ID: 1096423019

View in Genome Browser
Species Human (GRCh38)
Location 12:51476650-51476672
Sequence CCATCAGTACATCAAAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096423019 Original CRISPR CCATCAGTACATCAAAAATG GGG Intronic
903560500 1:24223725-24223747 CCACCAGAACATTAAAAGTGGGG - Intergenic
905293132 1:36936808-36936830 CCATCAGAAAAAAAAAAATGAGG - Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
908101288 1:60793875-60793897 CTATCTGTACATCATAAATGAGG + Intergenic
910092544 1:83482150-83482172 ACATCAGTACTTCAAAATTATGG - Intergenic
910551168 1:88477094-88477116 CCATCATTATATCAAAATTATGG + Intergenic
912052163 1:105542687-105542709 CTATAAGAACACCAAAAATGTGG - Intergenic
914390253 1:147214666-147214688 CCATCAGGACATGAAATATCAGG - Intronic
915838064 1:159193766-159193788 CCATCTGTACGTCTACAATGAGG + Intronic
916861049 1:168805906-168805928 CCATCAGAACACCAAAATTTAGG - Intergenic
918355201 1:183701360-183701382 TCATCAGTACCTTGAAAATGAGG - Intronic
918357124 1:183715357-183715379 CAATCAGTTCACCAACAATGAGG - Intronic
920018800 1:202937248-202937270 CTATCAGTAAATCAAAAAATAGG - Intergenic
920998753 1:211020762-211020784 CCAACAGAACATCAAAAAAAAGG + Intronic
922931747 1:229395554-229395576 CAATCAGTAAAACAAAAAGGGGG - Intergenic
923026753 1:230210454-230210476 CCACCACTACATTTAAAATGTGG + Intronic
1068543977 10:58326455-58326477 CCAGCAGTACCTGAGAAATGAGG + Intergenic
1069241671 10:66147980-66148002 CCTTCAGAAGAACAAAAATGGGG - Intronic
1069568357 10:69478756-69478778 ACATTATTACATCAAAAATTTGG - Intronic
1070696654 10:78568965-78568987 CCATGAGTTCTTCTAAAATGTGG + Intergenic
1072670248 10:97424161-97424183 CCAAAAATACAACAAAAATGTGG + Intronic
1074246758 10:111702008-111702030 CCATCAGAATATGATAAATGGGG - Intergenic
1077649294 11:3955333-3955355 TTAACAGTACATTAAAAATGAGG + Intronic
1078420975 11:11212580-11212602 CCAACAGGACATTCAAAATGAGG + Intergenic
1078764353 11:14279985-14280007 CCATCAGTAATTCAGGAATGAGG - Intronic
1080658717 11:34278584-34278606 CCCTCAGTGCATCAAAATGGAGG - Intronic
1081278559 11:41180837-41180859 GCCGCAGAACATCAAAAATGTGG + Intronic
1081865613 11:46358124-46358146 CCATCAGCACAGCAAAAAAAAGG - Intronic
1086170248 11:83827864-83827886 CCATGAATACATCAAGAATATGG + Intronic
1087854340 11:103073777-103073799 TCAAAAGTACATCAAAACTGAGG + Intronic
1091123852 11:133079371-133079393 CCAGCTGCCCATCAAAAATGTGG - Intronic
1091176533 11:133563399-133563421 CCATAAGAACCTTAAAAATGAGG + Intergenic
1092034350 12:5318237-5318259 CCATCTGTACAACAAAAAAGTGG - Intergenic
1092396966 12:8135184-8135206 CAATCAAGACAACAAAAATGGGG - Intronic
1095818696 12:46453097-46453119 CCATCTGTACCACACAAATGGGG - Intergenic
1096423019 12:51476650-51476672 CCATCAGTACATCAAAAATGGGG + Intronic
1097973504 12:65660413-65660435 CAATTAGTACTTTAAAAATGTGG + Intergenic
1099863124 12:88244479-88244501 CTCTCAGTACCTCAAGAATGTGG - Intergenic
1104198996 12:126568859-126568881 CCCCCAGTATGTCAAAAATGAGG - Intergenic
1106547980 13:30746762-30746784 CCATGTGTATATTAAAAATGAGG - Intronic
1108144996 13:47467307-47467329 CCAGCAGCACATCAAAAAACTGG + Intergenic
1109498309 13:63204471-63204493 CAATCTGTACATCAAATTTGGGG - Intergenic
1109779911 13:67095795-67095817 CCAACAGTACATGATAAATAAGG - Intronic
1109924858 13:69123453-69123475 CAATAATTCCATCAAAAATGGGG + Intergenic
1110437807 13:75494918-75494940 CCATCAGAAAGTCAAAAAGGAGG + Intergenic
1114252738 14:20975265-20975287 TAATCAGTACATCAAATCTGTGG - Intergenic
1115423578 14:33227114-33227136 CCCTGAGAACATCCAAAATGAGG - Intronic
1116143024 14:41024877-41024899 CCAAGAGCACATCAAAAATTAGG + Intergenic
1117784027 14:59263904-59263926 CCTTCAGTTCTTCAAATATGTGG + Intronic
1118167209 14:63348393-63348415 ATATCAGTACATCAAGAAGGAGG - Intergenic
1118192812 14:63595327-63595349 TCATCAGTAGATAAACAATGTGG - Intergenic
1120271088 14:82313972-82313994 CCATAAGTACATAAAACATGTGG - Intergenic
1120354134 14:83407791-83407813 CCATAAGTAAATAAACAATGGGG - Intergenic
1122123869 14:99568826-99568848 CCACCAGGCCATCAACAATGTGG + Intronic
1122433148 14:101670186-101670208 ACATCAATACATCAAATATGGGG + Intergenic
1124850469 15:33333334-33333356 CTAGCAGCACATCAAAAATCAGG + Intronic
1125479370 15:40069769-40069791 CCATCTGGACACCAGAAATGAGG - Intergenic
1127910794 15:63414522-63414544 CCATCAGATCATCAGACATGAGG + Intergenic
1130325641 15:82877646-82877668 ACATCAGTACTTCATAGATGGGG - Intronic
1130446778 15:84009534-84009556 CCAACACTACTTCAAAAATATGG - Intronic
1132040266 15:98519295-98519317 CCATCTGCAGATCAAAAACGTGG + Intergenic
1132276243 15:100566840-100566862 CCCTCATTACATGTAAAATGAGG - Intronic
1132992450 16:2803260-2803282 CAATCAGTTAAACAAAAATGAGG - Intergenic
1137246998 16:46713955-46713977 CCATCAGTGGATAAAAAATCTGG - Intronic
1138063551 16:53916603-53916625 CCATCATTCCATCTAAAGTGTGG - Intronic
1142894439 17:2964835-2964857 CCCTCAGTACATCAAGAACCTGG - Intronic
1144603935 17:16647020-16647042 CCAAGAGTACATCAACATTGTGG - Intronic
1148706452 17:49637678-49637700 CTATGAGTGCAGCAAAAATGAGG + Intronic
1155935782 18:31752168-31752190 CCATCAGCAGATGAATAATGTGG + Intergenic
1156002320 18:32398939-32398961 CCAGCAGCACATCAAAAAGAAGG + Intronic
1156242807 18:35269975-35269997 TCATCTGTTCATTAAAAATGGGG - Intronic
1156934293 18:42683978-42684000 CCAACAGCACATCAAAAAGATGG + Intergenic
1158447813 18:57536409-57536431 CCATCTCTACAACAAAACTGTGG + Intergenic
1161859855 19:6789896-6789918 CCATCATTAAATAAAAAATAAGG - Intronic
1162922149 19:13909562-13909584 CCAGCAGCACATCATAAGTGTGG + Intronic
1165085316 19:33341822-33341844 TCATCAGTAAAGTAAAAATGCGG + Intergenic
1168587572 19:57605983-57606005 CCTGCAGTTCATCATAAATGAGG - Exonic
928043871 2:27907582-27907604 CATTAAGTACATCACAAATGTGG + Intronic
928915207 2:36463262-36463284 CCACAAGTACTTCAATAATGAGG - Intronic
929764290 2:44831430-44831452 CCATCAGAACCTCAGAAAGGAGG - Intergenic
936997614 2:118431976-118431998 TCAGCAATACATCAAAAATTGGG - Intergenic
939521002 2:143230530-143230552 CCATAAGAGCATTAAAAATGGGG - Intronic
940798755 2:158109170-158109192 CCATCAGTACCTGAAAACTCAGG + Intronic
942538737 2:176993497-176993519 CCATCATTAAATCAAAAAGGAGG + Intergenic
945470861 2:210226286-210226308 CCAACAGTATATAAATAATGTGG - Intergenic
945828020 2:214748490-214748512 TCTTAAGTTCATCAAAAATGGGG + Intronic
946016079 2:216605179-216605201 CCATAAGTACGTTAAGAATGTGG + Intergenic
946486730 2:220107741-220107763 ACATGAGTTCATGAAAAATGGGG + Intergenic
946825624 2:223674624-223674646 CCATAAGTATATATAAAATGCGG - Intergenic
1171203260 20:23258528-23258550 CCATCATTACTTCAGATATGTGG + Intergenic
1178339388 21:31773294-31773316 ACATCAGTAGAGCAAAAAGGGGG - Intergenic
1184721905 22:46319555-46319577 CCCTCACTACTTCCAAAATGGGG - Intronic
1184817016 22:46880214-46880236 CCATCAGTACATGTAAGAAGTGG + Intronic
950113807 3:10437736-10437758 CCCTCAGTACCTTAAAATTGTGG + Intronic
951482068 3:23171955-23171977 CCATCTGGAGATCAACAATGAGG + Intergenic
953236143 3:41109263-41109285 CCATCAGTCACTAAAAAATGAGG + Intergenic
960113962 3:113874025-113874047 CCATCAGCAAAACAAAAGTGAGG - Intronic
965107848 3:164380720-164380742 CCATTAGTACTATAAAAATGTGG + Intergenic
966094320 3:176180412-176180434 CCATGACTACATCAAATGTGAGG - Intergenic
966426379 3:179784425-179784447 CCATCAGCACATCAAAAATGGGG + Exonic
967455795 3:189685174-189685196 CCAAAAGTACTTCAAAAAGGAGG + Intronic
970659933 4:18273828-18273850 TCATGAGAACATCAAAAATAAGG - Intergenic
972134627 4:35876792-35876814 CCATTTGTACATCCAAAATGTGG + Intergenic
972911930 4:43827886-43827908 CCTTCAGTACAACAAATATATGG - Intergenic
977024919 4:91805697-91805719 CCATCAGTCCATCATACATCAGG + Intergenic
977164158 4:93674764-93674786 CCAACAGAACATCTAAAAAGTGG + Intronic
978075575 4:104525185-104525207 CCATCATAGCATCAAACATGTGG + Intergenic
978155343 4:105483589-105483611 CCATCACTACTTCAAAATTATGG + Intergenic
981626964 4:146768342-146768364 CCATCAGTAGGTAACAAATGTGG + Intronic
982415592 4:155127861-155127883 CAATAAGTACATCACAAATAAGG - Intergenic
983739794 4:171115167-171115189 CCATCAGCAGCTCAACAATGGGG - Intergenic
984253756 4:177365519-177365541 CCATCAGTCCCTCCAAAATTTGG + Intergenic
984935672 4:184887789-184887811 TCATGATTACATCAAAGATGGGG - Intergenic
985907290 5:2849771-2849793 CAATCAGTAAAACAAAAATAGGG - Intergenic
989209965 5:38848412-38848434 CGACCAGTACAACTAAAATGAGG - Intronic
993152284 5:84175790-84175812 CCTTCAGTACACCAAACTTGAGG - Intronic
1000306377 5:159998175-159998197 TCATCACTACTTCAAAATTGTGG + Intergenic
1001424955 5:171616901-171616923 CCATTAGCACAGCATAAATGAGG + Intergenic
1003016761 6:2474165-2474187 GCATCAGTACACCAAAAACCAGG - Intergenic
1003048573 6:2759966-2759988 CCAACAGTGGATCAAAAATTTGG + Intergenic
1005983483 6:30855414-30855436 CCATAAGTCCAGCAAAAATTTGG - Intergenic
1007054816 6:38872083-38872105 CCAGAAGTACATCATGAATGAGG - Intronic
1007274980 6:40666609-40666631 CATTCAGAACATGAAAAATGGGG + Intergenic
1008783555 6:55137914-55137936 CCATCTGACCATTAAAAATGTGG + Intronic
1009017240 6:57919454-57919476 CCAAAAGTAAATCCAAAATGAGG + Intergenic
1011554259 6:88558092-88558114 CCATCTATATATTAAAAATGAGG - Intergenic
1011910040 6:92424520-92424542 CCAGCAGCACATCAAAAATGGGG + Intergenic
1012866677 6:104626261-104626283 TCATAAGTACATCAAGAATCAGG + Intergenic
1012953782 6:105546806-105546828 CCACCAGTACAGAAAATATGGGG + Intergenic
1014663785 6:124209345-124209367 CCATGAATGCATAAAAAATGTGG - Intronic
1018267492 6:162040724-162040746 TCATAAATACATCAAAAATGTGG - Intronic
1020877267 7:13713570-13713592 ACATCAGGAAATCAAAACTGAGG + Intergenic
1021536077 7:21706118-21706140 TAATAGGTACATCAAAAATGTGG - Intronic
1022471727 7:30685698-30685720 CCATCTGTAAAACAAGAATGTGG - Intronic
1023127080 7:36965186-36965208 CCATGAATACATTAAGAATGGGG - Intronic
1024916575 7:54506954-54506976 ACATCAATACATCAAAGATGAGG + Intergenic
1027309408 7:76938645-76938667 ACATCAGTACTTCAAAATTATGG - Intergenic
1028894445 7:96025122-96025144 CCACCATTACATCAAACATCAGG + Intronic
1029021543 7:97369900-97369922 CCCTGGGTACAACAAAAATGTGG - Intergenic
1029863069 7:103596511-103596533 CCTTCAGTACAGCAACAATGGGG - Exonic
1032978292 7:137251188-137251210 CCATCAATCCATTAAAATTGTGG + Intronic
1035172820 7:157028840-157028862 CCACAAACACATCAAAAATGAGG - Intergenic
1037698264 8:21247205-21247227 CCTTCTGTTCATCAATAATGGGG - Intergenic
1043169621 8:76949265-76949287 CCAGCACTACATAAAAAAGGGGG - Intergenic
1044756423 8:95466970-95466992 AAATCAGGACATCCAAAATGGGG - Intergenic
1046341368 8:112861172-112861194 TTATCAGTACAAGAAAAATGAGG - Intronic
1050438756 9:5637403-5637425 CAATCAGTTCATGAAAAATAGGG + Intronic
1052324216 9:27199644-27199666 CAATAAGTATATCAAAAAAGAGG - Intronic
1052324218 9:27199680-27199702 CAATAAGTATATCAAAAAAGAGG - Intronic
1056626000 9:88253865-88253887 CCATTTGTACACCAAATATGGGG - Intergenic
1058108982 9:101009697-101009719 CCATAGGTACATAAAATATGTGG - Intergenic
1059947390 9:119424674-119424696 CAATCATTCCATCAAAAATAAGG + Intergenic
1187066959 X:15850295-15850317 CCATCAGCAAACCAGAAATGTGG + Intronic
1188828470 X:34866256-34866278 CCATCCGTCCATTATAAATGGGG + Intergenic
1189640324 X:43062516-43062538 CCATCAGTACTTCCAGAAGGTGG + Intergenic
1192339573 X:70252187-70252209 CCATCAGTAGATCCAAAAACAGG + Intergenic
1195746930 X:108128233-108128255 CCATCTCTACAAAAAAAATGAGG - Intronic
1196874174 X:120142645-120142667 CTATCAGCAGATCCAAAATGTGG - Intergenic
1202116490 Y:21473266-21473288 CAATCAGTATATCCAAAAGGTGG + Intergenic