ID: 1096410326

View in Genome Browser
Species Human (GRCh38)
Location 12:51372612-51372634
Sequence TGTATATGGTGGCCTGCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096410321_1096410326 4 Left 1096410321 12:51372585-51372607 CCAGGACAGACAGAGAGAAGGTG 0: 1
1: 0
2: 2
3: 44
4: 396
Right 1096410326 12:51372612-51372634 TGTATATGGTGGCCTGCTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 87
1096410319_1096410326 18 Left 1096410319 12:51372571-51372593 CCAGGGCAACAAGTCCAGGACAG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1096410326 12:51372612-51372634 TGTATATGGTGGCCTGCTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096410326 Original CRISPR TGTATATGGTGGCCTGCTAG GGG Intronic
903799755 1:25957855-25957877 TGCCTATGGAGGCCTCCTAGTGG - Intergenic
906879663 1:49576400-49576422 CACATATGGTGGCCTGCTAAAGG - Intronic
909064483 1:70918216-70918238 TGTATATGGTGGAGAGATAGAGG - Intronic
911770259 1:101732179-101732201 TGTATACAGAGGCCTGCTAGGGG + Intergenic
912525543 1:110280216-110280238 TGCCTATGATGGCCAGCTAGAGG + Intronic
912962863 1:114211498-114211520 TATATGTGCTGGCCTGCCAGGGG + Intergenic
917793907 1:178518885-178518907 TGTATATGGTGGTCAGCACGGGG + Intronic
920307634 1:205029390-205029412 TGTATTTATTGGCCGGCTAGTGG + Intergenic
1063608970 10:7547084-7547106 TGGATATCGTGGCCTGCTGATGG + Intergenic
1069642799 10:69966859-69966881 TGGAAATGGTGGCCAGCTTGGGG + Intergenic
1071692218 10:87832966-87832988 TCAATATGGTGACCTCCTAGGGG - Intronic
1075162115 10:120033521-120033543 GGCACATGGTGGCCTGCAAGGGG + Intergenic
1078375251 11:10787952-10787974 TGTTTATGGAGGCCTTCGAGAGG - Intergenic
1078640527 11:13091424-13091446 AGTAGATGATGGCTTGCTAGAGG - Intergenic
1080590287 11:33717520-33717542 TGGAGATGGTGGGCTGCCAGGGG - Intronic
1080651172 11:34223723-34223745 TGTAACTGGAGGCATGCTAGCGG - Intronic
1082011108 11:47449981-47450003 TGGATGAGCTGGCCTGCTAGCGG - Intergenic
1082117658 11:48344951-48344973 TTTATATTGTTGCCTGCTTGTGG - Intergenic
1082256023 11:50034169-50034191 TTTATATTGTTGCCTGCTTGTGG + Intergenic
1091547079 12:1508405-1508427 TGTATATGCTAGTGTGCTAGCGG - Intergenic
1094234139 12:28144262-28144284 TGTAGATGCAGGCCTGCTAGAGG + Intronic
1095963007 12:47847121-47847143 TGAATATGGTGGTCTGCAAAAGG + Intronic
1096410326 12:51372612-51372634 TGTATATGGTGGCCTGCTAGGGG + Intronic
1097931585 12:65193325-65193347 TTTATATGGTGGCATGCTTCTGG + Intronic
1101703844 12:107201486-107201508 TGTATATTGTGAGCAGCTAGTGG - Intergenic
1102142104 12:110623448-110623470 TGTATATTGTGCCCTTCTAGAGG + Intronic
1108540463 13:51439815-51439837 TGTATATGGTGGTCTGTCATTGG - Intronic
1108718406 13:53105190-53105212 TTTATATGGTGGCCTGCTTCTGG + Intergenic
1118507547 14:66430162-66430184 TTTATACAGTGGCCTTCTAGGGG + Intergenic
1130768188 15:86894694-86894716 TGTGTGTGGTGGCCTCCTACTGG - Intronic
1133686807 16:8172932-8172954 TTTATAAGGTGGCCTGACAGTGG + Intergenic
1136921798 16:34287626-34287648 TGGATATGTTGGCCTCTTAGAGG + Intergenic
1137160590 16:37371183-37371205 TGGATATCTTGGCCTCCTAGAGG + Intergenic
1137208809 16:38168083-38168105 TGGATATGTTGGCCTCTTAGAGG + Intergenic
1137340345 16:47596163-47596185 TTTATATGGTGGCAGGCAAGAGG - Intronic
1137656075 16:50159013-50159035 TGTATAGGTGGACCTGCTAGTGG + Intronic
1139112253 16:63905131-63905153 AGTCTGTGGGGGCCTGCTAGAGG + Intergenic
1140955371 16:79860072-79860094 TGTATTTAGTGGCATGCTTGTGG + Intergenic
1158956170 18:62541268-62541290 AGTGTTTGGTGGCCTGCTTGTGG - Intronic
1164286833 19:23824095-23824117 TGTGCATGGTGGCCATCTAGTGG + Intronic
1164899165 19:31903579-31903601 GGAATATGCTGGCCTGATAGAGG - Intergenic
1165805412 19:38577849-38577871 TGTGTGTCGTGGCCTGCAAGGGG - Intronic
925751601 2:7094690-7094712 TGTATATGTTGGCATGCTTCCGG - Intergenic
926170852 2:10551742-10551764 TTTGTATGGTGGCCTGCCGGGGG - Intergenic
937318483 2:120947044-120947066 TGTATGTGATGACCTGGTAGGGG + Intronic
937524113 2:122746122-122746144 TGTTTCTGCTGGCCAGCTAGCGG + Intergenic
939220810 2:139299281-139299303 TATATATGGTGGTATGCTATAGG + Intergenic
940763840 2:157768255-157768277 TGCATATTGTGGCCAGCTAAGGG - Intronic
944105378 2:196073966-196073988 TATATATGGTGGCCTAGTGGAGG - Intergenic
946643536 2:221809478-221809500 TGGATATGGTGGCCTGCAGAAGG + Intergenic
947555028 2:231084516-231084538 TGTATATGGTGGGTAGTTAGTGG + Intronic
948983187 2:241505422-241505444 TGTCTAAGGTGGCCTGAGAGAGG + Intronic
1174076394 20:47940434-47940456 TGTATATGGAGGGCTCATAGAGG + Intergenic
1174574041 20:51524405-51524427 TGTATATGGTGGCGTGAATGGGG - Intronic
1175798185 20:61785426-61785448 AGTGGATGGTGACCTGCTAGAGG + Intronic
1177278483 21:18947664-18947686 TTTATATGTTGGCCTGCTTCCGG - Intergenic
1178660254 21:34501788-34501810 AGTGAATGGGGGCCTGCTAGGGG - Intergenic
1184771354 22:46598624-46598646 GGTATATGGGGGTCTGCTTGGGG + Intronic
1185250221 22:49797682-49797704 TGTATGCGGTTGCATGCTAGTGG + Intronic
956490803 3:69769630-69769652 TCAATATGGTGACCTCCTAGGGG - Intronic
957754015 3:84464034-84464056 TGTATATGTTGGCCTTAAAGAGG + Intergenic
968904788 4:3446196-3446218 TGTAGATGGCGGCCAGCCAGGGG - Exonic
969078410 4:4599073-4599095 TGTCTCTGATGGGCTGCTAGTGG + Intergenic
976185748 4:82441279-82441301 TTTATATGGTGGCAGGCAAGAGG + Intronic
981526382 4:145710378-145710400 TTTATATGTTGGCCTGCTTCTGG + Intronic
986709135 5:10475170-10475192 TGGCTGTGGTGCCCTGCTAGCGG - Intergenic
988090698 5:26537364-26537386 TGTATATGTTTGCCTCCTTGTGG - Intergenic
994844131 5:104963761-104963783 TGTAGATGTTGTCCTACTAGTGG - Intergenic
1006073454 6:31513821-31513843 TGCATATGGATGCCTGCCAGAGG + Intergenic
1007385957 6:41520245-41520267 TGTGTTTGGTGGCTTCCTAGGGG - Intergenic
1007826317 6:44603547-44603569 TGGGTATGGTTGCCTGGTAGTGG - Intergenic
1012972376 6:105745312-105745334 TGTTTATGGTAGGCTCCTAGAGG - Intergenic
1015853117 6:137594674-137594696 TTTATATGGTGGCAGGCAAGAGG + Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017659320 6:156658457-156658479 TGTCTGTGGCGGCCTGCCAGAGG + Intergenic
1018101705 6:160446180-160446202 TGGATCTGGTGGCCAGCAAGAGG + Intronic
1020353017 7:7243965-7243987 TTTAAATGGTGGCCAGGTAGAGG + Exonic
1020600522 7:10269682-10269704 TGTATATGTTAGCCTACTAAAGG - Intergenic
1031567988 7:123322991-123323013 TATATATGATGTGCTGCTAGTGG - Intergenic
1033714726 7:143988297-143988319 TGTTTAGGATGGCCTCCTAGAGG - Intergenic
1040542180 8:48370205-48370227 TGTACACTGTGGCCTGCTATTGG + Intergenic
1043005155 8:74809608-74809630 TGTATATGGTGGCATACTTCTGG - Intronic
1056582235 9:87898060-87898082 TGCATATGTTGGTCTGCTTGCGG - Intergenic
1058343023 9:103921122-103921144 TGTCTACGGTGGACTGCCAGGGG - Intergenic
1188024570 X:25194931-25194953 TGGCTATGGTGGCCTGTTAGTGG - Intergenic
1188576173 X:31652949-31652971 TGAGTATGTTGGCCTGCTAAAGG + Intronic
1189276000 X:39786674-39786696 TCTATATGGTGACCTCCCAGGGG - Intergenic
1193591576 X:83394351-83394373 TGTATATGATTACCTACTAGGGG - Intergenic
1193715912 X:84934632-84934654 TCGTTATGGTGGCCTGCCAGTGG - Intergenic
1196303681 X:114075255-114075277 TATATATGGGGGCCATCTAGTGG + Intergenic
1197932230 X:131707753-131707775 TTTATATGGTGGCCTACTTCCGG - Intergenic
1198765035 X:140071692-140071714 TGTGTCTGGTGGCCTGATGGTGG - Intergenic
1201984969 Y:19956290-19956312 TGTGGATGGTCGGCTGCTAGAGG + Intergenic