ID: 1096415599

View in Genome Browser
Species Human (GRCh38)
Location 12:51409887-51409909
Sequence GCTGAGTAAAGGGATTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096415596_1096415599 -6 Left 1096415596 12:51409870-51409892 CCATTTCAACTTTTTGGGCTGAG 0: 2
1: 3
2: 6
3: 25
4: 214
Right 1096415599 12:51409887-51409909 GCTGAGTAAAGGGATTTAAGAGG 0: 1
1: 0
2: 1
3: 7
4: 160
1096415593_1096415599 3 Left 1096415593 12:51409861-51409883 CCAAAAAAACCATTTCAACTTTT 0: 1
1: 0
2: 3
3: 57
4: 589
Right 1096415599 12:51409887-51409909 GCTGAGTAAAGGGATTTAAGAGG 0: 1
1: 0
2: 1
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096415599 Original CRISPR GCTGAGTAAAGGGATTTAAG AGG Intronic
901118156 1:6865591-6865613 GCTAAGAAAAGGAATGTAAGAGG + Intronic
902913829 1:19623389-19623411 CCTAAGTAAATGTATTTAAGAGG + Intronic
904056450 1:27673753-27673775 GCTGAGCAAAGGGGTCTAAAAGG - Intergenic
905742064 1:40379955-40379977 GCAAAGTAAAGGAATTTAACTGG - Intronic
907279167 1:53334238-53334260 ACTAAGTGAAAGGATTTAAGGGG - Intergenic
908337870 1:63145721-63145743 GCTGAGTAAAGGAGTTTGGGAGG - Intergenic
911268345 1:95770954-95770976 GCTGAGAAGAAGGATTTCAGGGG - Intergenic
911666832 1:100562854-100562876 GCTGTGTTAAGGGGTTTAATGGG + Intergenic
912094475 1:106121300-106121322 GCTGAGTACAGGGTTTTTATGGG - Intergenic
912976686 1:114337305-114337327 ACTGAGTTGAGGGATGTAAGAGG + Intergenic
916312661 1:163414202-163414224 CATGAGTAAAGGCATTTAGGTGG - Intergenic
919332093 1:196184840-196184862 TCTAAATACAGGGATTTAAGTGG - Intergenic
920001792 1:202805965-202805987 CCTGAGGAAAGGGGTTAAAGAGG - Intronic
922119678 1:222652386-222652408 TCTGAGTAAAGGCATTCATGAGG - Intronic
922412844 1:225392522-225392544 GCTGAGTAAAGGTTTGTAAAGGG - Intronic
923714391 1:236412465-236412487 GATAAGCAAAGGGATTTAGGTGG - Intronic
923744943 1:236691705-236691727 GGTGAGTGAAGGGATGTAAAAGG - Intronic
924239680 1:242029303-242029325 ACTGAGTAAAGGCATTCAGGAGG + Intergenic
924625734 1:245695318-245695340 GCTGAGGAAATGGAGTGAAGTGG - Intronic
1063666616 10:8064661-8064683 GCTGATTAAATGAATTTCAGAGG + Intronic
1063973864 10:11400080-11400102 GCTGAGAAAGGTGATGTAAGTGG - Intergenic
1064974101 10:21095456-21095478 GCTGAGTTAAGGGTGTTAAACGG + Intronic
1065189599 10:23197403-23197425 GATGAGTTTATGGATTTAAGAGG - Intergenic
1067775397 10:49161338-49161360 GCTGAGAAAATGGTTTTAACAGG - Intronic
1072390364 10:94978491-94978513 ACTGAGGAAAGAAATTTAAGAGG - Intronic
1073969865 10:109035233-109035255 GGAGGGTAAAGGAATTTAAGAGG + Intergenic
1078307124 11:10200601-10200623 GCTGACTAAAGAAATTTAACAGG - Intronic
1081001948 11:37685054-37685076 GATGATTAAAGAGATTGAAGGGG + Intergenic
1081308523 11:41542634-41542656 GCTGGGTAAATGGATTCAAGTGG + Intergenic
1089087017 11:115828709-115828731 GGGGAGTAAAGGGACTTAAATGG + Intergenic
1092031783 12:5292599-5292621 GCTCAGTAAAGAGATTTACACGG + Intergenic
1096415599 12:51409887-51409909 GCTGAGTAAAGGGATTTAAGAGG + Intronic
1099631780 12:85157772-85157794 TCTGAGTATAGGGATTTTGGTGG + Intronic
1100180051 12:92075285-92075307 TCTGAGAATAGTGATTTAAGAGG - Intronic
1100658400 12:96671307-96671329 GCAGAGTAAAGGGAATTGGGAGG - Intronic
1100860771 12:98804029-98804051 GCTGTCTAAACAGATTTAAGTGG - Intronic
1101101337 12:101396547-101396569 GCTGAGAAAAGCCATTTTAGTGG - Exonic
1102967610 12:117140386-117140408 GCTGATTACAGGCATTTAACGGG - Intergenic
1107965429 13:45593493-45593515 GAGGATTAAAGGGATTTAATTGG - Intronic
1109064368 13:57666533-57666555 GCTGAGAAAAGTTATTTAATAGG - Intronic
1111886066 13:94022682-94022704 GGTGAGAAAAGGGATTGATGTGG - Intronic
1112962628 13:105145464-105145486 GGAGAGTAAAGGGCTTTAAGGGG + Intergenic
1112962634 13:105145488-105145510 GGAGAGAAAAGGGCTTTAAGGGG + Intergenic
1114175234 14:20312532-20312554 GCTGAGGAAAAAGATTTAATAGG - Intronic
1115817503 14:37178695-37178717 GCTTAGTAAAGGGATCTGGGTGG - Intergenic
1115910686 14:38254418-38254440 GTGGAGTAAAGGGAATTTAGAGG + Exonic
1116965037 14:51005336-51005358 GGTGAGTAGAGGCACTTAAGGGG + Intronic
1118249155 14:64142259-64142281 GCTGGCAAAAGGAATTTAAGTGG - Intronic
1119576093 14:75723735-75723757 GCTGATGAAATGGACTTAAGGGG - Intronic
1123723446 15:23080190-23080212 GCAGCCTAAAGGGATTGAAGTGG - Intergenic
1125928318 15:43581825-43581847 GGTGGATATAGGGATTTAAGAGG - Intronic
1125941484 15:43681660-43681682 GGTGGATATAGGGATTTAAGAGG - Intergenic
1125963330 15:43851454-43851476 GCTGTGAAATGGGATTTAACAGG + Intronic
1126145066 15:45466272-45466294 GCTAAGAAAAGAGATTTAATTGG - Intergenic
1127062547 15:55201816-55201838 ACTGAGTAAAGGACTTAAAGAGG - Intergenic
1132174851 15:99704108-99704130 GCTAATTAAAGGACTTTAAGGGG + Intronic
1133570899 16:7038927-7038949 TCTGATTAAAGGGATGTCAGAGG - Intronic
1134201796 16:12205365-12205387 GCAGAGTGACGGGATTTATGAGG - Intronic
1136343835 16:29663007-29663029 GCTGAGGAATGGGATGGAAGTGG - Intronic
1137972830 16:53002442-53002464 GCTCAGTCAAGGCATTTAAAGGG + Intergenic
1140467122 16:75191477-75191499 GCCGAGAAAAGAGATTTAATCGG + Intergenic
1141463519 16:84192111-84192133 TCTGAGTTAAGGGATTTAAGGGG - Intronic
1147268234 17:39247807-39247829 GGTGAAAAAAGGGATTTTAGAGG + Intergenic
1149998881 17:61419746-61419768 GCTGAGTGAAAGGATTTGAAGGG + Intergenic
1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG + Intergenic
1151126506 17:71851277-71851299 ACTAATTAAAGTGATTTAAGAGG + Intergenic
1154972522 18:21424813-21424835 GCTGAGGAAAGGGATGAAACAGG - Intronic
1156850253 18:41717986-41718008 GCTGAATAATGGGCTTTAATAGG - Intergenic
1157135968 18:45055853-45055875 GCAGATTAAAGGGATTTTATAGG + Intronic
1164492074 19:28724381-28724403 TCTGAGAAAATGGATTTAAGTGG - Intergenic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1167866951 19:52336534-52336556 GGTCAGTAAAGAGTTTTAAGCGG - Intronic
1167967381 19:53158461-53158483 GGTCAGGAAAGGGTTTTAAGCGG + Intronic
925009634 2:472724-472746 GGAGAGTAATGGGATTTAGGTGG + Intergenic
929901420 2:46006937-46006959 GCTGAGTAAAGGTTTTTAGAAGG + Intronic
935122964 2:100198291-100198313 TCTGCGTAAATGGATTTCAGGGG - Intergenic
935827760 2:106968615-106968637 TCTGAGGAAAGGCATTTAGGTGG - Intergenic
936235899 2:110742327-110742349 GTTGAGGAAAGTGATCTAAGAGG - Intronic
936250393 2:110864021-110864043 CCTGAGTGAAGGGATCTGAGTGG - Intronic
937889232 2:126924094-126924116 GCTGATAAAAGGAATTAAAGAGG - Intergenic
939750253 2:146035348-146035370 GCTGATTAAATGAATTTAATAGG + Intergenic
939823705 2:146988270-146988292 GGTGAGTAAATGCACTTAAGAGG + Intergenic
940694261 2:156959381-156959403 GCTGAGTCCAGGGATTTTATGGG + Intergenic
940963259 2:159809538-159809560 GCTTAGAAAAAGGAATTAAGAGG - Intronic
941591895 2:167430267-167430289 GCTGAAGAAAGGGAATTAGGAGG + Intergenic
943245079 2:185436563-185436585 GCTGATTAAAGAAATATAAGCGG + Intergenic
945420775 2:209633532-209633554 GATAAGTAAATGGATTAAAGAGG + Intronic
945423439 2:209667944-209667966 GCTTTGTAATGGGATTTATGCGG - Intronic
1169176075 20:3515547-3515569 CCTTAATAAAGGGATTTCAGAGG + Intronic
1169361365 20:4952203-4952225 TCTGAGTAAAGGGACTAAAAGGG + Intronic
1170552953 20:17492733-17492755 GCTGAGTAAATGTGTTTAAATGG - Intergenic
1171510826 20:25683291-25683313 GGTGACTACAGGGACTTAAGAGG + Intronic
1173878943 20:46396046-46396068 GCAGCCTAAAGGGATTGAAGTGG + Intronic
1178425294 21:32474252-32474274 GCAGAGTGGAGGGCTTTAAGCGG - Intronic
1179956485 21:44742282-44742304 GCTGGGTAATGAGATTTAAAAGG + Intergenic
1182034740 22:27189063-27189085 GCAGAGAAACAGGATTTAAGAGG + Intergenic
1182042133 22:27246428-27246450 GCAGAGTAAGGGGATTGAAAGGG + Intergenic
1182237388 22:28885955-28885977 GCTAAGTAAAGTGACTTAAATGG + Intronic
955071886 3:55578455-55578477 GCTGAGTAAAGGCCTTTCTGAGG - Intronic
955389294 3:58508642-58508664 ACTTAGTAAAGGGAATTAAGAGG - Intronic
960019248 3:112931508-112931530 GCTGAAGAAAGGGATATAATTGG - Intronic
962579487 3:136784894-136784916 GCTGATAAAAGGGATCTGAGTGG - Intergenic
962844421 3:139262373-139262395 ACTGAGGAGAGGGAGTTAAGGGG - Intronic
963302193 3:143610914-143610936 ACTGAGTAACCGTATTTAAGAGG - Intronic
963932621 3:151019804-151019826 GCTGCGTAAAGGAATGTGAGTGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965005652 3:163019242-163019264 GCTGAGTCCAGGGTTTTAATGGG - Intergenic
966121135 3:176521881-176521903 CCTGAGCAAAGGCTTTTAAGGGG + Intergenic
967091204 3:186136316-186136338 GATTAGAAAAGGGTTTTAAGGGG - Intronic
967935243 3:194722398-194722420 GCTGAGTGCTGGGATATAAGAGG - Intergenic
971458448 4:26867851-26867873 GCTGAGAACAGAGACTTAAGAGG - Intronic
974941914 4:68479584-68479606 GAAAAGCAAAGGGATTTAAGGGG - Intronic
977443166 4:97096381-97096403 ATTGAATAAATGGATTTAAGAGG - Intergenic
979127329 4:116991199-116991221 GCTAAGTAAATATATTTAAGTGG - Intergenic
979667447 4:123327867-123327889 GCTGAGTATAGGGATGAAAGAGG + Intergenic
980340265 4:131535299-131535321 GCTGGCTAAAGGGATTTTAAGGG + Intergenic
980933403 4:139203105-139203127 GCTGAGGGAAGGGATTAAAAAGG + Intergenic
982839152 4:160160159-160160181 GCTGAGTTCAGGGTTTTAATGGG + Intergenic
985533015 5:444685-444707 CCTGAGTGTCGGGATTTAAGGGG + Intronic
986414525 5:7515391-7515413 GCTGAGTCAAGAGAGTTGAGTGG + Intronic
986898913 5:12407539-12407561 ACTGATTAAAGAAATTTAAGAGG - Intergenic
988240463 5:28601387-28601409 GCTGTGAAAAGGGAGGTAAGAGG - Intergenic
988729843 5:33961202-33961224 GCTGACTACAGGGAATAAAGAGG - Intronic
989229255 5:39067604-39067626 GTTGAGAAAAGGGATATAAATGG - Intronic
992426027 5:76658204-76658226 GCTGATAAAAGGGATAAAAGGGG + Intronic
1001393230 5:171397588-171397610 GAGAAGTAAATGGATTTAAGTGG - Intronic
1004555865 6:16697487-16697509 GGTGGGAAAAAGGATTTAAGTGG - Intronic
1007916662 6:45567796-45567818 GCTTACTAATGTGATTTAAGTGG - Intronic
1009751918 6:67886225-67886247 GCTGGGAAGAGGGATGTAAGGGG + Intergenic
1013899113 6:115131898-115131920 GCTGAGTCCAGGGATTTTATGGG - Intergenic
1014213478 6:118730886-118730908 TCAGAGCAAAGGGATTTGAGAGG - Intergenic
1015976286 6:138794694-138794716 TGTGAGAATAGGGATTTAAGGGG + Intergenic
1017752480 6:157500866-157500888 ACTGAGAAAAGGGTTTTAAAAGG - Intronic
1021097275 7:16548043-16548065 GCTGAGTTTAGGGATTTCATGGG - Intronic
1023493008 7:40764224-40764246 GCTGAGGTAAGGCATTTAACAGG - Intronic
1028500775 7:91516752-91516774 GCTGATTAAATGAATTTAAATGG - Intergenic
1031500933 7:122515302-122515324 GTGGAGCAAAGGGTTTTAAGGGG - Intronic
1034459491 7:151190718-151190740 GCTGAGGACAGGGATCTAGGAGG + Intergenic
1035087287 7:156271408-156271430 GCTGAGTACAGGGCTTTTATGGG + Intergenic
1035490406 7:159271457-159271479 TGTGAGAAATGGGATTTAAGAGG + Intergenic
1037295874 8:17399459-17399481 GCTGAGGAAAGAAATTAAAGAGG + Intronic
1040822281 8:51575127-51575149 GGAGGGTAAAGGGACTTAAGAGG + Intronic
1042002589 8:64142546-64142568 GCTGAGGAAAGAAATTAAAGAGG + Intergenic
1043263993 8:78239093-78239115 GCTGAGTAAAGTGTATAAAGGGG - Intergenic
1045749401 8:105464353-105464375 GCTGAGTAAATGAATTTTATAGG + Intronic
1047927381 8:129694772-129694794 CCTGGGTCAAGGGATTTTAGAGG + Intergenic
1048163965 8:132045683-132045705 TGTAAGTAAAGGGATTGAAGTGG - Intronic
1048603068 8:135939742-135939764 GAAGACTAGAGGGATTTAAGTGG + Intergenic
1051164822 9:14250196-14250218 GCTGAGTCAAGGAAGATAAGAGG + Intronic
1051688976 9:19689156-19689178 GCTGAGTGAAGTGAATTAAGTGG + Intronic
1053681858 9:40490948-40490970 CCAGAGTAAAGAGATTGAAGAGG - Intergenic
1053931848 9:43119277-43119299 CCAGAGTAAAGAGATTAAAGAGG - Intergenic
1054281856 9:63133984-63134006 CCAGAGTAAAGAGATTGAAGAGG + Intergenic
1054294951 9:63326451-63326473 CCAGAGTAAAGAGATTGAAGAGG - Intergenic
1054392972 9:64630950-64630972 CCAGAGTAAAGAGATTGAAGAGG - Intergenic
1054427622 9:65136160-65136182 CCAGAGTAAAGAGATTGAAGAGG - Intergenic
1054502756 9:65885379-65885401 CCAGAGTAAAGAGATTGAAGAGG + Intronic
1057068300 9:92074884-92074906 GCTGGGAAGAGGGATGTAAGGGG - Intronic
1059988863 9:119845625-119845647 GCTGAGGAAAGGGAGGTTAGGGG + Intergenic
1062082875 9:134633769-134633791 GATGCGTAGAGGGTTTTAAGAGG - Intergenic
1191058631 X:56270902-56270924 GCTGACTACATGGATTTGAGTGG - Intronic
1194261391 X:91700050-91700072 GCTGCTTAAAGGGATGTTAGGGG - Intergenic
1195050868 X:101095728-101095750 TGTGAGTAAAGGGTTTTAATAGG - Exonic
1196075276 X:111569111-111569133 GCTGAGTAAGAGGAATAAAGGGG - Intergenic
1197850086 X:130849219-130849241 ACAAGGTAAAGGGATTTAAGTGG + Intronic
1200580041 Y:4938851-4938873 GCTGCTTAAAGGGATGTTAGGGG - Intergenic
1201274030 Y:12282236-12282258 ACTGAGTAAAGAGACATAAGAGG + Intergenic
1202332535 Y:23770041-23770063 ACTGAGTAAAGAGTTTAAAGGGG - Intergenic
1202538234 Y:25900022-25900044 ACTGAGTAAAGAGTTTAAAGGGG + Intergenic