ID: 1096425362

View in Genome Browser
Species Human (GRCh38)
Location 12:51497133-51497155
Sequence CCAGGTATACAGTTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096425362_1096425372 6 Left 1096425362 12:51497133-51497155 CCTTGCACCAACTGTATACCTGG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1096425372 12:51497162-51497184 CAAATTACAGAACATAGGAAGGG 0: 1
1: 0
2: 8
3: 29
4: 346
1096425362_1096425369 1 Left 1096425362 12:51497133-51497155 CCTTGCACCAACTGTATACCTGG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1096425369 12:51497157-51497179 GGCCTCAAATTACAGAACATAGG 0: 1
1: 0
2: 1
3: 7
4: 151
1096425362_1096425371 5 Left 1096425362 12:51497133-51497155 CCTTGCACCAACTGTATACCTGG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1096425371 12:51497161-51497183 TCAAATTACAGAACATAGGAAGG 0: 1
1: 0
2: 4
3: 23
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096425362 Original CRISPR CCAGGTATACAGTTGGTGCA AGG (reversed) Intronic
902347739 1:15831062-15831084 CTAAGTATACTGTTGCTGCAAGG + Intergenic
904421571 1:30397826-30397848 CCTGGTACACAGTAGGTGCTTGG - Intergenic
906348996 1:45040643-45040665 CCTGGTATACAGTAGGTGTCAGG - Intronic
906993442 1:50763940-50763962 ACAGCTATATAGTTGGTGAAGGG - Intronic
907411328 1:54285787-54285809 CCAGGGCTGCAGTGGGTGCATGG + Intronic
907454368 1:54565640-54565662 CCTGGCATACAGTAGGTACATGG + Intronic
909409404 1:75331766-75331788 GCAGGAATACACTTAGTGCAGGG - Intronic
915593081 1:156881606-156881628 CCAGGTAGACAGGAGGTGCCTGG - Exonic
916324659 1:163543378-163543400 CCAGTTATACAGTTGAGGAATGG + Intergenic
918582238 1:186145046-186145068 CCAGATATCAAGTTGCTGCAAGG - Intronic
921500378 1:215895152-215895174 CCTGGTACACAGTAGGTACACGG + Intronic
1064411939 10:15112996-15113018 GCACGTATGCAGTTGGTTCAAGG - Intronic
1064626522 10:17266933-17266955 CCAGGCAAAAAGTTGCTGCAGGG + Intergenic
1065866796 10:29921477-29921499 CCTAGTATACAGTTAGAGCAGGG + Intergenic
1067905106 10:50282380-50282402 CAAGGTATTCAGCTGGTGGATGG - Intergenic
1067907713 10:50310967-50310989 CCAGTTATACAGCTGCTGTAAGG - Intronic
1069873344 10:71546621-71546643 CCTGATATATAGTAGGTGCACGG + Intronic
1077752083 11:4983436-4983458 TCAGGTAAAGAGTGGGTGCAGGG - Intronic
1078064743 11:8071059-8071081 CAAGGCATACAGGTGGTTCATGG + Intronic
1078472940 11:11606223-11606245 CCAGGTATACAGTAGGGGCTAGG - Intronic
1078636349 11:13053963-13053985 CCAGGCAGAAAGTTGCTGCAGGG - Intergenic
1081615059 11:44585938-44585960 CCAGGTTGAAAGATGGTGCAGGG + Intronic
1083427275 11:62594706-62594728 CCAGGTAAACTGCTGGTCCAGGG - Intronic
1088143690 11:106649271-106649293 CCAGGCAGACATTTGCTGCAGGG - Intergenic
1088143961 11:106652259-106652281 CCCAGTATACCCTTGGTGCATGG - Intergenic
1088267509 11:108001797-108001819 CCGGGCCTACAGTTCGTGCATGG + Intergenic
1095868547 12:47000747-47000769 CCAGGTATACAGCAGGTAGAAGG + Intergenic
1096425362 12:51497133-51497155 CCAGGTATACAGTTGGTGCAAGG - Intronic
1103983559 12:124752287-124752309 CCTGGCATACAGTAGGTGCTCGG - Intergenic
1105275859 13:18925280-18925302 CCAGGTATACTGTTAAAGCAGGG + Intergenic
1106158727 13:27181763-27181785 CAAGGAACACATTTGGTGCAAGG + Intergenic
1107480430 13:40781484-40781506 CCAGGTCTGCAGTGGGTGTAGGG + Intergenic
1108910978 13:55551079-55551101 CCAGGTATTCACCTGCTGCAGGG + Intergenic
1109191353 13:59327743-59327765 CCAGGCATACAGTGGCTTCAGGG - Intergenic
1109702719 13:66047940-66047962 CCAGGCAAACATTTGCTGCAGGG - Intergenic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1113138585 13:107121275-107121297 TCAGCTATACTGTTGGTCCAAGG + Intergenic
1115051850 14:29072554-29072576 CCAGGCAGACAGTTGCTGCAGGG - Intergenic
1129685630 15:77684780-77684802 CCTGGCACACAGTAGGTGCATGG - Intronic
1135725741 16:24852665-24852687 CCAGGTACACACAGGGTGCAGGG + Intronic
1136067607 16:27769394-27769416 CGAAGTATACAGTTTGTGCCAGG + Intronic
1136170515 16:28486559-28486581 CCAGGTAAGCAGGTGGAGCAGGG - Exonic
1138967694 16:62105625-62105647 TCAGGTAAACACTTGGTGGAGGG - Intergenic
1140142578 16:72272655-72272677 CCAGGAATTTAGTGGGTGCAGGG + Intergenic
1140998599 16:80286175-80286197 CCAGGTATCCATTTACTGCATGG + Intergenic
1142144357 16:88486675-88486697 CTAGGTACACAGTGGGTGCTGGG + Intronic
1147134172 17:38425690-38425712 ACAGGAATACAGTGGGTGCTGGG + Intergenic
1151787583 17:76282739-76282761 CCAGGTAGACAGCTGATCCAAGG + Intronic
1151956047 17:77380742-77380764 CCAGGTGTACAGTTGGAGGGGGG + Intronic
1154467476 18:14662420-14662442 CCAGGTATACTGTTAAAGCAGGG + Intergenic
1156049202 18:32911652-32911674 CCAGGAATACAAATGCTGCAGGG - Intergenic
1163149972 19:15405563-15405585 CCAGGTGTACAGTAGCTGCCTGG - Intronic
1166564730 19:43756840-43756862 CCTGGTACACAGTGGGTCCAAGG - Intergenic
1167527538 19:49994438-49994460 CCAAGGATACAGCTGGGGCAAGG - Intronic
1167781221 19:51600696-51600718 CTTGGTATACAGTAGGTGGATGG + Intergenic
925749682 2:7076675-7076697 CCCTGTATACAGTTCATGCAGGG + Intergenic
928680127 2:33692998-33693020 CCAGGTAGAAATTTGCTGCAGGG - Intergenic
930942117 2:57025759-57025781 CCAGGCAGACATTTGCTGCAGGG - Intergenic
934113023 2:88759784-88759806 CCAGGCATAAATTTGCTGCATGG + Intergenic
934553860 2:95277376-95277398 CAAGGTTTGCAGGTGGTGCACGG - Exonic
937527521 2:122788953-122788975 CCAGGAATAAATTTGCTGCAGGG + Intergenic
938070193 2:128304365-128304387 CCAGGGACAGAGATGGTGCATGG + Intronic
940387029 2:153085673-153085695 CCAGGCATAGATTTGCTGCAGGG + Intergenic
941356563 2:164500344-164500366 CCAGGTATACATTTTGAGAAAGG - Intronic
948186867 2:236028003-236028025 CCAGGTTTAGAGTTATTGCACGG + Intronic
948287036 2:236793797-236793819 GCAGGTAAACAGTCGGTGCCTGG - Intergenic
948792575 2:240386518-240386540 CCAGGTCTCCAGTTGCGGCAGGG - Intergenic
1170812364 20:19684480-19684502 CCAGATATACAGCTGGCCCAGGG - Intronic
1176807036 21:13495259-13495281 CCAGGTATACTGTTAAAGCAGGG - Intergenic
1182293656 22:29300605-29300627 CCAGGTAAACGGTTGGTTCAGGG + Intergenic
1183492829 22:38125942-38125964 CTAGGTATACAGCAGGTGCTGGG + Intronic
1184368265 22:44066575-44066597 CCTGGCACACAGTAGGTGCACGG + Intronic
950681111 3:14585716-14585738 CCTGGTATGCAGTGGGTGCTTGG - Intergenic
952162107 3:30704293-30704315 CCATGTATACATTTATTGCAGGG - Intergenic
953884573 3:46708030-46708052 CCAGGCATACACTTGGAGGAGGG - Intronic
954154043 3:48674870-48674892 CCAGGTATATTGTGGGTGCTGGG - Intronic
959785679 3:110294832-110294854 CCAGGCATAAATTTGGTCCAGGG - Intergenic
960856541 3:122107806-122107828 CCAGTTGTAAAGTTGGTTCATGG - Intronic
967243445 3:187463930-187463952 TCAGATATACAGTTGGAGAAAGG - Intergenic
968022164 3:195402185-195402207 CCAGGTAAACATTTGTTGAATGG + Intronic
969354388 4:6616807-6616829 CAAGGCATACAGCTGGTGCGCGG - Intronic
971450075 4:26791857-26791879 TCAGGTATGCAGTTGGATCAGGG + Intergenic
972922742 4:43964466-43964488 CTAGGTATTCAGTAGCTGCATGG - Intergenic
974016925 4:56656277-56656299 GCAGGGATACAGTTCCTGCAAGG - Intronic
978838142 4:113178079-113178101 CCAGGTATAAAGTAAATGCAAGG + Intronic
980509881 4:133771730-133771752 CCAGGTAAACATTTGCTGCAGGG - Intergenic
981311388 4:143301265-143301287 CCAAGCATACACTTGGTTCAGGG + Intergenic
983940739 4:173531940-173531962 CCAGGATTAGAGTCGGTGCAGGG + Intergenic
986142684 5:5046475-5046497 CCAGGTATACAAATGGGACAAGG - Intergenic
992138723 5:73773648-73773670 CCAGGTAGGCAGTAGGTGCTGGG - Intronic
992159035 5:73982890-73982912 CCAAGTTGACAGTTGGTGAATGG - Intergenic
992611461 5:78511691-78511713 GCAGGCAGACAGCTGGTGCAGGG - Intronic
995108967 5:108406648-108406670 CCAGGTTTACAGATGGTTAAAGG - Intergenic
995987434 5:118195602-118195624 CAAGGGATACTTTTGGTGCATGG + Intergenic
998065658 5:139156165-139156187 CCAGGTATGTAGTTGATGCCTGG - Intronic
1000948374 5:167450004-167450026 TAAGGTATACAGTTGGTGGGTGG + Intronic
1001301757 5:170538616-170538638 CCAAGGACACAGCTGGTGCAAGG - Intronic
1001518467 5:172373715-172373737 CCTGGTGCACAGTTGGTGCTCGG + Intronic
1010522660 6:76859716-76859738 CCTGGTACGAAGTTGGTGCAAGG + Intergenic
1015913440 6:138190972-138190994 CCATGAATACAGTTGGTAAATGG - Intronic
1018374784 6:163200884-163200906 CCAGGAATGCCGGTGGTGCAGGG - Intronic
1019039369 6:169090939-169090961 CCAGGCATAAGTTTGGTGCAGGG + Intergenic
1021970660 7:25962665-25962687 CCAGGTCAACATTTTGTGCAAGG + Intergenic
1023217052 7:37873908-37873930 CCAAGTATGCAGTTGGTGGAAGG - Intronic
1024675250 7:51632277-51632299 CCAGGAACACAGCTGGAGCAGGG + Intergenic
1027789469 7:82620785-82620807 CCAGGCAGACACTTGTTGCAGGG + Intergenic
1027996780 7:85434712-85434734 CCAGGTATAAATTTGTTGCAGGG + Intergenic
1031254950 7:119435498-119435520 CCAGGTAGAAATTTGTTGCAGGG - Intergenic
1035445919 7:158943319-158943341 CCAGGCACACAGTCGGTGCTGGG - Intronic
1038646573 8:29366648-29366670 CCAGGAAGACAGGTGGTTCAAGG - Intergenic
1042978610 8:74500271-74500293 CCATGGACAAAGTTGGTGCATGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG + Intergenic
1055701559 9:78950105-78950127 CCAGGTAGAAATTTGCTGCAGGG + Intergenic
1058307729 9:103464054-103464076 CCAGGCAGACATTTGCTGCAGGG - Intergenic
1059434945 9:114270575-114270597 CCTGGCACACAGTGGGTGCATGG - Intronic
1060168285 9:121439129-121439151 CCAGGTAAACAGCTTGTCCAGGG - Intergenic
1061505863 9:131031579-131031601 CCAGGGATACAGCTGGGGGACGG - Intronic
1187227316 X:17386038-17386060 CCAGCAATACAGTTGGGGCAGGG - Intronic
1190320486 X:49176783-49176805 CCAGGGATACAGCAGGTGAAGGG + Intronic
1192165391 X:68824539-68824561 CCAGGCATGCAGCTGGGGCAGGG + Intergenic
1193783851 X:85735149-85735171 TCAGTTTTACAGTTGGTGCAGGG + Intergenic
1194389630 X:93300146-93300168 CCAGGCAAACATTTGCTGCAGGG + Intergenic
1194905952 X:99576492-99576514 CCAGGAAGAAGGTTGGTGCAGGG + Intergenic
1195380885 X:104269673-104269695 CCAGGTCTACACTTAGTGAATGG + Intergenic