ID: 1096417379

View in Genome Browser
Species Human (GRCh38)
Location 12:51425380-51425402
Sequence ACGTGGGCAGAAAGGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096417371_1096417379 8 Left 1096417371 12:51425349-51425371 CCGGCGTCTGGCCTCGCGTTGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG 0: 1
1: 0
2: 0
3: 25
4: 149
1096417372_1096417379 -3 Left 1096417372 12:51425360-51425382 CCTCGCGTTGTCCTGCCAGAACG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG 0: 1
1: 0
2: 0
3: 25
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096417379 Original CRISPR ACGTGGGCAGAAAGGGTAGC AGG Intronic
900093478 1:930613-930635 ACCCGGTCAGCAAGGGTAGCTGG - Intronic
902630405 1:17701360-17701382 ATGTGGGCAGAAGTGGTGGCGGG + Intergenic
902861843 1:19252153-19252175 AAGTGGGCCGAAACGGCAGCAGG - Intronic
904289430 1:29474680-29474702 AGGAGGGGAGAAAGGGTAGCAGG + Intergenic
905030203 1:34877201-34877223 ACCTGCGCAGCAAGGGGAGCTGG + Intronic
906360245 1:45150586-45150608 ATAGGGGCAGAAAGGGGAGCTGG - Intronic
908730065 1:67216940-67216962 ACTTGGGCAGAAAGGGGAGGAGG + Intronic
915327228 1:155086690-155086712 ACGTGGGGGGAAGGGGTAGAGGG - Exonic
915518187 1:156425820-156425842 ATGTGGGCAGAAAAGGTAGGAGG + Intronic
915896531 1:159815446-159815468 CCGTGGGGAGAAAGGTGAGCTGG + Exonic
920942869 1:210500639-210500661 ACCTGGGCAGAAAGATCAGCAGG + Intronic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
921196048 1:212759411-212759433 GCATGGGAAGAAAGGGAAGCAGG + Intronic
921204825 1:212839698-212839720 AGGTAGGCAGCAAGGGTGGCAGG + Intronic
922915751 1:229256227-229256249 AGGTGGGCAGGAAGGGGAGGTGG + Intergenic
922991187 1:229913027-229913049 AAGTGGGTAGAAATGGTAGCGGG + Intergenic
924815981 1:247442575-247442597 AGGTGGACAGAAAGGGCAGTGGG + Intronic
1069783613 10:70974048-70974070 ACTTGGGGAGAAAGGGTAGGGGG + Intergenic
1069786425 10:70990999-70991021 ACTTGGGCAGACAGGAGAGCTGG + Intergenic
1069996353 10:72344397-72344419 ACCTGGGGAGAAATGGGAGCTGG + Intronic
1072730018 10:97839860-97839882 ACATGAGCACAAAGGGTAACAGG - Intergenic
1072847853 10:98852295-98852317 CCTTGGGCAGAAAAGGTAGCAGG - Intronic
1073288604 10:102402558-102402580 ATGTGGGCAGGGTGGGTAGCTGG - Intergenic
1077341472 11:2028245-2028267 TCATGGGCAGAAAGGGGAGCTGG - Intergenic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1081250783 11:40830680-40830702 ACGTCGGCATGAAGGGTAGAGGG - Intronic
1083533780 11:63449925-63449947 GGGTGGGCAGAAAGGGGAGGGGG - Intergenic
1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG + Intronic
1202824458 11_KI270721v1_random:83434-83456 TCATGGGCAGAAAGGGGAGCTGG - Intergenic
1092427417 12:8385948-8385970 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG + Intronic
1100330945 12:93581709-93581731 ACGTTGGCAGAAAGGAGAGAAGG - Intronic
1103223257 12:119264427-119264449 AAGTGGGGAGAAAAGGTAGGAGG + Intergenic
1103343459 12:120233824-120233846 ACGCTGGCAAAAAGGGAAGCGGG - Intronic
1105045764 12:133002009-133002031 ACGTGAGAAGAAAGGGAAGCGGG - Intronic
1106052858 13:26207804-26207826 AAGGGGCCAGAATGGGTAGCAGG - Intronic
1106354320 13:28965222-28965244 AGGTAGGCAGAAGTGGTAGCAGG + Intronic
1106594431 13:31124421-31124443 AAGGGGGCAGAAAGAGGAGCTGG - Intergenic
1106594656 13:31125866-31125888 AAGGGGGCAGAAAGAGGAGCTGG + Intergenic
1110187763 13:72694588-72694610 ACCTGGGAAGAATGTGTAGCAGG - Intergenic
1113414371 13:110116886-110116908 GGCTGGGCAGAAAGGGCAGCAGG + Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1114535514 14:23419782-23419804 ACATGGACAGAAAGGGGAGGTGG + Intronic
1114591628 14:23870098-23870120 ACTTGGGCAGAGTGGGTTGCTGG - Intergenic
1117802974 14:59464347-59464369 ACATGAGCAGGAAGGGCAGCAGG + Exonic
1118347078 14:64948284-64948306 CCGTGGGCAGACAGGGGAGCCGG - Exonic
1118347311 14:64949829-64949851 ATGGGGGCAGAAAGGGTAGGAGG - Intronic
1121776808 14:96596753-96596775 AGGGGAACAGAAAGGGTAGCCGG - Intergenic
1122101130 14:99410425-99410447 AGGTGGGATGAAAGGGCAGCTGG - Intronic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1123800472 15:23814564-23814586 CCGTGGGCAGACAGGGTAGTGGG + Intergenic
1124398078 15:29322771-29322793 AAGTGGGCAGGAAGGGAAGGAGG - Intronic
1126663348 15:51053576-51053598 AGGTGGGGAGAAGGGGTAGGTGG - Intergenic
1126795059 15:52253895-52253917 ACTTGGGCTGTAAGGGTATCAGG + Intronic
1131988177 15:98065946-98065968 ACTTGGGCAGAAAGGGAGGAGGG - Intergenic
1132226017 15:100141960-100141982 ACCTGGCCAGAATGGGTGGCTGG - Intronic
1132524124 16:405949-405971 ACGTGGTCAGGAAGGGGAGCAGG + Intronic
1133370829 16:5244430-5244452 ATGTGGGCAGGCAGGGTAGGTGG + Intergenic
1140245662 16:73245763-73245785 AGGTGAGCAGAGAGGGTAGCTGG + Intergenic
1140985477 16:80154403-80154425 AGGTGGGCAGAAAGGTCAGGAGG - Intergenic
1141306692 16:82871256-82871278 ATGTGGTCAGACAGGGTGGCTGG + Intronic
1142754560 17:2008426-2008448 ACGTAGGAAGGAAGCGTAGCCGG + Intronic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1144387558 17:14763558-14763580 ACGGGGGCAGAGTGGGTACCAGG - Intergenic
1144876243 17:18398946-18398968 TCGTGGGCACCAAGGGCAGCAGG - Intergenic
1145155985 17:20545474-20545496 TCGTGGGCACCAAGGGCAGCAGG + Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1151531793 17:74711256-74711278 AAGTGGGCAGAAAAGCCAGCAGG - Intronic
1152015962 17:77750354-77750376 ACGTGGGCATAGATGGTGGCAGG + Intergenic
1152434769 17:80269345-80269367 AGGTGGACAGATAGGGTAGAGGG - Intronic
1152888003 17:82863836-82863858 ATGGGGGCAGAGAGGGTAGCAGG + Intronic
1152917884 17:83051485-83051507 ACGGGGGCAGGAAGCGCAGCCGG + Intronic
1153243815 18:3054333-3054355 ACAAGGTCAGAAAGGGAAGCAGG - Intergenic
1158453388 18:57586483-57586505 GCGTGGGCAGAGCGGGCAGCTGG - Intronic
1161257349 19:3316675-3316697 CTGTGGGGAGAAAGGGTGGCTGG + Intergenic
1162126812 19:8503830-8503852 CCCTGGGCAGAAAGCTTAGCTGG + Intergenic
1162722867 19:12672906-12672928 ACGTGGGCAGTGAGTGTGGCTGG + Exonic
1163188468 19:15658276-15658298 ACATGGTCAGGAAGGGCAGCTGG - Exonic
1163193259 19:15695948-15695970 ACATGGTCAGGAAGGGCAGCTGG - Exonic
1163200246 19:15761341-15761363 ACATGGTCAGGAAGGGCAGCTGG + Intergenic
1163220507 19:15914861-15914883 ACATGGTCAGGAAGGGCAGCTGG + Exonic
1163228588 19:15981433-15981455 ACATGGTCAGGAAGGGCAGCTGG + Intergenic
1163491892 19:17621733-17621755 ACCTGGGCAGGAAGGGCAGCTGG - Intronic
1164400788 19:27900785-27900807 AGGTGGGCAGCAAGGGAGGCTGG - Intergenic
1164758713 19:30710734-30710756 CTGTGGGCAGAAAGAGTGGCCGG - Intronic
1166855573 19:45781325-45781347 AGGTGGGCAGACAAGGCAGCTGG + Intronic
926001687 2:9338626-9338648 ACAGTGGAAGAAAGGGTAGCTGG - Intronic
927503127 2:23595579-23595601 GAGTGGGCAGGAAGGGTGGCAGG + Intronic
930085054 2:47490789-47490811 AATTGGGAAGAAAGGGTAGGGGG + Intronic
931724182 2:65092976-65092998 ACTGTGGCAGAAAGGGAAGCAGG - Intronic
933528293 2:83472540-83472562 ACATGGGCAGAAAAGGAGGCTGG + Intergenic
933941825 2:87251588-87251610 ATGTGGGCAGAAAGAGGAGCTGG - Intergenic
936338398 2:111609981-111610003 ATGTGGGCAGAAAGAGGAGCTGG + Intergenic
936349623 2:111702900-111702922 ACTTGGGCACAAAGTGTGGCGGG - Intergenic
940329009 2:152454666-152454688 ATGTGGGCAGAAAGGGATGCTGG + Intronic
941013928 2:160333138-160333160 GTGGGGGCAGAAAGGGTAGGTGG + Intronic
941739255 2:169015535-169015557 ACCTGGGGAGAAGGAGTAGCAGG - Intronic
943414602 2:187585510-187585532 ACATGGACAGATAGTGTAGCTGG + Intergenic
944470933 2:200053609-200053631 ACTTGAGTACAAAGGGTAGCAGG + Intergenic
946455485 2:219822365-219822387 ACGTGGGCAGCAGGGGTCTCAGG - Intergenic
947860356 2:233353889-233353911 ACGGGGGAAGAAAGGGAAGCTGG - Intergenic
948939259 2:241187951-241187973 AGGTGGGGAGAAAGGATAGGAGG + Intergenic
1171343848 20:24451139-24451161 ACGGGGGCAGTAAGGAGAGCAGG - Intergenic
1171907568 20:30912378-30912400 ACGTGGGTAGTGAGGGGAGCTGG - Intergenic
1172442109 20:34973154-34973176 ACTGGGGCATAAAGGGGAGCGGG - Intergenic
1173755512 20:45512203-45512225 ACCAGGGAAGAAAGGGGAGCTGG - Intergenic
1180179245 21:46110718-46110740 AGCTGGGCAGAAAGGGCACCGGG - Intronic
1182293422 22:29299309-29299331 CCGGGGGCGGAAAGGGTGGCGGG - Exonic
1182683601 22:32102722-32102744 CCGAGGCCAGGAAGGGTAGCAGG - Intronic
1183027950 22:35080215-35080237 ACATAGGCAGAAAGTGTAGGTGG - Intronic
952220576 3:31320206-31320228 AGGTGGGCAGAAAGGATAAGGGG - Intergenic
953365847 3:42344370-42344392 ACGTGGACAGAAAGGCTTTCAGG - Intergenic
954880621 3:53833555-53833577 AGGTGGGCAGGAATGGGAGCAGG + Intronic
961282017 3:125771443-125771465 ATGTGGGCAGGCAGGGTAGGTGG + Intergenic
962461492 3:135618515-135618537 ATGTGGGCAGAAAGGGAGCCTGG - Intergenic
965753955 3:172006375-172006397 AGTTGGGCAGAAAGAGTAGTTGG - Intergenic
966740388 3:183227358-183227380 AGGTGGGAAGAAGGGGTAGTTGG + Intronic
968446409 4:654413-654435 ACGTGGGGAGATGGGGCAGCAGG - Intronic
968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG + Intronic
972034596 4:34505555-34505577 AAGTGGGCAGCAGGGGTAGTAGG + Intergenic
973301102 4:48585403-48585425 AAGTGGGGAGAAAGGATTGCTGG + Intronic
973813707 4:54598497-54598519 ACCTGGCCAAAAAGGGTGGCAGG + Intergenic
974162813 4:58161864-58161886 TCTTGGGGAGAAAGGGAAGCAGG + Intergenic
976763608 4:88576401-88576423 GAGTGGGCAGAAGGGGTGGCAGG - Intronic
977808666 4:101333992-101334014 ACGTGAGCAGGATGGGTAGATGG + Intronic
983941638 4:173539009-173539031 AGGTGGACAGAAAAGGAAGCTGG - Intergenic
985677008 5:1237408-1237430 ATGTGGGCAGAAGGGGTACAGGG + Intronic
987557864 5:19478665-19478687 CTGTGGACTGAAAGGGTAGCTGG + Intronic
987608876 5:20176057-20176079 AGGTGGGGAGAAAGGGTTGTTGG - Intronic
994083449 5:95732143-95732165 AAGTGGGCAGAAGGGGGAGGGGG - Intronic
997234476 5:132264864-132264886 AAGAGGGCAGATAGGGAAGCTGG - Intronic
997981205 5:138468241-138468263 AAGTGGGCAGAAAGGATTGTTGG - Exonic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1000049851 5:157553001-157553023 TCCTGGGCAGAAAGAGTAGAAGG + Intronic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1006931046 6:37688674-37688696 ACGAGAGCAGAGAGGGTGGCAGG - Intronic
1007936940 6:45740885-45740907 GGCTGGGCAGAAAGGGGAGCAGG + Intergenic
1012309775 6:97708737-97708759 ACGAGGAGAGAAAGGGAAGCTGG - Intergenic
1014390616 6:120857709-120857731 ACGTGGGCAGAACTGGCACCAGG - Intergenic
1014474937 6:121860408-121860430 AGGTGTGGATAAAGGGTAGCAGG + Intergenic
1015440785 6:133243008-133243030 ACCTTGGCAGAAAGGGCAGAGGG - Intronic
1019785706 7:2976039-2976061 ACGTGGGCTGCAGGGGTGGCGGG - Intronic
1023265648 7:38403266-38403288 AATTCGGCAGAAAGGGTAGGTGG + Intronic
1024162886 7:46696943-46696965 ACGTGAGCAGAAAGAGGAGTGGG + Intronic
1027761308 7:82282501-82282523 CTGTGGGCAGGAAGGTTAGCAGG + Intronic
1027840376 7:83303322-83303344 AAGTGGTCACAAAGGGTGGCTGG - Intergenic
1028637145 7:93002050-93002072 ACTTGGGGAGAAAGGGAAGAAGG - Intergenic
1029074383 7:97924597-97924619 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1035338535 7:158145557-158145579 ACGTGAGCAGAAAGGCCATCAGG + Intronic
1036829407 8:12010499-12010521 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1036898507 8:12654737-12654759 ATGTGGGCAGGAAGGGCAGGTGG - Intergenic
1037604064 8:20422667-20422689 ACGAGGGCAGAAAGGGGACCTGG - Intergenic
1047014543 8:120709946-120709968 CCTTGGGCAGAAAGGGTAAAGGG - Intronic
1047641854 8:126828988-126829010 ACGTGGGCAGAAAGTGGGTCTGG - Intergenic
1049409230 8:142465017-142465039 AGGTGGGCAGACAGGGGAGGCGG + Intronic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1053436852 9:38081444-38081466 ACGTGGGGAGAAAGGAAATCAGG + Intergenic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1056538812 9:87553873-87553895 TTGTGGGCAGAAAGGGAGGCAGG + Intronic
1057686187 9:97237317-97237339 ATGGGGGCAGAATGGGGAGCTGG - Intergenic
1059239217 9:112788765-112788787 AAGTGGGCAGAAAAGAGAGCAGG + Intronic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1060488367 9:124063793-124063815 AGGTTGGCAGAAAAGGTAGCAGG + Intergenic
1061877646 9:133552875-133552897 ACGTGGGGAGAAATGCTACCAGG - Intronic
1062532212 9:137006963-137006985 ACGTGGGCAGCAAGGGGTGAAGG + Intergenic
1186356658 X:8799027-8799049 CCGTGGGCAGGAAGCGCAGCAGG - Exonic
1186356987 X:8800142-8800164 CCGTGGGCAGGAAGCGCAGCAGG - Exonic
1186795476 X:13043790-13043812 CCGTGGGCAGGAAGGGCAGCAGG - Exonic
1190862925 X:54360564-54360586 CTGTAGGCAGAAAGGGGAGCGGG + Intergenic
1192809040 X:74533507-74533529 AGGTGGGGAGAAATGGAAGCAGG - Exonic
1196904563 X:120418926-120418948 ATGTGGACAGTGAGGGTAGCAGG - Intergenic
1201175571 Y:11306862-11306884 ACATGGGCAGAGAGGCCAGCGGG - Intergenic