ID: 1096418013

View in Genome Browser
Species Human (GRCh38)
Location 12:51430483-51430505
Sequence ATGTGTGAGGAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 1, 1: 1, 2: 7, 3: 71, 4: 818}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096418013_1096418021 9 Left 1096418013 12:51430483-51430505 CCCTCCACCCTCTCCTCACACAT 0: 1
1: 1
2: 7
3: 71
4: 818
Right 1096418021 12:51430515-51430537 TCTTTCCATGTGAGAGAATTGGG 0: 1
1: 0
2: 1
3: 22
4: 285
1096418013_1096418022 10 Left 1096418013 12:51430483-51430505 CCCTCCACCCTCTCCTCACACAT 0: 1
1: 1
2: 7
3: 71
4: 818
Right 1096418022 12:51430516-51430538 CTTTCCATGTGAGAGAATTGGGG 0: 1
1: 0
2: 2
3: 44
4: 456
1096418013_1096418024 19 Left 1096418013 12:51430483-51430505 CCCTCCACCCTCTCCTCACACAT 0: 1
1: 1
2: 7
3: 71
4: 818
Right 1096418024 12:51430525-51430547 TGAGAGAATTGGGGAACCTGTGG 0: 1
1: 0
2: 1
3: 44
4: 322
1096418013_1096418025 20 Left 1096418013 12:51430483-51430505 CCCTCCACCCTCTCCTCACACAT 0: 1
1: 1
2: 7
3: 71
4: 818
Right 1096418025 12:51430526-51430548 GAGAGAATTGGGGAACCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 274
1096418013_1096418020 8 Left 1096418013 12:51430483-51430505 CCCTCCACCCTCTCCTCACACAT 0: 1
1: 1
2: 7
3: 71
4: 818
Right 1096418020 12:51430514-51430536 TTCTTTCCATGTGAGAGAATTGG 0: 1
1: 0
2: 3
3: 28
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096418013 Original CRISPR ATGTGTGAGGAGAGGGTGGA GGG (reversed) Intronic
900298778 1:1966190-1966212 ATGAGTGTGGAGAGGGAGGCGGG + Intronic
902758829 1:18567452-18567474 TTGTGTGAGGAAAGGGTGGAGGG - Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903578432 1:24353501-24353523 ATGGGTGGGTAGATGGTGGATGG + Intronic
904004310 1:27355704-27355726 ATAGGTGAGCAGAGTGTGGAGGG + Exonic
904024211 1:27492007-27492029 ATGGGTGAGGGAAGAGTGGAGGG - Intergenic
904338120 1:29810968-29810990 ATGTGTGAGGCGAAGGAGGGTGG + Intergenic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905944222 1:41888437-41888459 ATATGTGAGGAGAGAGGAGAAGG + Intronic
906552445 1:46676635-46676657 AGGTGTGGGGTGAGAGTGGATGG + Exonic
907431234 1:54413139-54413161 CTGTGTGAGGAGAGGGTTTCAGG - Intronic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
907877102 1:58501707-58501729 ATGTGTGAGCAGAGATGGGAGGG - Intronic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
908322478 1:62991730-62991752 AGGTGGGAGGTGGGGGTGGAGGG - Intergenic
908325999 1:63024352-63024374 GTGTGTGGGGAGGGAGTGGAGGG + Intergenic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910364321 1:86447993-86448015 ATGTTTGAGCAAAGGGTGGGAGG + Intronic
910434527 1:87191653-87191675 ATGTGAGAGGAGAGGTTTGGGGG + Intergenic
910434630 1:87192806-87192828 ATGTGTGTGGTGAAGGTTGATGG + Intergenic
911668015 1:100576097-100576119 ATGTGTGAGGCTAGGATGCAGGG + Intergenic
911737740 1:101355941-101355963 ATGCTCGAAGAGAGGGTGGAGGG + Intergenic
912945521 1:114081041-114081063 GTGTGCTGGGAGAGGGTGGAGGG + Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913406910 1:118504374-118504396 ATGGGGGAGTAGGGGGTGGAAGG + Intergenic
913476926 1:119246550-119246572 AAGTGTGGAGAGAGGGTGGCTGG - Intergenic
914199833 1:145475137-145475159 ATCTGTGAGGCGAGGGTGTGGGG + Intergenic
914478952 1:148048272-148048294 ATCTGTGAGGCGAGGGTGTGGGG + Intergenic
914506870 1:148296979-148297001 ATATGTAAGAAGAGAGTGGAGGG - Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915141600 1:153771682-153771704 ATGTGAGAGTAGTGGGTGGGTGG + Intronic
915360463 1:155283547-155283569 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
915489419 1:156242967-156242989 ATGTGTAGGGAGAGGAGGGATGG + Intronic
915515307 1:156409304-156409326 ATGTATGAGCAGGGGATGGAAGG + Intronic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
916787262 1:168095684-168095706 ATCTGTGAGGAGGAGGAGGATGG + Intronic
917159823 1:172044969-172044991 ATGAGACAGGAGAGGATGGAAGG + Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918198018 1:182240872-182240894 ATATGTGTGGAGTGGATGGATGG + Intergenic
918213035 1:182368398-182368420 ATGTTTGAGGAAAAGGTGGAAGG + Intergenic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
918295147 1:183149558-183149580 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918295196 1:183149805-183149827 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918295233 1:183150002-183150024 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918331453 1:183464856-183464878 ATGTGGCAGGAGAGGGTGCTAGG - Intergenic
918585868 1:186187788-186187810 ATGTGTGACTAGAATGTGGAGGG - Intronic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
918965749 1:191345070-191345092 ATGTGAGAGGAAAAGGGGGAGGG - Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919747132 1:201015857-201015879 CTGGGAGAGGAGAGGCTGGAGGG + Intronic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
920210756 1:204326618-204326640 ATGTGTTGTGAGAGGGTGTAAGG - Intronic
920504136 1:206504879-206504901 ATGTGGGAGGAGATTGTGCAGGG - Intergenic
920670716 1:208002042-208002064 ATGTGTGAGGTCTGGGTGCAAGG - Intergenic
920720581 1:208382987-208383009 ATGTAAGTGGAGAGAGTGGAAGG + Intergenic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
921709528 1:218359767-218359789 GTTTGTGTGGAGAGGCTGGAGGG + Intronic
922139049 1:222863225-222863247 ATTTGTGGGGAGAGGGCTGAAGG + Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923514213 1:234681003-234681025 AGGTTGGAGGAGTGGGTGGACGG + Intergenic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
1063175749 10:3549417-3549439 AACCGTGAGGAGAAGGTGGATGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063667654 10:8073868-8073890 ATGTGTCTGGAGAGGGCGGCCGG - Exonic
1063749756 10:8930066-8930088 AAGGGTGTGGAGTGGGTGGAGGG + Intergenic
1064166703 10:12992872-12992894 ATTTGTGGGGACTGGGTGGATGG + Intronic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1066934291 10:41805979-41806001 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1067741231 10:48897354-48897376 ATGTGGGTGGAGCTGGTGGAGGG + Intronic
1067895859 10:50178693-50178715 TGGGGTGGGGAGAGGGTGGAGGG - Intergenic
1068137955 10:52969583-52969605 ATGTGTGAGGATATGGGGGTGGG - Intergenic
1069135037 10:64753393-64753415 ATGAGTGGGGAGAGGCAGGATGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069891143 10:71653143-71653165 ATGTGGCAGGAGAGGGAGGCTGG - Intronic
1069955187 10:72045966-72045988 GAGTGTGAGGACAGGGTGCAGGG + Intergenic
1070043610 10:72807640-72807662 GTGTGAGAGGAGAGGGAGGGTGG - Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072576277 10:96703461-96703483 TTGTGTGTGTTGAGGGTGGAGGG - Intronic
1072994202 10:100229054-100229076 ATGTGTGAGAAGAGGGCTGAAGG - Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076481901 10:130790244-130790266 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481908 10:130790296-130790318 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481921 10:130790400-130790422 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481970 10:130790765-130790787 ATGTGTGGGTAGAGTGTGGTGGG - Intergenic
1076819323 10:132930829-132930851 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1076819341 10:132930891-132930913 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077318301 11:1928918-1928940 ATGCCTGGGGAGGGGGTGGAAGG - Intronic
1077747908 11:4928037-4928059 GCGTGTGGGGAGAGGGTCGAGGG + Intronic
1077838271 11:5944446-5944468 ATGTGTATGGAGAGTGTGGGTGG + Intergenic
1077908587 11:6555174-6555196 ATGAGGGAGGAGAGGAGGGATGG - Intronic
1078102758 11:8339537-8339559 ATGTGTGCTTAGAGGGTGCAGGG + Intergenic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1078365974 11:10706732-10706754 GTGTGTGAGCACAGGGTGCAGGG - Intergenic
1078390555 11:10932123-10932145 GTGTGGGAAGAGAGAGTGGAGGG + Intergenic
1078538642 11:12195829-12195851 GTGTGAGAGGAGGGGGTGGTGGG + Intronic
1078630219 11:12995846-12995868 ATTTGAGGGTAGAGGGTGGAAGG - Intergenic
1078755201 11:14202464-14202486 ATGTGTCAGGACAGTGGGGAAGG + Intronic
1078763504 11:14271641-14271663 GTGTTTGAGGAGAGGGTCCAAGG - Intergenic
1079110228 11:17601273-17601295 ATGTGGCAGGAGAGGGTGCAGGG + Intronic
1079269580 11:18971787-18971809 ATGCCTGAGGTGAAGGTGGAGGG - Intergenic
1080252042 11:30244300-30244322 TGGTGGGTGGAGAGGGTGGAGGG + Intergenic
1081517947 11:43851843-43851865 ATGTGTGAAGAGTGGCAGGAGGG - Intronic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1082600117 11:55138686-55138708 TGGAGTGGGGAGAGGGTGGAGGG + Intergenic
1083267353 11:61552876-61552898 ATATGTGATGAGAGCCTGGAGGG - Intronic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1084485348 11:69444843-69444865 ATGTGGCTGGAGAGAGTGGACGG + Intergenic
1084596392 11:70119302-70119324 ATGGGTGATGGGTGGGTGGATGG + Intronic
1084754211 11:71224532-71224554 TTGGGTGGGAAGAGGGTGGATGG - Intronic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1084918418 11:72449259-72449281 ATCTGTGAGGAGAAGCGGGAGGG + Intergenic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085034940 11:73293965-73293987 CTGTGTGAGGAGAGGGGTCAGGG + Intronic
1085255443 11:75170077-75170099 ATGTGTGAGCAGGGGGCTGAGGG - Intronic
1085825835 11:79846346-79846368 ATGAGAGAGAAGAAGGTGGAGGG + Intergenic
1085887139 11:80534186-80534208 ATGGGTGAGGAAAGCTTGGAAGG + Intergenic
1086223857 11:84483658-84483680 ATCTGTAGGAAGAGGGTGGATGG + Intronic
1087293532 11:96343667-96343689 ATGTGTGTGTTGAGGGCGGAAGG + Intergenic
1088232706 11:107689021-107689043 AAGTGGGAGGAGAAGCTGGAAGG - Intergenic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1088871835 11:113896980-113897002 CTGAGTGGGGAGAGGGTGAACGG - Intergenic
1090077086 11:123586385-123586407 ACTTGGGATGAGAGGGTGGAAGG - Intronic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1091294483 11:134463993-134464015 ATGTTTGAGGAGAATGTGCAGGG + Intergenic
1091340773 11:134811664-134811686 ATGTGGGAGATGAGGGTGGCAGG + Intergenic
1091427914 12:407482-407504 ATGTGTGAGTCTAGAGTGGAGGG + Intronic
1092725451 12:11481116-11481138 ATGTGTCAAGAGAAGGTGAAAGG + Intronic
1092867392 12:12775523-12775545 ATGTGTGAGGGCAGGGAGCACGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093113997 12:15187133-15187155 ATCTTTGAGGAGATGGTGGGAGG + Intronic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095507175 12:42910150-42910172 ATGTGTGAGGCTAGGGTAGGAGG - Intergenic
1096145911 12:49278554-49278576 AAGTGTGCAGAGAGGGTGAAGGG - Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1096524611 12:52203047-52203069 ATGAGTGAGCACAGGGTGCAGGG - Intergenic
1096563393 12:52453464-52453486 ATGGGTGAGGAAGAGGTGGAGGG + Intergenic
1096911271 12:54986757-54986779 ATGGGAGGGTAGAGGGTGGAAGG - Intergenic
1097305637 12:58066243-58066265 ATGTGTGTGGAGACTGTGGCAGG + Intergenic
1097755339 12:63401298-63401320 GTCTGAGAGAAGAGGGTGGATGG - Intergenic
1097922308 12:65089570-65089592 ATGTGGGAGAAGAGGCTGGTGGG - Intronic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1101103130 12:101414202-101414224 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102598773 12:114012992-114013014 AGGAGGGAGGAGAGGGAGGAGGG + Intergenic
1102657207 12:114492075-114492097 AAGAGTGAGGAGAGAATGGATGG + Intergenic
1102691864 12:114767472-114767494 ATCTGGGAGAAAAGGGTGGAAGG - Intergenic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1102992026 12:117322416-117322438 AGGAGTGAGGAAAGGGAGGAGGG - Intronic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1103057746 12:117835066-117835088 ATGCCTGAGGACAGGATGGATGG - Intronic
1103512351 12:121484105-121484127 AGGTGGGAGGAGAGGGAGGCGGG - Intronic
1103605699 12:122084442-122084464 AGGTTAGAGGAGAGGATGGAGGG + Intronic
1103902376 12:124310062-124310084 ATGTGGGAGGCTGGGGTGGAAGG + Intronic
1103908591 12:124339843-124339865 ATGTGTGAGTAGTGGATGGGTGG - Intronic
1104081416 12:125433661-125433683 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104762367 12:131305174-131305196 AGGTGTGAGTAGAGGGTCGCTGG - Intergenic
1104778459 12:131404863-131404885 ATGGGTGAGGGGTGGATGGATGG - Intergenic
1104817409 12:131655622-131655644 AGGTGTGAGTAGAGGGTCGCTGG + Intergenic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1105918714 13:24941122-24941144 AAGTAGGAGGAGAGGTTGGAAGG + Intergenic
1105925044 13:25000406-25000428 ATGTGTGGGGAGTGGGAGAACGG + Intergenic
1106039562 13:26076625-26076647 ATGTGTGGGGAGTGGGAGAATGG - Intergenic
1106508542 13:30392921-30392943 ATGTGCAAGGAAAGGGAGGAGGG - Intergenic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107989589 13:45806562-45806584 ATGAGAGTGGGGAGGGTGGAAGG + Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1110210019 13:72960623-72960645 GTGTGTGGGGAAAGGGTGGCAGG - Intronic
1110572280 13:77018907-77018929 AAGTTGGAGGTGAGGGTGGAGGG - Intronic
1112186848 13:97136021-97136043 ATGCGTGTGGGGAGGGTGAAGGG - Intergenic
1112441355 13:99426936-99426958 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441375 13:99426991-99427013 AGGAGAGAGGGGAGGGTGGAAGG + Intergenic
1112441394 13:99427037-99427059 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112999011 13:105610456-105610478 AGGTGTGAGAAGAGGGTGTCGGG - Intergenic
1113371448 13:109728907-109728929 GTCTGTGAGGAGAGGGAGGCAGG + Intergenic
1113934131 13:113984501-113984523 ATGGGTGAGTAATGGGTGGATGG - Intronic
1113934185 13:113984744-113984766 ATGGGTGAGTAATGGGTGGATGG - Intronic
1113934464 13:113986421-113986443 ATGGGTGAGTAATGGGTGGATGG - Intronic
1113934808 13:113988411-113988433 ATGGGTGAGTAATGGGTGGATGG - Intronic
1113934867 13:113988679-113988701 ATGGGTGAGTAATGGGTGGATGG - Intronic
1113934999 13:113989287-113989309 ATGGGTGAGTAATGGGTGGATGG - Intronic
1113939731 13:114012324-114012346 GTGTGTGTGGAGTGTGTGGACGG - Intronic
1113939744 13:114012393-114012415 GTGTGTGTGGAGTGTGTGGACGG - Intronic
1113971518 13:114195040-114195062 ATGTGTGGGGCGGGGGTGAAGGG - Intergenic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114426441 14:22627808-22627830 ATGTGTAAGGAAAGGGAAGAGGG - Intergenic
1115069818 14:29307507-29307529 ATTTCTGAGGAGAGGTGGGAAGG + Intergenic
1115193262 14:30769686-30769708 ATATGTGTGGGGAGAGTGGAGGG - Intergenic
1115524512 14:34266414-34266436 ATAGGTCAGGACAGGGTGGAAGG + Intronic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1115860558 14:37681628-37681650 ATGTCTGAGGGCAGGGGGGATGG - Intronic
1117617271 14:57546404-57546426 AAGTGAGAGGAAAGGGAGGAAGG + Intergenic
1117717770 14:58598379-58598401 AGGTGGGAGGCGAGGGTGGGAGG + Intergenic
1117756150 14:58976124-58976146 AGGAGTGAGGAGAAGCTGGAGGG + Intergenic
1118011168 14:61612036-61612058 GTGTGTGTGGAGGGGGTGGGAGG - Intronic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1118860635 14:69660350-69660372 AAGTGTCAGAATAGGGTGGAAGG - Intronic
1119601611 14:75980625-75980647 ATGCATGGGGAGAGGGAGGAAGG - Exonic
1119692403 14:76685848-76685870 ATATGTGGGGGGAGGGGGGAAGG + Intergenic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1121431550 14:93891690-93891712 AAATGTGAGCAGAGTGTGGAAGG - Intergenic
1121455852 14:94038551-94038573 ATGTGTGAGCAGGGGCGGGAGGG - Intronic
1122408916 14:101516294-101516316 TGGTGGGAGGTGAGGGTGGAAGG - Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122842243 14:104471678-104471700 ATGTGTGTGGAGAGTGCTGATGG - Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123205624 14:106710377-106710399 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1123210674 14:106757652-106757674 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1123434958 15:20247949-20247971 AGGAGAGAGGAGAGGGAGGACGG + Intergenic
1123466651 15:20521441-20521463 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1123651463 15:22479600-22479622 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123741881 15:23288461-23288483 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123745115 15:23314097-23314119 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124041546 15:26110198-26110220 AAGAAGGAGGAGAGGGTGGAGGG + Intergenic
1124267858 15:28253506-28253528 AGGTGAGAGGAGAAGTTGGAGGG - Intronic
1124277386 15:28337417-28337439 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124305316 15:28574189-28574211 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1124645739 15:31436555-31436577 ATGAGTGAGGCAAGGGTGGGTGG + Intergenic
1125196286 15:37050692-37050714 TTATGTGAGGAGGGAGTGGAGGG - Intronic
1126800056 15:52289943-52289965 ATGGGTGGGGCTAGGGTGGAAGG - Intronic
1126881841 15:53107175-53107197 TTGTGGGAGGAGTGAGTGGAGGG + Intergenic
1127167166 15:56256933-56256955 ATGGGAGAGCAGAGGGTGGGAGG - Intronic
1127324725 15:57883956-57883978 ATGTGTGGGGAGTGGGAGGCAGG - Intergenic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127760614 15:62135919-62135941 GTGTGGGAGGAGACGCTGGAGGG + Intergenic
1128129123 15:65214142-65214164 AGCTGGGAGGAGAGAGTGGAGGG + Intergenic
1128707875 15:69850835-69850857 AGGGGTGAGGAGAGGATGGGAGG - Intergenic
1128845999 15:70895430-70895452 ATTTGTGGTGAGAGCGTGGAGGG + Intronic
1129450320 15:75647837-75647859 AGGGGTGGGGAGAGGGAGGAGGG - Intronic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129912871 15:79242589-79242611 AGGAGTGAGGGGAGGGTTGACGG + Intergenic
1130671345 15:85915651-85915673 GCCTGTCAGGAGAGGGTGGATGG + Intergenic
1130677839 15:85969453-85969475 ATGTGTGAGGAAGGGGTGGATGG - Intergenic
1130913359 15:88285912-88285934 ATGAGTGAGTAGGTGGTGGATGG - Intergenic
1131248541 15:90816562-90816584 AGGTGTGAAGAGGGGGTTGATGG + Intergenic
1132257579 15:100390039-100390061 AGGTGTGAGGAAAGGGTTTATGG + Intergenic
1132415648 15:101616886-101616908 ATGTGTGATCAGAGGGTGATGGG - Intergenic
1132487868 16:205509-205531 CTGTCTGAGGAGAGGGTACATGG + Intronic
1132567933 16:631691-631713 GGGTGGGAGGAGAGGGTGGGAGG - Intronic
1132567953 16:631753-631775 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568047 16:632122-632144 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568055 16:632148-632170 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132941847 16:2512423-2512445 GAGTGTGTGGAGAGGGTGGCAGG + Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133392816 16:5422976-5422998 AGGAGTGGGGAGAGGGAGGAGGG + Intergenic
1133689548 16:8199993-8200015 ATGTGAGAAGAGAGGGAGGGAGG - Intergenic
1134677459 16:16100485-16100507 GTGTGTGAGGACAGGCTGCATGG + Intronic
1134817268 16:17215941-17215963 ATGGTTGAGGAGTGGGTGGCAGG + Intronic
1134826188 16:17286279-17286301 ATGTGGGAGGAGTGGGTGGGAGG + Intronic
1135110955 16:19690523-19690545 AGGTTTGAGGAGAGGGTGACAGG + Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1135623702 16:23977381-23977403 GGCTGTGAGGAGAGGGTGGTGGG - Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136849678 16:33603083-33603105 AGGAGAGAGGAGAGGGAGGACGG - Intergenic
1137444272 16:48522309-48522331 ATGTGTGGAGAGAAGGTGTATGG + Intergenic
1137682535 16:50362773-50362795 AGGTCTGAGGAGAGGGAGAAAGG + Intronic
1138114769 16:54351623-54351645 AGGAGAGAGGAGAGGGAGGAAGG - Intergenic
1138586185 16:57971696-57971718 ATCTAGGAGGAGAGGGTGCAAGG + Intergenic
1139431805 16:66914767-66914789 ATGAGTGATGGGAGGTTGGATGG + Intronic
1139583233 16:67885409-67885431 AGGAGTCAGGACAGGGTGGAGGG - Intronic
1139641300 16:68293632-68293654 CTGTGTGAGAAGAGGGTGCTGGG - Intronic
1139855499 16:69976534-69976556 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1139885217 16:70203652-70203674 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140972386 16:80025666-80025688 AAGGGTGGGGAGAGGATGGAAGG + Intergenic
1141167247 16:81668930-81668952 AGGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167405 16:81669632-81669654 AGGTGTGAGGTGGGTGTGGAAGG - Intronic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141372171 16:83498164-83498186 AGGTGAGAGGAGAGGGGGCAAGG + Intronic
1141673292 16:85504135-85504157 ATGTGTGAAGAGAGGTTGCGTGG + Intergenic
1142012477 16:87722893-87722915 AAATGTGAGGTGAGGGTGGGTGG + Intronic
1142064763 16:88055274-88055296 GTGTGTGCGGAGGGGGTGGGTGG - Intronic
1142114986 16:88351801-88351823 AAGGGTGGGGAGAGGGTGGTGGG - Intergenic
1143007316 17:3845723-3845745 GTGAGTGAGGAGGGGCTGGAAGG - Intronic
1144051412 17:11500192-11500214 ATCTGTGAGGAGACTGAGGATGG - Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144573904 17:16417109-16417131 AGGGGTGAGGAGAGGGAGGGAGG - Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1144684302 17:17216006-17216028 AAGAGTGAGGAGAGGATGGCAGG + Intronic
1144956213 17:19020123-19020145 ATGAGTGAGGATAGGGTTGGGGG - Intronic
1145371675 17:22311480-22311502 TGGTGAGAGGAGTGGGTGGAGGG + Intergenic
1146271960 17:31490410-31490432 ATGGGTAAGGAGGGGGTGAAGGG + Intronic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1146588703 17:34107936-34107958 AAGTGTGAGGCGAGGTGGGATGG - Intronic
1147020013 17:37523748-37523770 AGGTGGGGGGAGAAGGTGGATGG + Intronic
1147033607 17:37662532-37662554 AACTGAGAGAAGAGGGTGGAGGG + Intergenic
1147464319 17:40599040-40599062 AGGAGGAAGGAGAGGGTGGAAGG - Intergenic
1148582282 17:48752348-48752370 AGGTGACAGGAGAGGGAGGAAGG + Intergenic
1148652730 17:49261193-49261215 ATGTGTGTGGGGAGTGTGGGTGG - Intergenic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148839186 17:50483824-50483846 ATGTGTGTGGGGGGGGTGGCAGG - Intronic
1149153602 17:53599180-53599202 ATTTGAGAGTAGAGGGTGGGAGG - Intergenic
1150219479 17:63487936-63487958 AAGTGTGAGGGGAGGCTGGCCGG + Intronic
1151182866 17:72342583-72342605 ATGTGTGACGTGGGGGTGAAGGG - Intergenic
1151422794 17:74009625-74009647 AGGCGGGAGGTGAGGGTGGAGGG - Intergenic
1151821319 17:76498403-76498425 AGATCTGAGGAGAGTGTGGAGGG + Intronic
1152022822 17:77789925-77789947 ATGTGGGAAGAGAGGGCCGATGG + Intergenic
1152205000 17:78969928-78969950 ACCTGTGGGGAGAGGGTGGGTGG + Intergenic
1152263879 17:79282185-79282207 ATGGGTGGGGAGGTGGTGGAAGG + Intronic
1152607656 17:81301068-81301090 ATGTGTGTGGTGTGGGTGGATGG + Intergenic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153475522 18:5494651-5494673 TTGGGTGGGGGGAGGGTGGATGG - Intronic
1154306590 18:13234856-13234878 ATTTGGGAGGAGAGAATGGAAGG - Intronic
1154402024 18:14048447-14048469 ACTTGAGAGGAGAGGGTGGGAGG - Intergenic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155582971 18:27332569-27332591 ATGGGTGGGGAGAAGGCGGATGG - Intergenic
1156310699 18:35919192-35919214 ATGTTAGAGGAGAGGGGAGAGGG + Intergenic
1156505038 18:37585108-37585130 GTGTGTGAGGGCAGGGTGGGAGG + Intergenic
1156727626 18:40148309-40148331 TTGTGTGAGGAATGGGAGGAAGG - Intergenic
1156998678 18:43498521-43498543 TTGAGTGATGAGAGGGTGGCTGG - Intergenic
1157264745 18:46208709-46208731 ATCTGGGAGGTCAGGGTGGATGG - Intronic
1157619333 18:49007061-49007083 CTGAGAGAGGAGTGGGTGGAAGG - Intergenic
1157676011 18:49569197-49569219 AAGTGTGGGGACAGGGTGGAGGG - Intronic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1159122307 18:64185094-64185116 ATGGGTGGGGAGAGGGTTGGGGG + Intergenic
1159928239 18:74288254-74288276 GTGTGTGGTGAGATGGTGGAGGG - Intronic
1159995470 18:74960395-74960417 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995585 18:74960935-74960957 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995593 18:74960971-74960993 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995602 18:74961007-74961029 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995611 18:74961043-74961065 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160692198 19:465277-465299 ATGGATGATGAGTGGGTGGATGG + Intronic
1160977773 19:1802246-1802268 ATGAGTGGGGGGTGGGTGGATGG - Intronic
1161088881 19:2349732-2349754 ATGTGTGTGGAGAGAGAGAACGG - Intronic
1161523417 19:4738573-4738595 AGGTGGGAGAAGAGGGGGGAGGG + Intergenic
1161638844 19:5406945-5406967 ATGTGTGAGCTGAGGCTTGAAGG - Intergenic
1161641076 19:5423751-5423773 GTGTGGGTGGAGTGGGTGGAGGG - Intergenic
1161897934 19:7096665-7096687 TTGTTTGGGGAGAGGATGGAGGG - Intergenic
1161958012 19:7506904-7506926 ATGGATTAGGAGAGGGGGGAGGG - Intronic
1161984908 19:7647715-7647737 ATGTGTGAGGAGCCTGTGCAGGG - Exonic
1162301560 19:9847866-9847888 ATGTGTGAGGAGAGGGGTTGTGG + Intronic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1163007722 19:14406959-14406981 AGGTGAGAGGAGAGGCTGGAAGG + Exonic
1163809079 19:19419130-19419152 ATGTGTGAGCACTCGGTGGAAGG + Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164828896 19:31305179-31305201 GTGTGTGTGGAGGGGGTGGCAGG - Intronic
1164840844 19:31391075-31391097 ATATGGGAGGAGAGGGAGAAAGG + Intergenic
1165161162 19:33817297-33817319 ATGTGTGATGAGAATGTGGGTGG + Intergenic
1165610366 19:37146425-37146447 ATTTGAGAGCTGAGGGTGGAGGG + Intronic
1166175292 19:41064300-41064322 ATGTGTGTGGTGATGGTGGTTGG + Intergenic
1166327586 19:42060727-42060749 ATGTGAGAGGAGAGGGTTCTAGG - Intronic
1166542049 19:43611947-43611969 AGGTGGGAGGAGAGAGGGGAGGG - Intronic
1166629425 19:44392066-44392088 ATGTGTGAGTAGGGGAGGGAGGG + Intronic
1166924417 19:46256883-46256905 ATGTGAGATGACAGGCTGGATGG - Intergenic
1167600392 19:50451429-50451451 ATGAGTGGGGAGAGGAAGGAGGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168497969 19:56870007-56870029 GTGTGTGTGGAACGGGTGGAAGG - Intergenic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
925085339 2:1103108-1103130 ATGGGTGTGGAGAGGCTGGGAGG + Intronic
925228266 2:2205785-2205807 ATATGTGAAGAGAAGGGGGATGG - Intronic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926309722 2:11666788-11666810 ATGAGTGAGGAGAGGAGGGAGGG + Intronic
926408435 2:12577614-12577636 ATGAATGAGGAGAGTTTGGAAGG - Intergenic
926674466 2:15609054-15609076 AAGTGTGGGGATAGTGTGGAGGG + Intronic
926761902 2:16285467-16285489 GCCTGGGAGGAGAGGGTGGAGGG + Intergenic
927489528 2:23511556-23511578 GTGTGTGAGGACAGGGAGGCTGG + Intronic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
928234724 2:29529701-29529723 ATCTGTGTGGTGAGGGTAGAAGG - Intronic
928353191 2:30582182-30582204 AGGGGTGAGGAGAGGGGGAAAGG - Intronic
928477848 2:31649333-31649355 ATGTGTCAGGAGCCAGTGGATGG - Intergenic
928809772 2:35208851-35208873 ATGTCTGAGGAAAGTGTGAAGGG - Intergenic
929109663 2:38396125-38396147 GTTTGTGGGGAGAGGGAGGAGGG - Intergenic
929193272 2:39159763-39159785 ATGTGGGAGGCGAAGGTTGAAGG + Intergenic
929932450 2:46269462-46269484 GTGTGTGAGGTGGGGGTGGGTGG - Intergenic
930037895 2:47099320-47099342 AAGTGGGAGGAGAGGGTTCAGGG - Intronic
930063243 2:47308462-47308484 ATGAGTCAGGAGCTGGTGGAGGG - Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931320107 2:61167693-61167715 ATGTGGGAGGAGCGAGAGGAGGG + Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932006263 2:67930182-67930204 ATGTGTGGGTGAAGGGTGGATGG + Intergenic
932127517 2:69157301-69157323 GTGTTAGAGAAGAGGGTGGAAGG - Intronic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932493934 2:72137496-72137518 GTGTGTGAGTAGGGGCTGGAAGG - Intronic
933024937 2:77244582-77244604 AAGTATCAGGAGGGGGTGGAGGG - Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934609916 2:95727482-95727504 ATGTGTGAGGTGGGGGTAGGAGG + Intergenic
934685206 2:96316214-96316236 GTGGATGAGGAGGGGGTGGAGGG - Intergenic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
934886565 2:98030529-98030551 AGGTGAGAGCAGAGGATGGAGGG - Intergenic
935224916 2:101045033-101045055 ATGTGTTAAGATAGGGTGGTTGG - Intronic
935375917 2:102397374-102397396 ATGTGGGAGGAGGGGCTGGCAGG + Exonic
935378193 2:102421919-102421941 GAGAGTGAGGAGAGGGTGCATGG - Intronic
935517597 2:104061497-104061519 ATGGGTGGGGGGAGGGGGGAGGG - Intergenic
935819251 2:106877792-106877814 GTGTGTGTGGAGAGGTTGTAGGG - Intronic
936270240 2:111043507-111043529 AGGTGGGAGGAGAGGGCTGAGGG + Intronic
936543243 2:113369059-113369081 ATGTGTGAGGTGGGGGTAGGAGG + Intergenic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
937049257 2:118875250-118875272 ATGTCTGAGGAGCAGTTGGAGGG - Intergenic
937062719 2:118992342-118992364 ATGAGTGGGGAGCGGGTGGAGGG - Intronic
937137021 2:119562513-119562535 AGGTGATTGGAGAGGGTGGAGGG + Intronic
937138962 2:119581624-119581646 TTCTGTCAGGAGAGAGTGGAGGG + Intronic
937708688 2:124952129-124952151 AAGGGTGAGGAGAGGTGGGAGGG + Intergenic
937860371 2:126703453-126703475 ATGTGTGTGGAGTGTGTGGTGGG + Intergenic
937996494 2:127698398-127698420 TTGTGAGTGGAAAGGGTGGAGGG + Intergenic
939334369 2:140806506-140806528 AGGTGTGAGTGAAGGGTGGAGGG + Intronic
939382143 2:141448852-141448874 ATGTGTGAGGATTGGGTGGATGG - Intronic
939729511 2:145764717-145764739 AAGGTTGAGGAGAGGATGGATGG - Intergenic
940602434 2:155878627-155878649 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
941640052 2:167977731-167977753 ATTTCTGGGGAGAGGGTGTATGG + Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
942964845 2:181879506-181879528 CTGGGTGAGGAGAGAGTGGTAGG - Intergenic
944064584 2:195605333-195605355 AAGTGGGATGAGAGGGTGGGTGG - Intronic
944148980 2:196537294-196537316 ATGTATGGGGACAGGGTGGGAGG + Intronic
944290438 2:197998401-197998423 ATGTGTGAGGGGTGTGTGTAGGG + Intronic
944545644 2:200796599-200796621 ATGTGTGAGAATTGGATGGATGG - Intergenic
944925426 2:204459093-204459115 ATGGGAGAGGAGAGGGTGGGAGG - Intergenic
945349248 2:208758240-208758262 TGGGGTGAGGGGAGGGTGGAGGG - Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946498746 2:220222794-220222816 AGGTGTGAGAAAAGGGTAGAAGG - Intergenic
946716035 2:222556328-222556350 AAGCGTGAGGGGATGGTGGAGGG + Intronic
946963208 2:225006966-225006988 ATGTGTGAAGACAGGCTAGAAGG + Intronic
947137292 2:226987853-226987875 ATCTGTGGTGAGGGGGTGGAGGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948223827 2:236293501-236293523 AGGTGTGAGCAGAGGCTGGGAGG - Intergenic
948383547 2:237567684-237567706 ATGTGGGGGAAGGGGGTGGATGG - Intergenic
948481238 2:238251842-238251864 ATGAGTGGGGTGAGGGTGGAGGG + Intronic
1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG + Intergenic
1169091056 20:2861723-2861745 CTGTGTGTGGAGAGAGGGGAGGG + Intronic
1169138645 20:3213651-3213673 ATGTGTGTGGGGAGGATGTAGGG - Intronic
1169989507 20:11485343-11485365 ATTTGAGGGTAGAGGGTGGAAGG - Intergenic
1170510949 20:17076177-17076199 AGGTGTGAGGTGAGAGTGGTAGG + Intergenic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171026659 20:21636924-21636946 AGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171545589 20:25998108-25998130 GTGGGAGAGGAGTGGGTGGAGGG + Intergenic
1172151488 20:32793713-32793735 ATGTGAGGGGAGAGTGGGGAGGG - Intronic
1172176191 20:32973178-32973200 ATGAGTGAGGAGTTGGTGGTTGG - Intergenic
1172629018 20:36365972-36365994 ATTGGAGGGGAGAGGGTGGAGGG + Intronic
1172788305 20:37485018-37485040 AAGTCTGAGAAGAGGGTGGTGGG + Intergenic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1173513704 20:43650034-43650056 AGGTGGGAGGAAAGGGGGGAGGG + Intergenic
1173583145 20:44161411-44161433 ATGTGTGTGGAGAGGCAGCAGGG + Intronic
1175244823 20:57575678-57575700 CTGCGTGAGGATTGGGTGGATGG + Intergenic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176585649 21:8582294-8582316 ATTTGTGAGGCCAAGGTGGAAGG - Intergenic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1177024029 21:15899275-15899297 ACTTGAGAGGGGAGGGTGGAAGG - Intergenic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178127471 21:29530597-29530619 ATGGGAGAGGAGAGGGTTGAAGG + Intronic
1178172964 21:30062386-30062408 TTGGGTGGGGAGGGGGTGGAGGG - Intergenic
1178352622 21:31883708-31883730 ATTTCTGAGGAGAGGGTCCATGG + Intronic
1178969396 21:37158445-37158467 ATGTTTGGGGTGAAGGTGGAAGG - Intronic
1179130943 21:38636668-38636690 GTGGGAGAGGAGAGGTTGGATGG - Intronic
1179585368 21:42370942-42370964 GTGTGTGAGCAGTGGCTGGAGGG - Intergenic
1180147000 21:45927309-45927331 ATGTAGGGGGAGAGGGAGGAAGG - Intronic
1180167821 21:46039134-46039156 CTCTGTGAGGAGAGCGGGGAGGG + Intergenic
1180268458 22:10559193-10559215 ATTTGTGAGGCCAAGGTGGAAGG - Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180945698 22:19691929-19691951 ATGTGTGAGGTTAGGAGGGAAGG + Intergenic
1181049158 22:20230607-20230629 ACGGGTGGGGAGCGGGTGGAGGG + Intergenic
1181052987 22:20246456-20246478 AGGTGGGAGGAGAGCGAGGAGGG + Intronic
1181266956 22:21636041-21636063 ATGGCTGAGGAAAGGGTCGAGGG - Intronic
1181423464 22:22817884-22817906 GTGTGTGAGGAGAGGATGTGTGG - Intronic
1181528317 22:23502381-23502403 ATGGGGGATGAGAGGATGGAGGG - Intergenic
1182103750 22:27674534-27674556 AGGAGTGGGGAGAGGGAGGAAGG - Intergenic
1182145341 22:27993781-27993803 CTGTCTGCGGAGAGTGTGGAAGG - Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182569153 22:31223180-31223202 ATATGAGAGGAGAGAGTAGAGGG + Intronic
1182675054 22:32032543-32032565 ATGTGTGAGGAGAGGAGGTGGGG - Intergenic
1183066703 22:35368482-35368504 ATGGATGAGGAGAAGGTTGAGGG - Intergenic
1183257628 22:36772852-36772874 ATGTGTGTGGTGGGGGTGGGTGG + Intronic
1183262310 22:36803579-36803601 ATGGATGAGGAATGGGTGGATGG + Intronic
1183280315 22:36928802-36928824 AGGTGTGAGGAGATGGGGGTGGG - Intronic
1184035449 22:41915681-41915703 AGGTGTGAGGAGAGGGGGACTGG + Intergenic
1184081054 22:42220614-42220636 ATGGGTGAGGAGAGGCTGTGGGG - Intronic
1184412857 22:44335640-44335662 GTGTGTGAGGTGTGAGTGGATGG + Intergenic
1184731251 22:46372289-46372311 ATGGGTGGGGAGCGAGTGGATGG - Intronic
1184731264 22:46372341-46372363 ATGGGTGGGGAGCGAGTGGATGG - Intronic
1184744631 22:46449174-46449196 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744666 22:46449346-46449368 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744673 22:46449377-46449399 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184835711 22:47019829-47019851 AAGAGAGAGGAGAGGATGGAGGG - Intronic
1184835722 22:47019880-47019902 AAGGGAGAGGAGAGGATGGAGGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
949751969 3:7362882-7362904 ATTTGCGAGGCCAGGGTGGAAGG + Intronic
950110808 3:10417401-10417423 ATGGGTGAGCTGAGGATGGATGG + Intronic
950705430 3:14776991-14777013 TTCTGTGAGGAGTGGTTGGAGGG + Intergenic
951098548 3:18659773-18659795 ATTTGTGGGTAGAGGGTGGAAGG + Intergenic
951223516 3:20094573-20094595 ATGAGTGAGGAGAGAGTCAATGG + Intronic
951393157 3:22131544-22131566 ATGTATCAGGAGAGAATGGAAGG + Intronic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
954196073 3:48998003-48998025 TGGAGTGAGGAGGGGGTGGAGGG + Intronic
954297482 3:49682276-49682298 ATGTGTGAAAAGAGCGTCGAGGG + Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954673111 3:52301160-52301182 ATGTTTGTGGAGATGGTGGCAGG + Intergenic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956206009 3:66755262-66755284 ATGGGTGAGGAAAGGGTGCAGGG - Intergenic
956447330 3:69338306-69338328 GTGAGTGGGGAGAGGGGGGAGGG + Intronic
956526071 3:70163490-70163512 ATGAATGAGGAGAGGGGGAAGGG - Intergenic
956831927 3:73059588-73059610 TTGTGTGTGGAGGGGGTTGAGGG + Intronic
957403914 3:79752549-79752571 AGGTGTGTGCAGAGGGTGAAAGG + Intronic
958054750 3:88394877-88394899 TTGAGAGAGGAGAGGGTGGGAGG + Intergenic
958642048 3:96816089-96816111 TTGTGTGAGGAGAAGGTTAAGGG + Intronic
958951918 3:100426037-100426059 ATCTGTCAGGAGTGGATGGAGGG + Intronic
959832646 3:110882507-110882529 TTGTGTGAGGAGAGGTTGTAAGG - Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960116013 3:113893318-113893340 ATGTGGGTGGAGAGGTGGGAAGG - Intronic
960379087 3:116938270-116938292 TTTTGTGATTAGAGGGTGGAGGG - Intronic
960403895 3:117236432-117236454 GGGTGTTGGGAGAGGGTGGAAGG - Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960623595 3:119659610-119659632 ATGTGTGTGGTGATGGTAGAGGG + Intronic
961212465 3:125136341-125136363 ATGTGGGAGAAGAGTCTGGAAGG - Intronic
961431465 3:126886910-126886932 AGGGGTGAAGGGAGGGTGGAAGG - Intronic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961554154 3:127686302-127686324 ATGTGTGATGAGGGAATGGATGG - Intergenic
961554234 3:127687066-127687088 ATGTGTGATGAGGGAATGGATGG - Intergenic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962241547 3:133754899-133754921 ATGAGTGAGGAAAGGGCGCAAGG + Intronic
962691468 3:137902864-137902886 AAGGGTGGGGAGAGGGGGGAGGG + Intergenic
962731678 3:138289424-138289446 AGGTGAGAGGAGAGAGTGGGTGG + Intronic
963025878 3:140918094-140918116 AGGTGTAAGGCAAGGGTGGAGGG + Intergenic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
963840455 3:150099619-150099641 AAGGCTGAGGAGAGGATGGAAGG + Intergenic
964004487 3:151811668-151811690 AGGGATGAGGAGAGGGCGGAGGG - Intergenic
964261770 3:154847606-154847628 ATGAGGGAGGAGTTGGTGGAGGG + Intergenic
965542832 3:169887644-169887666 ATGTGTGTGGAGAGGGAGTGAGG - Intergenic
966399526 3:179534445-179534467 AATTGGGAGGAGAGTGTGGAAGG + Intergenic
967171037 3:186824003-186824025 TTGTGTTAGGAGAGGGCTGAAGG + Intergenic
967278243 3:187797528-187797550 ATATTTGCGGAGAGGATGGATGG - Intergenic
967517974 3:190392934-190392956 ATCTGTGGGGAGAGATTGGAAGG + Intronic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
968473625 4:792744-792766 AGGTGGGAGGAGCGGCTGGAGGG - Intronic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
968959796 4:3737703-3737725 GTGTGAGAGGAGGGGCTGGAGGG - Intergenic
969429090 4:7143350-7143372 TTGTCTGGGGAGAGGGAGGAAGG + Intergenic
969476265 4:7424141-7424163 ATGTGTGAAAAGCGGGTGGTGGG + Intronic
969571697 4:8012577-8012599 ATGGGTGAAGAATGGGTGGATGG - Intronic
969858932 4:10020894-10020916 GTGAGTGGGGAGCGGGTGGAGGG - Intronic
970435064 4:16025433-16025455 ATGTGGGAGGAGAGGGCAGCGGG - Intronic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
971470317 4:27018035-27018057 AGGTGTGAGGAGGGGGCGGGAGG + Intronic
971531840 4:27698470-27698492 TTGGGTGGGGGGAGGGTGGAGGG - Intergenic
971584399 4:28386851-28386873 ATGTTTGAGGAAAGTGTTGAAGG - Intronic
972302090 4:37794013-37794035 TTGTGTGAGCAGTGGGTGGTTGG - Intergenic
973553214 4:52056138-52056160 AAGAGTGAGGAGAGGGCTGAGGG - Intronic
973588250 4:52413721-52413743 GTGTGTGACGAAAGGGAGGATGG - Intergenic
974255986 4:59456295-59456317 AGGGGTGGGGAGAGGGGGGAGGG - Intergenic
975411544 4:74057792-74057814 AAGTGGGAGGAGAGTGGGGAGGG + Intergenic
977065225 4:92305283-92305305 ATGTGAGAAGAGAGGGTGGCTGG - Intronic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
977539111 4:98293863-98293885 ATATGTGGGGAGAGTGGGGAGGG + Intronic
977718229 4:100208309-100208331 ATGAGTGAGGTGAGGGGGAAGGG + Intergenic
977901973 4:102432882-102432904 ATGTGTGAGGAGAGGGTTATTGG - Intergenic
978195994 4:105972790-105972812 ATGTGTAAGGAAAGGGAGGGGGG + Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980098080 4:128513691-128513713 ATGTGTGAGTACAGGGAGGGAGG - Intergenic
980166950 4:129240761-129240783 ATGTATGAGGCGGGGGTGGGAGG - Intergenic
980901017 4:138905267-138905289 AAGTGTGGGGAGAGAGGGGAGGG + Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
981193163 4:141887043-141887065 ATGTGACAGGATAGGGTGAATGG + Intergenic
981201611 4:141986787-141986809 TGGGGTGGGGAGAGGGTGGAGGG - Intergenic
981235082 4:142406124-142406146 AGGTGGGAGGCGAGGGTGGCGGG - Intronic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983418727 4:167490655-167490677 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
984521678 4:180809784-180809806 ATGTGTGTGGTGGGGGTGCAGGG - Intergenic
984756945 4:183333250-183333272 AAGCGTGAGGTGAGGGAGGAGGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985701520 5:1376078-1376100 GTGTGGGAGAAGGGGGTGGAAGG - Intergenic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985780273 5:1867267-1867289 GTGTGTGGGGAGAGGGTGTGTGG + Intergenic
985780282 5:1867296-1867318 GTGTGTGGGGAGAGGGTGTGTGG + Intergenic
985780287 5:1867311-1867333 GTGTGTGGGGAGAGGGTGTGTGG + Intergenic
985780292 5:1867326-1867348 GTGTGTGGGGAGAGGGTGTGTGG + Intergenic
985780309 5:1867389-1867411 GTGTGTGGGGAGAGGGTGTGTGG + Intergenic
986178800 5:5374329-5374351 ATGTGAGAGGAGAAAGGGGATGG + Intergenic
986793065 5:11182082-11182104 ATGTGTGGGGTGTGTGTGGATGG + Intronic
986806159 5:11310872-11310894 GCGTGTGAGGTGAGGGTGCATGG - Intronic
986806177 5:11310993-11311015 GTGTGTGGGGTGAGGGTGCATGG - Intronic
986806189 5:11311063-11311085 ATGTGTGGGTTGAGGGTGCATGG - Intronic
986806214 5:11311225-11311247 ATGTGTGGGTTGAGGGTGCATGG - Intronic
986806259 5:11311503-11311525 ATGTGTGGGATGAGGGTGCATGG - Intronic
986806270 5:11311568-11311590 ATGTGTGGGTTGAGGGTGCATGG - Intronic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
986806314 5:11311840-11311862 GTGTGTGGGGTGAGGGTGTATGG - Intronic
988092351 5:26560289-26560311 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
988434442 5:31157325-31157347 ATATCTGAGGAGAGGGTTGCTGG - Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989401350 5:41010868-41010890 ATGTGAGGGGAGCGGGTAGATGG + Intronic
989432311 5:41370093-41370115 ATAAGTGATGAGGGGGTGGAAGG + Intronic
990350259 5:54908941-54908963 ATGGGTGGGGTGAGGCTGGAGGG - Intergenic
990758017 5:59097464-59097486 ATGTGTGTTTAGAGAGTGGAGGG - Intronic
992091544 5:73322366-73322388 TGGTTTGAGGATAGGGTGGAAGG + Intergenic
992489055 5:77223375-77223397 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
992890640 5:81200994-81201016 GTGTGAGAGAAGAGGCTGGAGGG + Intronic
993686731 5:90946606-90946628 GTGTGTGGGGAGTGGGGGGAGGG - Intronic
993795952 5:92268072-92268094 CTGTGTTGGGAGAGAGTGGATGG - Intergenic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
994177847 5:96731643-96731665 AGGGGTGGGGAGAGGGGGGAGGG - Intronic
994225625 5:97249163-97249185 GTCTGAGAGTAGAGGGTGGAAGG + Intergenic
995106199 5:108380893-108380915 AGGTGGGAGAAGAGGGCGGAGGG + Exonic
995434814 5:112123629-112123651 TTGGGGGAGGAGAGAGTGGAAGG - Intergenic
995518105 5:112974246-112974268 GTGTGTGAGGAGGCAGTGGAGGG + Intergenic
995561975 5:113391847-113391869 ATGGGTGTGGAGAGGGAGGTAGG + Intronic
995644007 5:114291330-114291352 TGGGGTGAGGAGAGGGGGGAGGG - Intergenic
996075789 5:119192103-119192125 AAGAGTGAGGATAGGATGGAAGG - Intronic
996248699 5:121299616-121299638 ATGAGTTTGGAGAGGGTGGTGGG - Intergenic
996650620 5:125872177-125872199 TTGGGTGGGGAGAGGGGGGAGGG - Intergenic
996777328 5:127146654-127146676 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
997140637 5:131376645-131376667 ATCTGAGAGTAGAGGGTGGGAGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997783522 5:136684507-136684529 ATGTGTTGGGAGAGGGGGAAGGG + Intergenic
998153500 5:139770717-139770739 ATGTGTGAGGAGGGGCTGAAAGG - Intergenic
998350118 5:141494921-141494943 ACGTGGGAGGAGATGGGGGAGGG + Intronic
998490506 5:142542363-142542385 AACTGTGACGAGAGGGAGGAAGG - Intergenic
998527947 5:142859728-142859750 ATGTGTGAGGAGGGCCTGAAAGG + Intronic
998535058 5:142922533-142922555 ATTTGTGATGAAAGGGTGGGAGG - Intronic
998586269 5:143431037-143431059 ATGTGGGAGGAGAGAGGAGAAGG + Intronic
998595906 5:143530232-143530254 AAGGATGAGGATAGGGTGGATGG - Intergenic
999174982 5:149625748-149625770 GTGTGTGTGGAGAGGTGGGAGGG - Intronic
999241133 5:150128058-150128080 ATGTGTGATGAGCGGGAGGAGGG - Intronic
999323793 5:150630699-150630721 GAGGGAGAGGAGAGGGTGGATGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999992441 5:157061822-157061844 ATGTGAGAAGAATGGGTGGAGGG + Intergenic
1000185471 5:158853632-158853654 AGGTGTGCTGAGAGGGTGGCAGG + Intronic
1000845405 5:166273875-166273897 ATGTGTGGTTAGAGGGTGGGGGG + Intergenic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001313797 5:170629056-170629078 ATGTGCGAGGTGGGAGTGGAGGG - Intronic
1001517056 5:172363288-172363310 ATGGGTGATGAGATGGTTGATGG - Intronic
1001857245 5:175023578-175023600 ATGTGTGAGGCGAGGGAGACTGG - Intergenic
1001972443 5:175967658-175967680 GAAGGTGAGGAGAGGGTGGATGG - Intronic
1002067620 5:176660057-176660079 ATGGATGAAGAGTGGGTGGATGG - Intergenic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002210468 5:177595883-177595905 GTGTGTGAGTTGAGGGTGGGTGG + Exonic
1002244996 5:177876122-177876144 GAAGGTGAGGAGAGGGTGGATGG + Intergenic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1002448197 5:179302872-179302894 ATGTTTGAGGAAAGGGAAGAAGG + Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG + Intergenic
1003234344 6:4282358-4282380 GTGTGGGGGGAGGGGGTGGATGG + Intergenic
1003513458 6:6800380-6800402 ATGAGTGTGGATAGGGTGGAGGG - Intergenic
1004569701 6:16833325-16833347 TGGGGTGAGGAGAGGTTGGAGGG - Intergenic
1004632296 6:17433523-17433545 AGGGCAGAGGAGAGGGTGGAAGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1006133477 6:31882407-31882429 AAGGGCGAGGAGGGGGTGGAGGG + Intronic
1006369739 6:33636525-33636547 AGGTGTGAGGTGTGAGTGGAAGG + Intronic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006718047 6:36132516-36132538 GTGTATTAGGAAAGGGTGGATGG + Intronic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1006884819 6:37372596-37372618 CTGTCTCAGGAGAGGGTGCAGGG - Intronic
1007115626 6:39341190-39341212 GTGGCTGGGGAGAGGGTGGAAGG - Intronic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007962204 6:45970069-45970091 GGGGGTGAGGAGAGGGAGGAAGG - Intronic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009727253 6:67551379-67551401 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011241806 6:85279681-85279703 ATGTGTGGGGGGTGGGTGGGTGG - Intergenic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1011552040 6:88538825-88538847 ATCTGTAAGGAGAGGTGGGATGG - Intergenic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1013047049 6:106497105-106497127 ATGTGTCAGGAGTGGGCTGATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014479855 6:121922362-121922384 ATGTGTGTGGTGGGGGTGAAGGG + Intergenic
1014601266 6:123416316-123416338 ATGAGTGAGGAGCAGGTGGTAGG - Intronic
1015189835 6:130460602-130460624 GTGGGTGAGAAGAGAGTGGATGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1015631566 6:135236900-135236922 AGGTGTTAGGAGAGGCAGGAAGG - Intergenic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1017032724 6:150238372-150238394 AGGAGAGAGGAGAGGGTGGGAGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017256578 6:152340282-152340304 AGGTGTGAGCAGAGGTCGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017754551 6:157518388-157518410 AGGGGTGGGGGGAGGGTGGAAGG + Intronic
1018060605 6:160086879-160086901 GTGTGTGTGGTCAGGGTGGAAGG + Intronic
1018137645 6:160793011-160793033 ATGTGTGTGGGGAGGACGGATGG - Intergenic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018625664 6:165776648-165776670 AGGAGAGAGGAGAGGGTGGGAGG - Intronic
1019914730 7:4125373-4125395 ATGGGTGATGGGTGGGTGGATGG + Intronic
1020372660 7:7451039-7451061 ATGTGTGAGGAGAGAAGGGAGGG + Intronic
1021697134 7:23286361-23286383 AGGAGGGAGGAGAGAGTGGAAGG - Intergenic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022740027 7:33111907-33111929 AGGTATGAGGAGAGGTCGGATGG + Intergenic
1022786133 7:33639232-33639254 ATGGCTGGGGAGAGGGAGGAGGG + Intergenic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1023710401 7:42986492-42986514 ATGTGTGTGGAGAGGGGGTGGGG - Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023907329 7:44531886-44531908 ATTTGTGGGGAGATGGGGGACGG - Intronic
1023960391 7:44921686-44921708 ATGTGTGGGGAGAGATTGGTGGG + Intergenic
1024360069 7:48459086-48459108 AAGTGTGAGAAAAGGGTGGCAGG + Intronic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1025115088 7:56250838-56250860 AGTTGAGAGGTGAGGGTGGAGGG + Intergenic
1025474457 7:60902270-60902292 TGGGGTGGGGAGAGGGTGGAGGG - Intergenic
1025512546 7:61587604-61587626 TGGGGTGGGGAGAGGGTGGAGGG + Intergenic
1026223194 7:68418225-68418247 GTATATGAGGAGAGGGAGGATGG - Intergenic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1027513318 7:79110289-79110311 AGTTGTGAGAAGAGGGTGGTGGG + Intronic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028071865 7:86460579-86460601 ATGTGTGGGGAGAGAGTAGGAGG - Intergenic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029524165 7:101085221-101085243 TTCTCTGAGTAGAGGGTGGAGGG - Intergenic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1030797987 7:113813595-113813617 ATGTGTGTGAAGAGTGTTGAGGG - Intergenic
1031312288 7:120213471-120213493 ATTTAAGGGGAGAGGGTGGAAGG + Intergenic
1031976890 7:128099753-128099775 ATGTGTTAGGACAGGCTGGAGGG - Intergenic
1032311586 7:130792421-130792443 GTCTGTGGGGAGAGGGTTGAGGG - Intergenic
1032464841 7:132137700-132137722 ATGGGTGGGGAGATGGTGGGAGG + Intronic
1033440448 7:141373643-141373665 ATGTGTGTTGGGGGGGTGGAGGG - Intronic
1033588849 7:142794104-142794126 AGAAGTGAGGAGAGTGTGGAAGG - Intergenic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1034904618 7:154933247-154933269 ATGTGTGAACTGATGGTGGAGGG - Intronic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1035286899 7:157812386-157812408 ATGAGGGAGGTGAGGGAGGAGGG + Intronic
1036630529 8:10511138-10511160 AGGTGGGAGGAGGGGGTCGAGGG - Intergenic
1036702032 8:11019296-11019318 ATGAGTGAGGAGACTGTGAATGG + Intronic
1037594037 8:20339246-20339268 TTGTATGATGAGAGGTTGGAGGG - Intergenic
1037607922 8:20452986-20453008 AAGTGAGAGGAGAGTGTGGGAGG + Intergenic
1037671238 8:21016980-21017002 AGGTGTCAGGAGAGGGTTGACGG + Intergenic
1037728803 8:21506214-21506236 TTGTGTGAGGAGAGAGGGTATGG + Intergenic
1037751421 8:21684756-21684778 ATGGGTGAGTTGAGGGTGGCTGG + Intergenic
1037807990 8:22069111-22069133 ATGTGTGAGGGGAGGGAGTTAGG - Intronic
1037924144 8:22831608-22831630 ATGTGTGTGCAGAGGGTCCAAGG + Intronic
1038340573 8:26682042-26682064 AGGAGTGGGAAGAGGGTGGAGGG - Intergenic
1038584524 8:28777156-28777178 AGGAGTGAGATGAGGGTGGAGGG - Intronic
1039103896 8:33970066-33970088 TTGCCTGAGGAGAGGGTGGATGG + Intergenic
1039677534 8:39685788-39685810 ATATGTTAGCAGATGGTGGAGGG - Intronic
1040626201 8:49152131-49152153 ACGTGTGGGGACAGGGTAGATGG - Intergenic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1041360138 8:57044430-57044452 ATTTGTGAAAAGAGAGTGGAGGG + Intergenic
1041946513 8:63449778-63449800 ATGTGTGATGAGGGGGTCCAGGG + Intergenic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044432918 8:92129950-92129972 TTGGGTGGGGAGAGGGGGGAGGG - Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1046193282 8:110827512-110827534 ATGTGTGTGGTGTGGGAGGAGGG - Intergenic
1046320458 8:112567673-112567695 ATGTGTGTTGAGAGGTTGAAGGG + Intronic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047348803 8:124053954-124053976 ATGAGTCAGGATAGGGAGGACGG - Intronic
1047454577 8:124997942-124997964 GTGTATGTGGAGAGGGCGGAAGG - Intergenic
1048205618 8:132412934-132412956 ATGTGTTGGGAGGTGGTGGATGG - Intronic
1048224606 8:132572968-132572990 TTGTGGGAGGAGAGGTTGGTGGG - Intronic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048450329 8:134527845-134527867 ATGTGAGGGGAGGGGGCGGATGG - Intronic
1048736953 8:137512766-137512788 ATGGGAGAGGATATGGTGGATGG + Intergenic
1048986101 8:139735912-139735934 AGGTGTGAGGCCAGGGTGGTAGG + Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1049731691 8:144181479-144181501 AGGGCTGAGGAGAGGGTGGCAGG - Intronic
1049801579 8:144520202-144520224 TGGTGTGAGGAAGGGGTGGAGGG - Intronic
1049844545 8:144793485-144793507 AGGAGACAGGAGAGGGTGGAAGG + Intergenic
1050072225 9:1827366-1827388 ATGTGTGTGGTGAGGGGGGTGGG - Intergenic
1050260694 9:3837984-3838006 TTGTGTGTGGAGGGGGTGGGGGG + Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052024759 9:23562299-23562321 ATGTGTGTGGAGGGGTGGGATGG - Intergenic
1052315633 9:27113819-27113841 ATAAGTGAGGGGAGGGTAGATGG - Intronic
1053008749 9:34621566-34621588 AGGGGTGAGGAGATGGTAGAGGG + Intronic
1053329170 9:37188510-37188532 AGGGGTGGGGAGAGGGGGGAGGG - Intronic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1056613579 9:88141735-88141757 ATGTGTGCAGAGAGGATGGGAGG + Intergenic
1057237356 9:93372608-93372630 ATGTGTGCTTAGAGGGTGTATGG - Intergenic
1058989589 9:110242141-110242163 ATGAGTGAGGTGAGGATGGGAGG - Intergenic
1059027125 9:110646748-110646770 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1059040790 9:110813609-110813631 ATTTGTGATGAGCAGGTGGAAGG - Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059542479 9:115144251-115144273 AGGAGAGAGGAGAAGGTGGAAGG - Intronic
1059795337 9:117688750-117688772 ATGTGTGTGGCGGGGGTGGGGGG - Intergenic
1060018102 9:120104662-120104684 ATGCGTGTGGAGAGGGAGGTTGG + Intergenic
1060246354 9:121949975-121949997 GAGTGTGAGTAGAGGCTGGATGG - Intronic
1060716498 9:125935043-125935065 ATGTGTGAGATGAGTCTGGAAGG - Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061355065 9:130098375-130098397 ATGTGTGAGGAGAAAGTGCCAGG - Intronic
1061372983 9:130208214-130208236 GTGTGTGAGGTGGGGGTGGGGGG + Intronic
1203615551 Un_KI270749v1:59818-59840 ATTTGTGAGGCCAAGGTGGAAGG - Intergenic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1185883430 X:3760302-3760324 ATTTTTGAGGAAAGAGTGGAGGG - Intergenic
1185950916 X:4432906-4432928 GCTAGTGAGGAGAGGGTGGACGG + Intergenic
1186181656 X:6979307-6979329 ATGTGTGTGGAGGAGGTGGTGGG - Intergenic
1186216810 X:7309387-7309409 ATTTGAGAGGGGAGGGTGGGAGG + Intronic
1186483403 X:9913547-9913569 TTGTGTGTGCAGAGGGTCGATGG + Intronic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186846424 X:13535248-13535270 ATGTGTCATGATAGGGTGAATGG - Intergenic
1187279916 X:17850353-17850375 ATGGCTGAGGAGAGGGTGAAGGG + Intronic
1187407460 X:19016686-19016708 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1188228014 X:27625854-27625876 ATTTGTGAGTGGAGGGTGGGAGG + Intronic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189248355 X:39580824-39580846 ATGAGAGAGGAGAGAGAGGAGGG - Intergenic
1189351159 X:40276826-40276848 ATGTGTGAGGACATGGTGGAAGG - Intergenic
1189609865 X:42720892-42720914 GTGGGTGTGGAGAGGGGGGAGGG - Intergenic
1190024973 X:46913697-46913719 ATTTGTGAGGAGGGGGTGGCGGG + Intronic
1190117728 X:47637113-47637135 GTCTGTGGGGAGAGGGTGGTCGG + Exonic
1190332772 X:49246461-49246483 ATGTGGGAAGAGAGGGGGGTGGG - Intronic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1190753153 X:53379822-53379844 ATGGGTGATGAGGGGGAGGAAGG + Exonic
1191091636 X:56629717-56629739 TGGGGTGGGGAGAGGGTGGAGGG - Intergenic
1191579839 X:62748200-62748222 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
1191716105 X:64194619-64194641 ATCTGGGAGGAGAGGGGAGAGGG + Intronic
1191898051 X:66014331-66014353 AGGTGTGAAAAGAAGGTGGATGG - Intergenic
1192029537 X:67494347-67494369 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1192365870 X:70472605-70472627 ATGTTTGAGCAGAGGCTGAAGGG + Intronic
1192438321 X:71156209-71156231 ATTTGTGGGGGGTGGGTGGAAGG - Intronic
1193584323 X:83301739-83301761 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1193801547 X:85942901-85942923 AGGGGTGAGGGGAGGGGGGAGGG - Intronic
1194794713 X:98197508-98197530 ATGTGTGTGGAGGGGGAGCATGG - Intergenic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197863008 X:130990044-130990066 AAGTGTGAGTAGAGGGTGCCGGG - Intergenic
1198099807 X:133414374-133414396 ATGGGTGAGGAGAGGCCGGGTGG - Intronic
1198440119 X:136654980-136655002 ATGTTTGATCAGAGGCTGGACGG - Intronic
1198518087 X:137428291-137428313 AAGTGGGCTGAGAGGGTGGAGGG - Intergenic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1199552324 X:149073863-149073885 GTCTGAGGGGAGAGGGTGGATGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1199918379 X:152369673-152369695 ATGTATGAGGAATGTGTGGAAGG - Intronic
1200002093 X:153067402-153067424 TTGTGTGTGGACCGGGTGGAAGG - Intergenic
1200005640 X:153082623-153082645 TTGTGTGTGGACCGGGTGGAAGG + Intergenic
1201254590 Y:12094210-12094232 TGGTGTGGGGAGAGGGGGGAGGG + Intergenic
1201721676 Y:17105011-17105033 AGGAGTGTGGAGAGGGTTGAGGG - Intergenic
1201789642 Y:17825412-17825434 GTGTGTGTGGAGCGGGTGGGGGG - Intergenic
1201811912 Y:18080577-18080599 GTGTGTGTGGAGCGGGTGGGGGG + Intergenic
1202351293 Y:23995162-23995184 GTGTGTGTGGAGCGGGTGGGGGG - Intergenic
1202519486 Y:25674957-25674979 GTGTGTGTGGAGCGGGTGGGGGG + Intergenic