ID: 1096412024

View in Genome Browser
Species Human (GRCh38)
Location 12:51383910-51383932
Sequence CTTTCTCCAAGGCTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 429}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096412024 Original CRISPR CTTTCTCCAAGGCTGGTGGA GGG (reversed) Intronic
900168432 1:1254380-1254402 CGTCCTCCTATGCTGGTGGAAGG - Intronic
900495197 1:2973025-2973047 CTTTCTGGAAGGATGGTGGATGG - Intergenic
900605593 1:3522298-3522320 CCTTCTCCAGGGCTGGTGCCCGG - Intronic
900995480 1:6121213-6121235 CTCTATCCAAGGCGGCTGGAAGG + Exonic
901004073 1:6163278-6163300 CTTTCCCCAGTGCAGGTGGATGG - Intronic
901323534 1:8353579-8353601 CTTTCTCCCAGGCTGAGGGCGGG - Exonic
902528573 1:17075811-17075833 CCTTCTCCAGGTCTGGTGGTCGG - Exonic
902942559 1:19811250-19811272 CTGCCTCCAAGGCTGCTGCATGG + Intergenic
903265075 1:22153358-22153380 CTCTCTCTTGGGCTGGTGGAAGG + Intergenic
903774236 1:25782575-25782597 ATTTCTCCAAGGCCTGAGGAAGG - Exonic
904374032 1:30068567-30068589 CTCTCTCCAGGGTTGGTGGTAGG + Intergenic
904746878 1:32716791-32716813 CTCTCTCCAGAGCTGGGGGAGGG - Intergenic
904751378 1:32742830-32742852 GTTTCTCCAGGGCTGGAAGAAGG - Intronic
904830104 1:33300795-33300817 CCTTCTCCAAGTCTGGGGGGCGG - Intergenic
904973372 1:34436346-34436368 CTTCCTCCAGGGCTGTGGGAGGG - Intergenic
905601227 1:39253548-39253570 CCATCTCCCAGGCTGGTGTACGG + Intronic
906295227 1:44645415-44645437 CTTTCACCATTGCTGGTGGATGG - Exonic
906972911 1:50536391-50536413 TTTTCTCCAAGGCTTGAGAAGGG + Intronic
907157879 1:52351158-52351180 CAATCTCCAAGTCTGGTGGGAGG + Exonic
907563940 1:55417075-55417097 CTCTCTCCTTGGCTTGTGGATGG + Intergenic
909426814 1:75535338-75535360 ATTTCTCCCAGGGTGGTGGCAGG - Intronic
910458330 1:87422053-87422075 CTTTCCCCTTGGCTTGTGGATGG + Intergenic
910849013 1:91632814-91632836 CTCTCTGCAAGGCTGGGTGATGG + Intergenic
912757294 1:112334893-112334915 CTGTCACCAAGGCTGGAGTACGG - Intergenic
912810621 1:112791440-112791462 CTGGCTCCAAAGCTGATGGATGG + Intergenic
913489652 1:119367016-119367038 CATTCTCCAAGCCTGCTGGTGGG + Intergenic
913956734 1:143306145-143306167 CTTTCTCCCAGGCTGGAGTATGG + Intergenic
913980709 1:143509510-143509532 CTTTCTCCCAGGCTGGAGTATGG - Intergenic
914075071 1:144335947-144335969 CTTTCTCCCAGGCTGGAGTATGG - Intergenic
914104107 1:144630548-144630570 CTTTCTCCCAGGCTGGAGTATGG + Intergenic
915367027 1:155322346-155322368 CTTCCTCCAAGCCTGGGGAAGGG - Exonic
916418950 1:164618338-164618360 CCTTCTCCCAGGCTGGGGTAAGG + Intronic
918435276 1:184504622-184504644 CATTCTCAAAGGCTGGTGCCGGG - Intronic
918466256 1:184824354-184824376 CTTTCTCCAGTGCTGGATGAAGG - Intronic
920112834 1:203599148-203599170 CTTTCTCCTAGGCTCTGGGAGGG - Intergenic
920444307 1:206003771-206003793 CTTCCTACCAGGCTGGTGGTAGG - Intergenic
921254860 1:213330009-213330031 CTCTCTACCAGCCTGGTGGAGGG + Intergenic
922561250 1:226571192-226571214 CTGTCTCCCAGGCTGGAGGACGG - Intronic
923081593 1:230661964-230661986 CTATCTCCAAGGGTGGGGGTAGG - Intronic
923295722 1:232593318-232593340 CTTTCTCCCAGGCTGCAGAAAGG - Intergenic
923510580 1:234648762-234648784 CTTTCTCCCTGGCTGTTGGCTGG - Intergenic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
924061806 1:240182951-240182973 CTGTCACCCAGGCTGGTGTATGG + Intronic
1063080676 10:2764546-2764568 ACTTCTCCAGGGCTGGTAGATGG - Intergenic
1063348709 10:5335513-5335535 TTCGATCCAAGGCTGGTGGATGG + Intergenic
1063529375 10:6816498-6816520 CTTTCTCCAAGGATGGTCAGTGG + Intergenic
1063815726 10:9769060-9769082 CTTTCTCAAAGGCAGGAGCAAGG + Intergenic
1064135056 10:12743308-12743330 CTGTCACCCAGGCTGGAGGACGG - Intronic
1066097520 10:32086253-32086275 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1067568144 10:47352648-47352670 CCCTCTCTAAGGCTGCTGGAGGG - Intronic
1068408893 10:56628992-56629014 CTTTCTCCCAGTTTGGAGGATGG - Intergenic
1068523726 10:58105257-58105279 TTTCCTCAAAGGCTGGTGGAAGG + Intergenic
1068797755 10:61102877-61102899 CTATTTCTTAGGCTGGTGGAAGG + Intergenic
1069498848 10:68931347-68931369 CTGTCACCCAGGCTGGTGGGTGG + Intronic
1069630363 10:69893879-69893901 GCTGCACCAAGGCTGGTGGAGGG - Intronic
1070989379 10:80718208-80718230 CTTTGGCCAAGGCTGCTGCATGG + Intergenic
1071259365 10:83906083-83906105 CTGTCACCCAGGCTGGTGTACGG - Intergenic
1072633253 10:97161406-97161428 CTTTCTTCCAGGCTGTAGGAGGG + Intronic
1073493094 10:103867937-103867959 CTCTCTCCTGGGCTTGTGGATGG - Intergenic
1074151536 10:110763785-110763807 CTTTCTGCAAGACTGGTTGAAGG + Intronic
1075879399 10:125837462-125837484 CTGTCTCCCAGGCTGGTGTGCGG + Intronic
1076048736 10:127315473-127315495 CTCTCTCCTTGGCTGGTAGAGGG - Intronic
1076662882 10:132067258-132067280 CCTTCTCCAAGGCTGAGGGTGGG + Intergenic
1076771622 10:132669214-132669236 CTGTCTCCAAGGCTGGAGTGCGG - Intronic
1077301453 11:1849054-1849076 CTGTCTCCAAATCTGGTGCAGGG - Intergenic
1078216255 11:9314432-9314454 CTTTCGCCATGGCTGCTGCAAGG + Exonic
1078611408 11:12822614-12822636 CTTTTTCCAGGGCTGGAGGCTGG + Intronic
1079361219 11:19771956-19771978 TCCCCTCCAAGGCTGGTGGAGGG + Intronic
1080387887 11:31820275-31820297 CTTCCTCCAAGGCTGGTGGCAGG - Intronic
1082277134 11:50233870-50233892 CTGTCACCAAGGCTGGAGTACGG - Intergenic
1085191629 11:74630622-74630644 CTTTGGCCAAGGCTGCTGAAAGG + Intronic
1085655925 11:78314866-78314888 CTTTCTCCAAGGCCTCTTGACGG - Intronic
1087791547 11:102411194-102411216 CTTTCCCAAAGGTTGATGGATGG - Intronic
1088425135 11:109693822-109693844 CTTTCTCCCAGGGTGGTGGCAGG + Intergenic
1089145279 11:116324954-116324976 ATTTCTCCAGGGCTTGTGCATGG - Intergenic
1089775617 11:120833492-120833514 CCTTCCACAAGGGTGGTGGAGGG - Intronic
1089891538 11:121886457-121886479 CTCTATCCAAGGCTGGCAGAGGG - Intergenic
1091307314 11:134544593-134544615 CTTTTTCCATGGATGGTGGTGGG + Intergenic
1091386306 12:97968-97990 ATATCTCCATGGCTGGGGGAAGG - Intronic
1094446171 12:30532966-30532988 CTGTCTACAAGGCTGATGCACGG + Intergenic
1095921739 12:47538842-47538864 CTTTCGCCCAGGCTGGAGGCTGG - Intergenic
1095953486 12:47794177-47794199 CTCTCTCCTTGGCTTGTGGATGG - Intronic
1096237702 12:49940857-49940879 CTGTCTTCAAGGCAGGTGGCAGG + Intergenic
1096412024 12:51383910-51383932 CTTTCTCCAAGGCTGGTGGAGGG - Intronic
1096984509 12:55747378-55747400 CTTTCTCCCAGGGTGGGGGTGGG + Intronic
1097903803 12:64899708-64899730 CTTTCTCCATCTCTGGTGGTAGG + Intergenic
1098587304 12:72169477-72169499 CTTTCTTCCTGGCTGGTAGATGG + Intronic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1100092916 12:90993258-90993280 CTTTGTCCGAGGCTTGTGGCTGG + Intronic
1101376163 12:104173103-104173125 CTTTCTCCCAGTCTAGGGGAGGG + Intergenic
1101676910 12:106925626-106925648 CTTTCTCCTTGGTTTGTGGATGG - Intergenic
1102163420 12:110787409-110787431 CTCTCCCAAAGGCTGTTGGAGGG - Intergenic
1103530316 12:121596633-121596655 CTGTCACCCAGGCTGCTGGAGGG + Intergenic
1104016617 12:124966006-124966028 TTGTCTCCCAGGCTGGTGGGAGG + Intronic
1104037581 12:125108292-125108314 CTCTCTCCTTGGCTTGTGGACGG + Intronic
1104844398 12:131839508-131839530 CTTTCACCCAGGCTGGGGGGCGG + Intronic
1105826045 13:24124488-24124510 CTTTCTCGAAGGAAGGTGGATGG + Intronic
1106132969 13:26954595-26954617 CTTCCGCCAAGGGTGGTGCAAGG - Intergenic
1106454564 13:29915926-29915948 CTCTCTCCTTGGCTGGTAGATGG - Intergenic
1106871941 13:34031126-34031148 CTGTGTCCTAGCCTGGTGGAAGG - Intergenic
1108761363 13:53569834-53569856 CTTTCTCCAAGACTAGCAGAAGG - Intergenic
1111813018 13:93115644-93115666 CTTTCTTCCAGGCTGGAGTACGG + Intergenic
1112837449 13:103533424-103533446 CTCTCTCCAAGGCTGGGGTTAGG + Intergenic
1112896538 13:104306253-104306275 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1114487591 14:23072160-23072182 CTTTTCCCAGGGATGGTGGAGGG + Intronic
1114566226 14:23635097-23635119 CTCTCTCCCAGGCTGGAGTACGG + Intronic
1116348046 14:43821764-43821786 CTTTCTCCTTGGCTTGTAGATGG - Intergenic
1117630618 14:57687075-57687097 CTCTCTCCTAGGCTTGTAGATGG - Intronic
1118144845 14:63124185-63124207 CTCTCTCCTTGGCTTGTGGAGGG + Intergenic
1119602357 14:75984977-75984999 CATTCTCCTAGGCTGGCAGAGGG - Intronic
1119782297 14:77284638-77284660 CTTGCTCCAAGCCTGGAGGCTGG + Intronic
1121887204 14:97554400-97554422 CTTTGTCCAAGGCTAGTGAGAGG + Intergenic
1122028071 14:98892152-98892174 CTGTCTCCCTGGCTGGTAGAGGG - Intergenic
1122153498 14:99737217-99737239 CTGTCTCCAAGGCTGCAGGAAGG - Intergenic
1122938095 14:104969144-104969166 CTGCCTCCAAGGCTGCAGGAGGG + Intronic
1123163981 14:106308342-106308364 CTGTCACCAAGGCTGGTGTGTGG + Intergenic
1202939140 14_KI270725v1_random:127821-127843 CTTTCTCCCAGGCTGGAGTGCGG + Intergenic
1123394004 15:19908455-19908477 CTTTCTCCCAGGCTGGAGTGTGG - Intergenic
1123490989 15:20782819-20782841 GTCTCTCCAAGCTTGGTGGAAGG + Intergenic
1123547491 15:21351910-21351932 GTCTCTCCAAGCTTGGTGGAAGG + Intergenic
1124192683 15:27594245-27594267 CTTTCCCTGAGGATGGTGGAAGG + Intergenic
1124721302 15:32113200-32113222 CTCTCTCCTTGGCTGGTAGATGG + Intronic
1125973104 15:43928283-43928305 CTTTCTCCAAGGCTGGGGTGGGG + Intronic
1127723951 15:61729179-61729201 CCCTTTCCAAGGCTGGTGTAAGG - Intergenic
1128754430 15:70171735-70171757 CTCTCTCCAAGGGTTGTGGTGGG + Intergenic
1128771639 15:70287055-70287077 CTGTCACCCAGGCTGGTGGAGGG + Intergenic
1128934929 15:71738126-71738148 ATTTCTCCATGGATGGTGGCGGG + Intronic
1129754198 15:78086433-78086455 CTTTCTACATGGCTGCTGGTTGG - Intronic
1130033112 15:80333603-80333625 CTTTCTCCACTGCTGGATGAGGG + Intergenic
1131132475 15:89909121-89909143 GTTTGTCCCAGGCTGTTGGAAGG - Intronic
1202955821 15_KI270727v1_random:79140-79162 GTCTCTCCAAGCTTGGTGGAAGG + Intergenic
1133097011 16:3454190-3454212 CTATCTCCAAGGCTGAAAGAGGG + Intronic
1134572575 16:15303896-15303918 CTTTCTGCAAGCCAGGAGGAGGG + Intergenic
1134729807 16:16452126-16452148 CTTTCTGCAAGCCAGGAGGAGGG - Intergenic
1134937624 16:18259770-18259792 CTTTCTGCAAGCCAGGAGGAGGG + Intergenic
1135041084 16:19117063-19117085 GTTTCTCCAAGGCTGGCTGCTGG + Exonic
1135635667 16:24073366-24073388 CTGTCTCCCAGGCTGGAGTACGG + Intronic
1136277534 16:29187712-29187734 CTTTCTCCATGGCCTGCGGATGG + Intergenic
1136700015 16:32126340-32126362 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1136767636 16:32801116-32801138 CTTTCTCCCAGGCTGGAGTGCGG + Intergenic
1136800514 16:33069581-33069603 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1136958403 16:34813289-34813311 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1137745931 16:50819940-50819962 CTCTCTCCTGGGCTTGTGGATGG + Intergenic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1138082366 16:54102757-54102779 CCTTCTCCAAGGCAGCAGGATGG + Intronic
1138394037 16:56690859-56690881 CTTTCTCTATGGAGGGTGGAGGG - Intronic
1138409208 16:56824633-56824655 CTTACTGCAAGGCTGCTGGCAGG - Intronic
1139481304 16:67232191-67232213 CTTTCTGCATGGTTGGGGGAAGG + Exonic
1140193246 16:72836060-72836082 CAATCTGCAATGCTGGTGGACGG + Intronic
1141659316 16:85433400-85433422 CTCTCTCTAAGGCTGGCCGAGGG - Intergenic
1142081910 16:88153754-88153776 CTTTCTCCATGGCCTGCGGATGG + Intergenic
1142292193 16:89198325-89198347 CTCTCTCCCAGGCTGGTTGGTGG - Exonic
1203070029 16_KI270728v1_random:1063149-1063171 CTTTCTCCCAGGCTGGAGTGCGG + Intergenic
1142493239 17:292232-292254 GCTTCTCCAAGCCTGGCGGATGG - Intronic
1143192656 17:5051548-5051570 CTTTCACCCAGGCTGGAGCACGG - Intronic
1143253325 17:5538216-5538238 CTTGCTCCCAGGGAGGTGGAGGG + Intronic
1143334513 17:6162280-6162302 CATTCTCGAAGGCTTGGGGAAGG + Intergenic
1144010874 17:11147388-11147410 TTCTCTCCAAGGCTGAGGGAAGG + Intergenic
1144468535 17:15516478-15516500 CTCTCTCCTTGGCTTGTGGACGG + Intronic
1145239399 17:21231264-21231286 CTGTCTCCCAGGCTGGAGGATGG - Intergenic
1145784794 17:27586828-27586850 GTTTCTCCTAGGCTGGTAGCTGG + Intronic
1146056843 17:29585549-29585571 CTTTCCCCCAGCCTGGGGGAGGG + Intronic
1146564514 17:33900879-33900901 CTTTAGCCAAGGCTGGTTAAAGG - Intronic
1146958245 17:36949481-36949503 CTTGCTCCAGGCCTGTTGGAGGG + Intronic
1147278940 17:39341745-39341767 TTTTCTCCAAGGCTGAGGGCAGG - Intronic
1147917666 17:43898369-43898391 CTTGCTGCATGGCTGGGGGAAGG + Exonic
1150204918 17:63396401-63396423 CTTTATACAAGGCTGTTGTAAGG + Intronic
1150737804 17:67755107-67755129 CTTTCACCCAGGCTGGAGGCTGG - Intergenic
1151264203 17:72941314-72941336 CTTTCTCCTTGGCTGGTAGATGG - Intronic
1151285932 17:73111159-73111181 TTTTCTCCTTGGCTAGTGGATGG - Intergenic
1151598594 17:75092988-75093010 CTTTCTCCAAAGCTGCTGGTTGG + Intronic
1152171845 17:78755872-78755894 CTTTCTCCCAGGCTGGAGTGTGG - Intronic
1152694962 17:81739434-81739456 CTTTCTCCCTGGCTTGTAGATGG + Intergenic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1153960152 18:10133553-10133575 CCTTCTCGGAGGTTGGTGGATGG + Intergenic
1154170524 18:12047493-12047515 CGTTCCCCAAGGCTGGGGGATGG - Intergenic
1154170554 18:12047590-12047612 CATTCCCCAAGGCTGGGGGATGG - Intergenic
1154316750 18:13310316-13310338 CTGTCACCCAGGCTGGAGGAGGG - Intronic
1154517129 18:15183920-15183942 CTTTCTCCCAGGCTGGAGTGCGG + Intergenic
1155225683 18:23727360-23727382 CTGTCTCCCAGGCTGGAGGGCGG + Intronic
1155553619 18:26993944-26993966 CTCTCTCCTCGGCTGGGGGATGG + Intronic
1155647755 18:28100626-28100648 GTTTCTCCAAACCTGGTGTATGG + Intronic
1156366050 18:36428392-36428414 CTTCCTCCAAAGATGGAGGAAGG - Intronic
1159015941 18:63101781-63101803 CATTCTCCTAGAGTGGTGGAGGG + Intergenic
1159510446 18:69391817-69391839 CTCTCTCCACAGCTGGTAGATGG + Intergenic
1159676239 18:71287334-71287356 CTCTCTCCTTGGCTGGTAGATGG + Intergenic
1159879408 18:73844539-73844561 CTCTCTCGTTGGCTGGTGGATGG + Intergenic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160327875 18:77967415-77967437 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
1160508915 18:79442489-79442511 CTTTCTCCAAAGTCGGCGGAAGG + Intronic
1160761683 19:788716-788738 TTTTATCCATGGCAGGTGGAAGG - Intergenic
1160801785 19:973791-973813 CTTTCTCCAAGCCAGGGGGAGGG - Exonic
1161128680 19:2574925-2574947 GTTTCTCCAAGGCTGCTGGCAGG + Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1163287562 19:16358002-16358024 CTGTCCTCAAGGCTGGTGGAGGG - Intronic
1163348089 19:16757388-16757410 CATCCTCCAAGGCTACTGGAAGG + Intronic
1163573117 19:18094757-18094779 CTTTCGCCCAGGCTGGAGGGCGG - Intronic
1164890720 19:31820998-31821020 CTCTCTCCATGGCTTGTGGATGG + Intergenic
1165410631 19:35658681-35658703 CCTTCTCCCAGGATGGTGAAGGG + Exonic
1166053136 19:40272956-40272978 CTATCTCTAAGGCTATTGGAGGG + Intronic
1166778775 19:45328726-45328748 AATTAGCCAAGGCTGGTGGATGG - Intergenic
1168499492 19:56881378-56881400 CTGTCTCCCAGGCTGGAGTACGG + Intergenic
925428464 2:3770920-3770942 CCTCCTCCACGGCTGGTGGGTGG - Intronic
927435863 2:23065620-23065642 CTCTCTCCTTGGCTGGTAGATGG - Intergenic
927569383 2:24144892-24144914 CTCTCGCCAATGGTGGTGGATGG - Intronic
928191120 2:29169270-29169292 CTTTCTCTATGGCTTGTAGATGG + Intronic
929627725 2:43427344-43427366 TCTGCTCCAAGGCAGGTGGATGG - Intronic
929658258 2:43755810-43755832 CTTCCTCCAAGAATGGTGAATGG + Intronic
931165590 2:59744109-59744131 CTTTGGCCAAGGCAGATGGAGGG + Intergenic
931286821 2:60839353-60839375 CTTTATCCAGGGATGGTGAATGG + Intergenic
931635020 2:64332999-64333021 CTTTCCCAAAGTGTGGTGGAAGG - Intergenic
931856501 2:66307456-66307478 CTTTATCCAAAGCTGGAGAAAGG + Intergenic
932563563 2:72892074-72892096 CCTTCTCCCAGCCTGGGGGAGGG - Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932874171 2:75433215-75433237 CTTCCTCCAAGTCTCTTGGAAGG - Intergenic
933420533 2:82040189-82040211 TTTTCTCCAGGGGTGGTGGTGGG - Intergenic
933991919 2:87639979-87640001 CCTGCTGCAGGGCTGGTGGAGGG + Intergenic
934138865 2:89025461-89025483 CTTTCACCCAGGCTGGAGTATGG + Intergenic
934230383 2:90175097-90175119 CTTTCACCCAGGCTGGAGTATGG - Intergenic
935173921 2:100631434-100631456 CTGTCACCCAGGCTGGAGGAGGG + Intergenic
935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG + Intergenic
935931170 2:108127376-108127398 TTTTCTTCAAGGCTTATGGAGGG - Intergenic
936301925 2:111310839-111310861 CCTGCTGCAGGGCTGGTGGAGGG - Intergenic
936431239 2:112465439-112465461 CTTTCTCCAGGTTAGGTGGATGG - Intergenic
936596133 2:113849914-113849936 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
938196414 2:129332902-129332924 TTTTCTCATAGGCTGCTGGAAGG - Intergenic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
940809035 2:158222210-158222232 CTTTCTCCAAGGCCAGTGCTGGG - Intronic
941891271 2:170584222-170584244 CTTTTTCCAAGTTTGTTGGAGGG - Intronic
942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG + Intronic
942448888 2:176097170-176097192 ATTTCTCCAAGGCGGGGGGAGGG - Intergenic
942610850 2:177741223-177741245 CTCTCTCCTTGGCTTGTGGATGG + Intronic
943294461 2:186118920-186118942 CTTTCTCCATGGCTTGCAGAGGG - Intergenic
944940906 2:204625403-204625425 CTTTCTACATGAATGGTGGATGG - Intronic
944954040 2:204787167-204787189 CTTACTCCAAGGCTGAGGAATGG - Intronic
945435988 2:209817916-209817938 TTTTCTCCATGGCTGTTGGAGGG - Exonic
945708152 2:213261575-213261597 ATATCTCTCAGGCTGGTGGAAGG + Intergenic
946197005 2:218039502-218039524 CTTGCTCACAGGCTGGGGGAGGG + Intronic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
946464894 2:219903155-219903177 CTTTATCCAATGAAGGTGGAAGG - Intergenic
946467229 2:219922655-219922677 CATTCTCCAAGGCTGTGCGAGGG + Intergenic
946510492 2:220350392-220350414 CTCTCTCCAAGTTTGGTGGGTGG + Intergenic
947378770 2:229524674-229524696 CTATCTCCAAGATTGGTGAAGGG - Intronic
947498061 2:230653261-230653283 CTTTCTTCAAGGCAGCTAGATGG + Intergenic
947875895 2:233468133-233468155 CTTTCTGCACTGCTGGTGGGTGG + Intronic
948880027 2:240851914-240851936 CTTTCTCCTGGGCTTGTAGATGG + Intergenic
1168934968 20:1657119-1657141 CTTTCTCCTTGGCTTGTAGAAGG - Intronic
1169354168 20:4893894-4893916 CTTTCCCGCAGGCTGGTGGGAGG - Intronic
1169427835 20:5510153-5510175 CTTGCTCCAATGATGGGGGAGGG + Intergenic
1171445048 20:25196838-25196860 CTCTCTCCAAGGCAAGGGGAGGG - Intronic
1172909845 20:38399890-38399912 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
1173386619 20:42594209-42594231 CTTTCTGCAGGGCTGTTGGTTGG + Intronic
1173858807 20:46268664-46268686 CTTTCTCCTAGGATGGGAGAGGG + Intronic
1175396819 20:58670357-58670379 CTATCTCCAATGGGGGTGGAGGG - Intronic
1175594710 20:60221833-60221855 GTATCTCCAAGGCTTGTGGGTGG + Intergenic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1176249784 20:64114997-64115019 CTCTGTCCAGGGCTTGTGGATGG + Intergenic
1176861215 21:14012512-14012534 CTGTCACCAAGGTTGGTGGGTGG + Intergenic
1177038101 21:16070590-16070612 CTTTTTGCAAGGGGGGTGGAGGG + Intergenic
1177292532 21:19133353-19133375 TTTTCTCCTAGGGTGGTGGGAGG + Intergenic
1178343605 21:31806484-31806506 CTCTGTCCCAGGCTGGTAGATGG + Intergenic
1178484653 21:33011019-33011041 CTCTCTCCTTGGCTTGTGGATGG + Intergenic
1179430847 21:41320028-41320050 CTCTCTCCTTGGCTTGTGGATGG - Intronic
1179446595 21:41436172-41436194 CTTTCTCCATGGCTTGCAGATGG + Intronic
1179941334 21:44640370-44640392 GTGTGACCAAGGCTGGTGGAGGG + Intronic
1180266865 22:10536294-10536316 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1181962729 22:26634525-26634547 CTCTCTCCATGGCTAGTAGATGG + Intergenic
1182031018 22:27159533-27159555 CTTTCTCCTTGGCTTGGGGATGG - Intergenic
1182314281 22:29433583-29433605 CTTTTTCCAAGGCTGTTGGTGGG - Intergenic
1182560059 22:31152682-31152704 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1182664495 22:31947185-31947207 CTTTCTTCAGGGCTGGGGAAGGG + Intronic
1182892876 22:33833478-33833500 CTCTCTCCTTGGCTTGTGGAAGG - Intronic
1183059897 22:35329941-35329963 CCTCCTCCAAGGCTTGTGCAGGG + Intronic
1183724347 22:39580268-39580290 CTTTCTCCACAGCAGTTGGAGGG - Intronic
1183742060 22:39674295-39674317 GTTGCCCCCAGGCTGGTGGAGGG + Intronic
1184832299 22:46996459-46996481 CTTTCTCCACGGGTGGTTCATGG + Intronic
1185158015 22:49205764-49205786 CTTCCTCCCAGCCTGGAGGATGG - Intergenic
1185187918 22:49413939-49413961 CTCTCTCCTCAGCTGGTGGACGG + Intergenic
949134702 3:549906-549928 CTCTCTCCTGGGCTGGTAGATGG - Intergenic
949394239 3:3597689-3597711 CTGTCTCCCAGGCTGGAGGGCGG - Intergenic
949446738 3:4143085-4143107 ATTTGTGCAAGGCTGGTAGAGGG + Intronic
950714372 3:14837258-14837280 CTGTCTCCATGGCTGGAGAAGGG + Intronic
950867891 3:16203963-16203985 CTGTCTCCAAGGCTTGTGTCAGG + Intronic
951217016 3:20034785-20034807 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
951627288 3:24679817-24679839 CTCTCTCCTTGGCTTGTGGAGGG + Intergenic
951839292 3:27016469-27016491 CTTTCTCCTCGGCTGGCAGATGG + Intergenic
952026774 3:29092317-29092339 CTTACTCCAAGGTTGTTAGAAGG + Intergenic
952116562 3:30188825-30188847 CTTTCTCCTAGCATGGTGGCTGG - Intergenic
952317856 3:32247347-32247369 CTTTCGCCCAGGCTGGAGGGCGG + Intronic
952356576 3:32590473-32590495 CTTTTTCCATGGGTGGTAGAAGG - Intergenic
953190764 3:40685412-40685434 CTTTCTCCTTGGCTTGTAGAAGG + Intergenic
953456022 3:43043049-43043071 CTCTCTCCAAGGAGGGTGGCAGG - Intronic
953482870 3:43266852-43266874 CTTTATCCAAGGCTTATGGAAGG + Intergenic
953574592 3:44102886-44102908 CATTCTCCTTGGCTGGTAGAGGG - Intergenic
953905486 3:46866395-46866417 CATTCTCCTTGGCTGGGGGAAGG - Intronic
954249896 3:49359096-49359118 CTCTCTCCAGGGCTGGGGGTAGG - Intergenic
954643772 3:52118167-52118189 CATGCTACAAGGCTGGGGGAAGG - Intronic
955287646 3:57658489-57658511 CTGTCTCCCAGGCTGGAGTACGG - Intronic
955445902 3:59009008-59009030 CTTTCCCCAATGCTGGTGAGTGG - Intronic
955547087 3:60042503-60042525 CTCTCTCCTTGGCTTGTGGATGG + Intronic
955590489 3:60529840-60529862 CTTTCTCCAATTCTAGTGAATGG - Intronic
956594277 3:70949050-70949072 CTGTCTCCCAGGCTGGAGTAGGG - Intergenic
957667626 3:83254054-83254076 CTGTCTCCCAGGCTGGAGGAGGG - Intergenic
960797916 3:121507888-121507910 CTGTCACCAAGGCTGGAGCATGG + Intronic
960994778 3:123333581-123333603 CTTCCTCCTGGGCTGGGGGAGGG - Intronic
962091839 3:132252385-132252407 CTTTCTCCATGGCTTGTAAATGG - Intronic
962350033 3:134649984-134650006 CTGTCTCCGAGGCTGGTGTGAGG - Intronic
962918253 3:139928141-139928163 CTCTCTCCTGGGCTGGTAGATGG + Intergenic
963605036 3:147406188-147406210 CTTTATCCACGGTTGGGGGAGGG + Intronic
964988312 3:162772516-162772538 CTTTCTCTAGCCCTGGTGGAAGG + Intergenic
965619289 3:170626256-170626278 CTTTCTCCTTGTCTTGTGGATGG - Intronic
966085940 3:176067355-176067377 ATTTATCCAAGGGTGGTAGAAGG + Intergenic
966400830 3:179545485-179545507 CTGGCTCCTAGGCTGGTGGCTGG + Intergenic
967137632 3:186525864-186525886 CTATCTCCAAGGCAGGTCGATGG + Intergenic
967260040 3:187633182-187633204 CTTTCTCAAAGGGTGGTTCAAGG + Intergenic
967381444 3:188863549-188863571 CTTTCTCGAAGGCTACTGGTAGG + Intronic
968918681 4:3511128-3511150 CTTTCTCCCAGCTGGGTGGAAGG - Exonic
968955634 4:3717457-3717479 CCTGGTCCAGGGCTGGTGGAGGG - Intergenic
970223492 4:13834176-13834198 GTGTGTCCCAGGCTGGTGGATGG + Intergenic
971361102 4:25939431-25939453 CTTTCTCCTTGGCTTGTAGATGG - Intergenic
971890287 4:32511091-32511113 TTTTCTCCAAGGCAGGTCAATGG + Intergenic
972335825 4:38106611-38106633 CTTGCTCCAAGGCTGGGAGGAGG + Intronic
972548608 4:40106583-40106605 CTGTCTCCCAGGCTGGAGTACGG + Intronic
972930702 4:44068537-44068559 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
974037665 4:56831136-56831158 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
974048609 4:56918704-56918726 CTTTCACCCAGGCTGGAGCACGG + Intronic
975510778 4:75192235-75192257 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
975837022 4:78434027-78434049 CTTTCTCTAAGGGTTGTAGAAGG + Intronic
976420038 4:84831483-84831505 CTTTCTCCAAGGCAGGTTATAGG + Exonic
976660178 4:87532624-87532646 CTCTCTCCTTGGCTTGTGGATGG + Intergenic
979972127 4:127148354-127148376 CTTTCTCCAAGGGAGGGAGAGGG + Intergenic
980121535 4:128732908-128732930 CTTTTTCCAAGACTGCTGCAGGG - Intergenic
980735356 4:136878794-136878816 CTTTCTCCTTGGCTTGTAGACGG - Intergenic
980844310 4:138305678-138305700 CTGTCTCCTAGGCTTGTAGATGG + Intergenic
981597241 4:146440318-146440340 CTTTCACCCAGGCTGGAGTAGGG + Intronic
982116717 4:152104318-152104340 CTCTCTCCTGGGCTTGTGGATGG - Intergenic
982816892 4:159897107-159897129 CTTTCTCCTTGGCTTTTGGATGG - Intergenic
983901934 4:173145321-173145343 CTTTCTCCATGGTTGTTGGCAGG + Intergenic
984942009 4:184941125-184941147 CTGTCTCCCAGGCTGGAGTAGGG + Intergenic
985042355 4:185904363-185904385 CTTACTCCAGGGGTAGTGGATGG + Intronic
985690323 5:1306200-1306222 CTGTCACCAAGGCTGGTGTGTGG + Intergenic
986371898 5:7088239-7088261 CCTTCTGCAAGTCTGGTGAAGGG + Intergenic
988392911 5:30658872-30658894 ATTTTTCCATGGATGGTGGAAGG + Intergenic
988395313 5:30690623-30690645 CTTTCACTGGGGCTGGTGGAGGG - Intergenic
989619297 5:43368784-43368806 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
991018317 5:61954900-61954922 CTTTCTCCAATGCTGCAGCATGG - Intergenic
991293029 5:65051059-65051081 GTTTCTGCAGGGCTGATGGATGG + Intergenic
992161518 5:74008610-74008632 CTCTCTCCCTGGCTGGTAGATGG + Intergenic
992270220 5:75055449-75055471 CTGTCTCCCAGGCTGGAGTAAGG + Intergenic
992827386 5:80564397-80564419 CTTTCACCAAGGTTGGTGTCAGG + Intronic
994363099 5:98878229-98878251 CTTTCTCCAAGGCTGTACCATGG - Intronic
996105341 5:119495705-119495727 CTGTCTCCCAGGCTGGAGTATGG + Intronic
998057931 5:139095298-139095320 CTGTCTCCCAGGCTGGAGTACGG + Intronic
998268117 5:140681698-140681720 CTCTCTCCATGGCTTGTAGATGG - Intronic
998643206 5:144035352-144035374 CTTTCTCTTTGGCTGGTAGATGG - Intergenic
999128488 5:149264659-149264681 CTGTCTCCATGGCTTGTGGATGG - Intergenic
999895899 5:156033038-156033060 CTGTCTCCCAGGCTGGAGTATGG - Intronic
1000011563 5:157238170-157238192 TTTTCACCAAGGCTGTTGTAAGG + Exonic
1000860548 5:166451263-166451285 CTTTCACCCAGGCTGGAGTACGG + Intergenic
1001410710 5:171509407-171509429 CTTTCTCCGGGGCTCATGGAGGG - Intergenic
1002317770 5:178355019-178355041 CTGTCTCCCAGGCTGGAGTACGG - Intronic
1003024541 6:2542533-2542555 CTCTCTCCTGGGCTGGTGGAGGG - Intergenic
1003258073 6:4491117-4491139 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
1004136159 6:12969041-12969063 GTTTCTCCAAGTGTGGTGCATGG - Intronic
1004367172 6:15022112-15022134 CCTTCCCCAGGCCTGGTGGATGG - Intergenic
1005041329 6:21602926-21602948 CTTTTAACAAGGATGGTGGAAGG - Intergenic
1006101803 6:31690174-31690196 CTTTCTCCATCCCTGGGGGAAGG + Intronic
1006266746 6:32931869-32931891 CTTGCTTCAAGGCAGTTGGAGGG + Intergenic
1006656100 6:35594306-35594328 CTTTCACCTAGGCTGGAGTAGGG - Intronic
1006945297 6:37780438-37780460 CTTTCTCCAAGGGCTTTGGAAGG + Intergenic
1008000873 6:46358402-46358424 ATATCTCCAAAGGTGGTGGAAGG + Intronic
1008921793 6:56850352-56850374 CTTCCTCCAAGGGGGCTGGAGGG - Intronic
1009465252 6:63961171-63961193 CTTACTTCAAAGATGGTGGAAGG + Intronic
1011324955 6:86140493-86140515 CTCTCTCCTTGGCTTGTGGATGG + Intergenic
1012113449 6:95263335-95263357 CTTTTGCCATTGCTGGTGGAAGG - Intergenic
1012371172 6:98509132-98509154 CTTTCTCCTTGGCTTGTAGATGG + Intergenic
1012457085 6:99419114-99419136 CTGGCACCCAGGCTGGTGGAGGG - Intronic
1012457506 6:99423864-99423886 CTCTCTCCTTGGCTTGTGGATGG + Intronic
1013658051 6:112265865-112265887 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
1015592119 6:134832185-134832207 CTGTCGCCCAGGCTGGAGGACGG - Intergenic
1016783670 6:147987536-147987558 TTTTCTCGATGGCAGGTGGAAGG - Intergenic
1016821688 6:148352558-148352580 CTGTCTCCCAGGCTGGAGTACGG - Intronic
1016951828 6:149587802-149587824 CCTTCCCCAAGGTTGGGGGATGG + Intronic
1017663068 6:156692411-156692433 CTCTCTCCTTGGCTGGTAGATGG + Intergenic
1018045860 6:159965770-159965792 ATTTTTCCATGGATGGTGGAGGG - Intergenic
1018371185 6:163169908-163169930 CTCTCTCCTTGGCTTGTGGACGG + Intronic
1018910478 6:168098557-168098579 CGGTCACCAAGGCTGGTGGGGGG - Intergenic
1018965611 6:168486301-168486323 CAATCTACAAGGCTGTTGGATGG - Intronic
1019997763 7:4735627-4735649 CTTTCCGCCGGGCTGGTGGACGG + Intronic
1020129365 7:5550838-5550860 CTTCCCCCAAAGCTGGGGGAAGG + Intronic
1020353540 7:7251806-7251828 CTTACTACAATCCTGGTGGATGG + Intergenic
1021107659 7:16656994-16657016 CTGACTCCAAGGCTGGAGCAGGG - Intronic
1021534481 7:21688023-21688045 CTGTCTCCTAGGCTGGAGCACGG - Intronic
1021788390 7:24175377-24175399 CTGTCTCCCAGGCTGGAGTATGG - Intergenic
1024192978 7:47031355-47031377 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
1024381727 7:48704344-48704366 CTTTCTTTAAGGCTGATAGAGGG - Intergenic
1024537241 7:50447770-50447792 CTGTCACCCAGGCTGCTGGAGGG + Intronic
1025562731 7:62389523-62389545 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1026824172 7:73570942-73570964 CTGTCTCCAAGGATGGTACATGG - Exonic
1029096535 7:98089448-98089470 CTTTCTCCTTGGCTTGTAGATGG - Intergenic
1029158806 7:98536435-98536457 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
1029421576 7:100474583-100474605 CCTTCTCCAGAGCTGGAGGAGGG - Intronic
1029684395 7:102135935-102135957 CTGTCTCCCAGGCTGGTGTGTGG - Intronic
1030639669 7:111989895-111989917 CTTTCTGCAAGGCTGTTTTATGG + Intronic
1031346728 7:120675892-120675914 CTGTCTCCCAGGCTGGAGTACGG + Intronic
1032077827 7:128844406-128844428 TTGTCTCCAAGGCAGGTGGTGGG - Intronic
1032959536 7:137015556-137015578 GTTTCTCCAAGTCTGGTACAAGG + Exonic
1033916430 7:146331603-146331625 CTTTCTCCATGGCTGCTGATTGG + Intronic
1034049203 7:147964188-147964210 CTCTCTCCTTGGCTTGTGGAGGG - Intronic
1034169801 7:149054210-149054232 CCTTCTCCCAGGGTGGTGAAGGG + Intergenic
1034338629 7:150338821-150338843 CATTCTCCAAGGGATGTGGAGGG - Intronic
1035590525 8:809731-809753 CTCTCTCCAAGGCCAGGGGAGGG - Intergenic
1037322317 8:17655692-17655714 CTGTCTCCCAGGCTGGAGGCTGG - Intronic
1037821833 8:22138840-22138862 CTTCCCCCAAGGCTCGAGGAAGG - Intronic
1037823875 8:22149028-22149050 CCTTCTCCAAGGGGGTTGGATGG - Intronic
1038372628 8:27009403-27009425 CTCTCTCCTTGGCTTGTGGATGG - Intergenic
1038524497 8:28261447-28261469 CTCTCTCCCTGGCTTGTGGATGG - Intergenic
1039387409 8:37148253-37148275 CTCTCTCCAAGTCTGGTTGGAGG + Intergenic
1040508662 8:48074338-48074360 GTTTCTCTAATGCTGGTGGGAGG - Intergenic
1041554441 8:59136947-59136969 CTCTCTCCTTGGCTGGTAGATGG + Intergenic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1042311069 8:67379926-67379948 CTGTCTCCCAGGCTGGAGGGCGG + Intergenic
1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG + Intronic
1043386062 8:79748912-79748934 CTTTCTCCAGAGCTGGTGGAAGG - Intergenic
1043606153 8:82003025-82003047 CTGTCTCCCAGGCTGGAGGCTGG + Intergenic
1043796743 8:84551763-84551785 CTATCTCCTAGGCTGGTGCATGG + Intronic
1044191149 8:89319292-89319314 CTCTCTTCTAGGCTGGTAGATGG + Intergenic
1044700154 8:94958344-94958366 CTCTCTCCTTGGCTTGTGGATGG + Intronic
1044827308 8:96210645-96210667 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
1045165987 8:99605736-99605758 CATTCTCCAGGGCAGGTGGGTGG + Intronic
1046522356 8:115341909-115341931 CTGTCTCCCAGGCTGGAGGCTGG + Intergenic
1047023900 8:120806927-120806949 CTTTCTCCAAGGGTGGAAGTGGG - Intronic
1047357773 8:124139652-124139674 CTCTCTCCTTAGCTGGTGGATGG + Intergenic
1048005267 8:130414461-130414483 GCTTGTCCAAGGCTGGTAGAGGG - Intronic
1048306597 8:133288928-133288950 ATTCCTCCCAGGCAGGTGGATGG - Intronic
1049542681 8:143215595-143215617 CATTCTCCAAAGCTGGTGCAGGG - Intergenic
1049572273 8:143374872-143374894 CTTTCGCCATGGCTGGTGCTGGG + Intronic
1049822450 8:144644258-144644280 CTTTCTCCAGGGTTTCTGGAGGG - Intergenic
1051569770 9:18542600-18542622 CTCTCTCCTTGGCTTGTGGAAGG - Intronic
1052108762 9:24552909-24552931 CTTTTTCCAAAGCTTGTCGAAGG + Intergenic
1052834357 9:33239665-33239687 CTTTCTCCCAGGCTGCTGTGAGG - Intronic
1053379143 9:37635215-37635237 CTTTCTTCAAGGTTGGTGCAAGG - Intronic
1053593398 9:39534649-39534671 CTTTCTCCTAGGCTGGCAGAGGG + Intergenic
1053851131 9:42289357-42289379 CTTTCTCCTAGCCTGGCAGAGGG + Intergenic
1054572908 9:66830628-66830650 CTTTCTCCTAGGCTGGCAGAGGG - Intergenic
1055054961 9:72015024-72015046 CTCTCTCCTTGGCTTGTGGATGG + Intergenic
1055362877 9:75513065-75513087 CTTTCTCCTTGGCTAGTAGATGG + Intergenic
1056138022 9:83648200-83648222 CTTTCTCCAAGTGTGATGGTGGG - Intergenic
1056676261 9:88679259-88679281 CTTTCTCCAAGCCTGGGTGCAGG - Intergenic
1057045456 9:91882814-91882836 CTTTCTCCTTGGCTGGCAGATGG - Intronic
1057126113 9:92617574-92617596 CATTCTCCAAGGCTGCTAGAGGG - Exonic
1057825680 9:98370561-98370583 CTTTTCCCAAGGCAGGTGGCCGG + Intronic
1059637666 9:116186762-116186784 CATTTTCCAAAGCTGTTGGATGG - Intronic
1059764076 9:117366809-117366831 CTGTCTCCCAGGCTGGAGCACGG + Intronic
1060247256 9:121957270-121957292 CTTCCTCCCATGGTGGTGGAGGG - Intronic
1060521094 9:124294587-124294609 TTTAGTCCAAGGCTGGTGCATGG + Intronic
1060780922 9:126412094-126412116 CGCTCTCCAAGGCTGGTCAATGG - Intronic
1060936834 9:127520995-127521017 CTCTCTCCTTGGCTGGTGGCCGG - Intronic
1060992083 9:127854883-127854905 CCCTCTCCAAGGCTGGTGGGTGG + Intergenic
1203614015 Un_KI270749v1:37242-37264 CTTTCTCCCAGGCTGGAGTGTGG - Intergenic
1187542735 X:20214058-20214080 CTTTCCCCAAGAATGGTGGAAGG - Intronic
1188029868 X:25252444-25252466 TTTTCTCCATGGCTTGTAGATGG + Intergenic
1188701275 X:33267756-33267778 CCTTGTCGAAGGCTGGTTGAAGG - Intronic
1188760763 X:34026846-34026868 CTTTCTTCCTGGCTGGTAGATGG + Intergenic
1189330854 X:40144223-40144245 CTTTCTCCAAGGAGTGAGGAGGG - Intronic
1189773341 X:44447716-44447738 CTGTCACCCAGGCTGGTGTATGG + Intergenic
1189987956 X:46570735-46570757 CTGTCACCCAGGCTGGTGGAAGG - Intergenic
1191169203 X:57423774-57423796 CTGTATCCAAGGCAGGTGAAAGG - Intronic
1194116826 X:89910988-89911010 CTGTCTCCCAGGCTGGAGGGCGG + Intergenic
1195933411 X:110102313-110102335 CTGTCACCCAGGCTGGAGGACGG - Intronic
1199508638 X:148594820-148594842 TTTTCTGCAAGGCTGGGGAAAGG - Intronic
1200469621 Y:3568156-3568178 CTGTCTCCCAGGCTGGAGGGCGG + Intergenic
1201975991 Y:19849899-19849921 TTTTCTCCAAAGCTTGTAGATGG + Intergenic