAAGG + Intergenic
940035676 2:149310145-149310167 GAGTGTGGAAGAGTGTTGGAGGG + Intergenic
940287882 2:152050244-152050266 CAGTGTGCCAAAAGGATGGAAGG - Intronic
943952459 2:194147623-194147645 GAGTGTGCCAGTCTTCTTGATGG + Intergenic
944207269 2:197169754-197169776 GTGTGTATCAGAATCCTGGAAGG - Intronic
946173324 2:217908205-217908227 GAGGGTGCCAGAGTGAGGGATGG - Intronic
948648946 2:239426853-239426875 GAGGGTGACAGAAGGATGGAAGG - Intergenic
948918898 2:241052336-241052358 GGGGCTGCCAGAATGCAGGAAGG - Exonic
949080492 2:242094432-242094454 GAGTGGGCCAGAATTAAGGATGG - Intergenic
1169902567 20:10568517-10568539 GAGTCTTACAGAATGATGGAAGG - Intronic
1171271722 20:23823495-23823517 GAGTGGGCCAGACTGCTGCCCGG - Intergenic
1177133016 21:17279971-17279993 GTGTCTGGCAGAATGCTTGATGG + Intergenic
1178090203 21:29154682-29154704 CAGTGTAGCAGAATCCTGGAAGG - Intronic
1178740248 21:35193248-35193270 GGGTGTTACAGAATGATGGAGGG - Intronic
1179233980 21:39529013-39529035 GAGTGAGCCAGCAAGCTAGAGGG + Intergenic
1182071576 22:27467291-27467313 GAGTGTGCAAGAATGCAGTAGGG + Intergenic
1182847706 22:33445373-33445395 GAGAGGTCCAGAATGCTGAAAGG + Intronic
1185213702 22:49586799-49586821 GGATGTGCCTGAATGCTGCAGGG + Intronic
951034349 3:17916566-17916588 AAGGGTGCCAGAATACTGTAGGG + Intronic
954424877 3:50438064-50438086 GAGAGTGCCAGGATGCTGGTGGG + Intronic
962985030 3:140528339-140528361 GAGTGTGCAATAAGGCTGCAAGG - Intronic
967210862 3:187167279-187167301 GAGTGTGCCAGACTCCCAGATGG + Intronic
969422869 4:7107521-7107543 CAGTGTCTCAGAAAGCTGGAAGG - Intergenic
969623240 4:8289510-8289532 GGCTGTGGCAGAATGCTGGCAGG + Intronic
972230891 4:37071781-37071803 GACTGTGCCAGAATGCATGGAGG + Intergenic
974942939 4:68490244-68490266 GAGTGTGCCAGTCTTCTTGATGG + Intronic
975556521 4:75671548-75671570 GAGTGAACCAGAATGCTTGTGGG - Intronic
976634467 4:87273808-87273830 TAGTTTGCAAGAATGGTGGAGGG + Intergenic
979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG + Intronic
983488734 4:168362513-168362535 CAGTGTGCCAGCAGGCTGTATGG - Intronic
984708357 4:182864079-182864101 GAATGTGCCAGCATTCTGCAGGG + Intergenic
985840144 5:2299934-2299956 GAGGCTGCCACAATGCTGGCTGG + Intergenic
987288678 5:16487350-16487372 GAGTGTGAGAGAAAGCTGGAAGG - Intronic
988809742 5:34772685-34772707 GAGCATGCCAGGAGGCTGGAGGG - Intronic
989439727 5:41456233-41456255 GAGAGTTCCAGAATTCTTGAGGG - Intronic
990050695 5:51495761-51495783 GAGCACGCCAGAATGCTGCAGGG + Intergenic
992782633 5:80141994-80142016 CTGTGTGCCAAAATGCTGGTGGG - Exonic
993429377 5:87813505-87813527 GAGTGTGCCAGTCTTCTTGATGG - Intergenic
994055555 5:95410261-95410283 GAGTGGGCCAGGAAGCCGGAAGG + Intronic
994187570 5:96832081-96832103 GAGTGTGCCAGAACCATGCAGGG + Intronic
994384681 5:99116609-99116631 AAGTGTTCCAGCATGATGGAAGG - Intergenic
994761203 5:103856359-103856381 GAGTGAGCCATGATACTGGATGG - Intergenic
996888668 5:128389917-128389939 GAGTGTGCCAGTCTTCTTGATGG + Intronic
998148527 5:139744262-139744284 GAGCCTCCCAGAATGCAGGAAGG - Intergenic
998185510 5:139976156-139976178 GAGTGTCCCAGAGTACTGAAGGG - Intronic
999353670 5:150903834-150903856 GAGTATACCACAATGCAGGAAGG + Intronic
999617259 5:153437476-153437498 GAGTGTGCTGGAATGCTTGAGGG - Intergenic
1001368375 5:171168897-171168919 GAGGGTGACAGAAGGCAGGAAGG - Intronic
1001579631 5:172789918-172789940 CAGAGTGCCTGAATGGTGGAGGG + Intergenic
1002443047 5:179274148-179274170 GATGGTGCCAGCAGGCTGGATGG - Intronic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1003385079 6:5660085-5660107 GAGAGTGCAAGATTGGTGGATGG - Intronic
1006373051 6:33657201-33657223 GAGAGTGCCAGTCTGATGGAGGG + Intronic
1009184285 6:60555103-60555125 GAGTGTGCCAGTTTACTTGATGG + Intergenic
1009271912 6:61624658-61624680 TGGTGTCCCATAATGCTGGAAGG + Intergenic
1012942308 6:105428159-105428181 GTGTCTGCCACAGTGCTGGAGGG + Intergenic
1016524716 6:144988830-144988852 GAGTGTGGCACAATGCAAGATGG - Intergenic
1019638232 7:2088363-2088385 GTGTGGGCCAGAAGGTTGGAGGG - Intronic
1019709389 7:2511386-2511408 GAGTGAGGCAGGAGGCTGGAGGG - Intergenic
1020069216 7:5214745-5214767 GCTTGTCCCAGAGTGCTGGAGGG - Intronic
1024578894 7:50785690-50785712 GGGTGTGCCAGCCTGGTGGAGGG - Intronic
1027309902 7:76944588-76944610 GAGTGAGCCAGCATGCCAGAGGG - Intergenic
1028311549 7:89343882-89343904 GAGTGTGCCAGTCTGCTGAGTGG - Intergenic
1033840508 7:145367958-145367980 GAGTGTGTCTGAATGCAGGTAGG + Intergenic
1035214872 7:157358048-157358070 GTGGGTGACAGAATGGTGGAAGG + Intronic
1035538544 8:412624-412646 GAGTGGGCCAGAATTAAGGATGG - Intronic
1036923379 8:12880028-12880050 GATTTTGCCAAAGTGCTGGAAGG - Intergenic
1037177319 8:15962300-15962322 GAGTGTGCCAGCCTTCTTGATGG + Intergenic
1038208337 8:25490805-25490827 GGGTGGGGCAGAATACTGGAGGG - Intronic
1040907737 8:52486168-52486190 GTGTGTGCCAGACTCCTGGCTGG + Intergenic
1043232738 8:77823190-77823212 GAGTGTGGGATAATGGTGGAAGG - Intergenic
1043317944 8:78944535-78944557 GAGTGTGGCATTATGGTGGAAGG - Intergenic
1044150517 8:88770855-88770877 GAGTGTGGGATAATGGTGGAAGG + Intergenic
1044309277 8:90675017-90675039 GAGTGTGGCAGACTGCTAGTGGG + Intronic
1044561823 8:93619613-93619635 GAGTGTGAAAGCCTGCTGGATGG - Intergenic
1045866704 8:106874392-106874414 TAATGTTCCAGAATTCTGGAAGG + Intergenic
1046838552 8:118830468-118830490 GAGTGTGCCAGTCTTCTTGATGG - Intergenic
1048109679 8:131454135-131454157 GGCAGTGGCAGAATGCTGGATGG - Intergenic
1048247599 8:132825607-132825629 GAGTCTACCATAATGCTGGAAGG - Intronic
1048390545 8:133959438-133959460 CAATGCACCAGAATGCTGGAAGG + Intergenic
1049838941 8:144758110-144758132 GAGTTTGGCAGAATGCTTGGAGG - Intergenic
1050781977 9:9348492-9348514 GAGTGGGCAAGTATGCTGGGTGG + Intronic
1058259532 9:102811941-102811963 GAGTGTGGAATAATGGTGGAAGG - Intergenic
1059150026 9:111941016-111941038 GTATGTGCCAGAATGTGGGAAGG - Intergenic
1060132239 9:121114346-121114368 CAGTGGGCCATAATGCTGGGGGG - Intronic
1060887620 9:127166859-127166881 GATGATGTCAGAATGCTGGATGG + Intronic
1061238702 9:129357026-129357048 GGGAGTGCCAGGAGGCTGGAGGG - Intergenic
1061788695 9:133046714-133046736 GAGTGGGCCACACTGGTGGAAGG + Intronic
1062116667 9:134813248-134813270 GTGTGTGCCTGCATGCTGGGTGG + Intronic
1062163213 9:135091202-135091224 GAATGTGCCAAAAGGCTGGTGGG - Intronic
1062707729 9:137954488-137954510 GAGGGGGCCAGACTGCTGGGGGG + Intronic
1185525450 X:774892-774914 GAGGAGGCCAGAAGGCTGGAAGG + Intergenic
1189632818 X:42973521-42973543 CAGTGAGCCAGAATGCTGATTGG - Intergenic
1189855451 X:45219765-45219787 GCCTGTGCCAGAATCCTGAATGG - Intergenic
1192138615 X:68629842-68629864 CAGTGTGCCAGCCTGATGGAAGG + Intergenic
1192503212 X:71666421-71666443 GGGTGTCCCTGGATGCTGGACGG + Intergenic
1193049086 X:77082341-77082363 CAGTCTGCCAGAAAGATGGATGG + Intergenic
1194894025 X:99416375-99416397 GAGTGTGCCAGTTTTCTTGATGG + Intergenic
1195524469 X:105870839-105870861 GACTGTCCCAGATTTCTGGAAGG + Intronic
1196197352 X:112850078-112850100 TAGTGTGTCAGAATGGGGGAAGG + Intergenic
1196483463 X:116178573-116178595 TAGTATGCCAGCATGTTGGAGGG - Intergenic
1198945813 X:142012134-142012156 GAGTGTGCCAGTCTTCTTGATGG + Intergenic