ID: 1096426709

View in Genome Browser
Species Human (GRCh38)
Location 12:51510069-51510091
Sequence CAGCCTGCACAGCTGGTACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096426705_1096426709 -6 Left 1096426705 12:51510052-51510074 CCCAACAGCGGTTCCAGCAGCCT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG 0: 1
1: 0
2: 0
3: 23
4: 265
1096426702_1096426709 18 Left 1096426702 12:51510028-51510050 CCAGTCACTCTAGGGATTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG 0: 1
1: 0
2: 0
3: 23
4: 265
1096426706_1096426709 -7 Left 1096426706 12:51510053-51510075 CCAACAGCGGTTCCAGCAGCCTG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG 0: 1
1: 0
2: 0
3: 23
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096426709 Original CRISPR CAGCCTGCACAGCTGGTACG AGG Exonic
900773060 1:4561250-4561272 CAGCCTGCCCAGCTGCTATGAGG - Intergenic
900871496 1:5307266-5307288 CTGCCTGCAGGGCTGGGACGAGG - Intergenic
901053416 1:6437329-6437351 CGGTCTGCACAGCTGGTGGGGGG - Intronic
901573107 1:10177924-10177946 ACGACTGCACAGCTGGTAGGTGG + Intronic
901908411 1:12434334-12434356 CACCCTTCACAGCTGGCAAGTGG - Intronic
902756204 1:18550780-18550802 CAGCGTGCCCAGCTGGTGCCTGG - Intergenic
902777951 1:18686515-18686537 AAGCCTGGGCAGCTGGTTCGAGG - Intronic
903182948 1:21614260-21614282 CAGGCTGCCCAGCTGGTCAGTGG - Intronic
903337389 1:22634329-22634351 CAGCTTCCACAGCTGGCACCGGG + Intergenic
903672037 1:25042147-25042169 CAGCATCCACAGCTGGCACTGGG + Intergenic
903763212 1:25713748-25713770 CAGCCTGCACAGGTGATCAGAGG + Intronic
904558829 1:31383382-31383404 CTGCCTGAACAGATGGTAAGTGG - Intergenic
905140758 1:35842208-35842230 CAGGCTGCACAGCAGGTGAGTGG + Intronic
905455169 1:38083654-38083676 CAGCCTGCACAGCAGGGCGGGGG - Intergenic
907491076 1:54809210-54809232 CAGAGTGCACAGCTGCTAAGTGG + Intronic
910430966 1:87159409-87159431 CAGCCTAAACAGTTGGTACAAGG + Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911979377 1:104547229-104547251 CAGCCTGCTCAGCCTGTATGAGG - Intergenic
912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG + Exonic
912557956 1:110529874-110529896 GAGCCTGCCCAGCTGGTGCCTGG + Intergenic
913317965 1:117568174-117568196 CACCCTGCACAGCTGCCAAGGGG - Intergenic
917968720 1:180194171-180194193 CAGCCTGAAGGGCTGGTGCGTGG + Intronic
920229761 1:204462435-204462457 CAGCCTTCACAACTAGTAAGTGG + Intronic
921608720 1:217185467-217185489 CATCCTGCAGAGCCTGTACGAGG - Intergenic
922193699 1:223341481-223341503 CAGCCTTCACAGCTGGAAGGTGG - Intronic
922213131 1:223500518-223500540 CAGCTTGCACAGCTGGGAGCAGG - Intergenic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
923755388 1:236786509-236786531 CAGCTTCCTCAGCTGGCACGAGG - Intergenic
1065183533 10:23150237-23150259 AAGGCTGCACAGCTGGCAAGTGG - Intergenic
1067378861 10:45753964-45753986 CAGCCCGCACAGCAGGCACAAGG - Intronic
1067698629 10:48553059-48553081 CAGCCTGCTCAGATGGGACCTGG - Intronic
1067886564 10:50094626-50094648 CAGCCCGCACAGCAGGCACAAGG - Intronic
1070859264 10:79637739-79637761 CAGCTTCCACAGCTGTTACAAGG + Intergenic
1073670174 10:105579365-105579387 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1074435801 10:113433251-113433273 TAGCCTGGACAGCTGGGAGGAGG - Intergenic
1076194935 10:128511028-128511050 CAGCCCACACAGCTAGTACCTGG - Intergenic
1076759503 10:132594814-132594836 CAGCCTGCAGGGCTGGCAGGGGG - Intronic
1077089667 11:772684-772706 CAGCCCGCACAGCTGGCATCAGG + Intronic
1077328911 11:1975437-1975459 CAGCCTGGACAGCCTGTCCGAGG - Intronic
1078076860 11:8169938-8169960 CAGTCTTCTCAACTGGTACGAGG + Intergenic
1079030534 11:16983026-16983048 CAGCCTGATCATCTGGTAGGAGG - Intronic
1085100709 11:73797536-73797558 CAGCTTTCACAGCTGGCACTGGG - Intronic
1085767114 11:79292735-79292757 CAGGTTGCATAGCTGGTAAGTGG - Intronic
1088503615 11:110508044-110508066 CAGCTTCCACGGCTGGTACCAGG - Intergenic
1088651245 11:111959365-111959387 CAGCTTCCACAGCTGGCACCAGG - Intronic
1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG + Intronic
1090124787 11:124074831-124074853 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1090334987 11:125956041-125956063 CAGTCTTCACAACTGGTACAAGG + Exonic
1090640121 11:128722877-128722899 CAGCCTGAACAGCTAGAACAGGG - Intronic
1091335462 11:134762710-134762732 GCGGCTGCACAGCTGGTGCGTGG + Intergenic
1202811890 11_KI270721v1_random:30616-30638 CAGCCTGGACAGCCTGTCCGAGG - Intergenic
1093764870 12:22951954-22951976 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1097536077 12:60872512-60872534 CAGCTTTCACAGCTGGCACCAGG + Intergenic
1098175504 12:67786128-67786150 CAGCCACCACAGGTGGTACCAGG - Intergenic
1100494235 12:95109963-95109985 AAGCCTCCACGGCTGGTACCAGG - Intronic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1101602371 12:106221864-106221886 AAGCCTGCACAGCTAGCAAGAGG + Intergenic
1102487585 12:113268671-113268693 CATCCTGCATACCTGGAACGGGG - Intronic
1104552641 12:129771264-129771286 AAACCTGCACAGTTGGTATGCGG - Intronic
1104717815 12:131028032-131028054 CAGCATGAACAGCTGGTGCCCGG + Intronic
1104750131 12:131233117-131233139 CAGCCTGGGCAGCTGGCACGGGG - Intergenic
1104782585 12:131431344-131431366 CAGCCTGGGCAGCTGGCACGGGG + Intergenic
1105240985 13:18609605-18609627 CAGCCTGCGCAGCGGGCACTCGG - Intergenic
1105783629 13:23725926-23725948 GAGCCTGCACAGCAGGAGCGGGG + Intergenic
1106837269 13:33648416-33648438 TAGTCTGCATAGCTGGTAAGTGG - Intergenic
1108542328 13:51455803-51455825 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1109396390 13:61765599-61765621 CAGCTTCCACAGCTGGCACCGGG + Intergenic
1109622118 13:64924761-64924783 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1109982371 13:69924848-69924870 CAGCTTCCACAGCTGGCACTGGG - Intronic
1112225123 13:97532114-97532136 CAGCCTGCAAAGTTGGTGCCAGG - Intergenic
1113507850 13:110829518-110829540 AAGGCTGCAGAGCTAGTACGCGG + Intergenic
1121685567 14:95832567-95832589 CAGTCAGGACAGCTGGTACCCGG - Intergenic
1122029101 14:98899664-98899686 CAGCCTGCACCGTTTGTACCTGG + Intergenic
1122175522 14:99915567-99915589 CAACCTGCAGAGCTGCTACAGGG - Intronic
1122307550 14:100775515-100775537 CAGGCTTCCCAGCAGGTACGTGG + Intergenic
1122498703 14:102178962-102178984 AAGGCTACACAGCTGGTAAGTGG + Intronic
1123490372 15:20775540-20775562 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1123546873 15:21344627-21344649 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1125381481 15:39091781-39091803 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1125743840 15:41985944-41985966 CAGCAGGCACAGGTGGTTCGCGG + Exonic
1126215312 15:46147025-46147047 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1128732295 15:70029464-70029486 CATCCTGCACAGCTGGGCCCAGG + Intergenic
1129371461 15:75098524-75098546 CAGCCTGCCCAACTGGTGGGTGG + Intronic
1130056137 15:80527717-80527739 CAGTTTGCACAGCTGGTAACTGG + Intronic
1130202147 15:81842037-81842059 CAGCTTACACAGGTGGTAAGTGG - Intergenic
1131300195 15:91192864-91192886 GAGCCTGCACAGCAGGTGCCTGG - Intronic
1132270636 15:100520808-100520830 CAGCAAGCACAGCTGGTGCCGGG + Intronic
1202955204 15_KI270727v1_random:71843-71865 CAGCCTGCGCAGCAGGCACTCGG + Intergenic
1132685120 16:1158926-1158948 CAGCCCGCACCGCTGGGACCGGG + Intronic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1135049810 16:19183738-19183760 CAGCATGCCCAGCTGGTACTTGG - Exonic
1135804934 16:25534270-25534292 CAGGCTGCACAGCAGGTGAGTGG - Intergenic
1136536229 16:30901408-30901430 CAAACTGCACAGCTAGTAAGTGG + Intronic
1137334211 16:47532653-47532675 CAGCTTCCACAGCTGGCACTGGG + Intronic
1138109442 16:54311972-54311994 CAGCCTGCACTCCTGGTCCCTGG - Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1142863673 17:2777927-2777949 CAGCTTGCACAGCTGCCAGGAGG + Intronic
1144217385 17:13068375-13068397 CAGCCTGGACTGCTGGTTCCGGG - Intergenic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1144839585 17:18177655-18177677 CAGACTGCACAACTGGTAGGTGG - Intronic
1144872115 17:18377969-18377991 CAGCAAGCACAGCTGGTGAGTGG + Exonic
1145815702 17:27793638-27793660 CAGCCTGCACAGCCGGGGCCCGG + Intronic
1148907881 17:50922847-50922869 CAGCCTGCACAGGTGGGGCCAGG - Intergenic
1149836683 17:59919328-59919350 CAGCCTGGCCAGCTGGTTTGGGG + Intronic
1151428079 17:74044093-74044115 AAGGCTGCACAGCTGGCAAGGGG - Intergenic
1151473120 17:74330236-74330258 CAGGCTGCACAGCTGGCAAATGG - Intronic
1151749171 17:76027093-76027115 CAGCAGGCACAGCCGGTAAGTGG - Exonic
1152241065 17:79161418-79161440 CAGCATCCCCAGCTGGTATGCGG - Intronic
1152729997 17:81965270-81965292 CACTGTGCCCAGCTGGTACGGGG + Intergenic
1153352533 18:4096803-4096825 CAGCCTTCACAGCTAGTAAATGG - Intronic
1154447979 18:14450297-14450319 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1155866742 18:30974647-30974669 CACTATGCACAGCTGGTACCTGG + Intergenic
1158197957 18:54909761-54909783 CAGCTTCCACAGCTGGCACCGGG + Intronic
1160716777 19:580332-580354 CGTCCTGCAGAGCTGGTACGCGG + Intronic
1160949536 19:1658794-1658816 GAGCCTGCAAAGCTGGAACAGGG + Intergenic
1160967209 19:1752028-1752050 CAGCCTGCCCAGCTGGGAGCCGG - Intergenic
1162801445 19:13112908-13112930 CAGCCTGCACAGCTGCATCCAGG + Exonic
1163129963 19:15266152-15266174 CTGCCTGCACAGCTGCTGGGAGG - Intronic
1163241067 19:16064285-16064307 CAGCCTGAACAGCTGGGGCAGGG + Intergenic
1163612826 19:18309957-18309979 CAGCTTGCAGGGGTGGTACGGGG - Intronic
1165092429 19:33394131-33394153 CAGCCTGCAAAGTTGGCACATGG + Intronic
1165210362 19:34231047-34231069 CAGCCTGCACAGCGGGTGAGAGG - Intergenic
1165724973 19:38106455-38106477 AAACCAGCACAGATGGTACGTGG + Intronic
1165861840 19:38913153-38913175 TGGGCTGCACAGCTGGCACGTGG - Intergenic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1168138060 19:54364808-54364830 CAGGCTGCACTGCTGGGACCTGG - Exonic
1168594651 19:57665380-57665402 CAGCCTACACAAATGGTAAGGGG - Intergenic
925189127 2:1868773-1868795 CAGCCTGCACCGCAGGGAGGAGG - Intronic
926123343 2:10256519-10256541 CAGCCAGCACAGCAGGTGCCAGG + Intergenic
927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG + Intronic
928285839 2:29989347-29989369 CAATTTGCACAGCTGGTAAGTGG - Intergenic
928945543 2:36768620-36768642 CAGCCTACACAGCTGGGAAGTGG + Intronic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
932522553 2:72428394-72428416 CAGCTTCCCCAGCTGGTACCAGG - Intronic
933858636 2:86442131-86442153 CAGCCACGACAGCTGGGACGTGG + Exonic
934962645 2:98690403-98690425 AACCCTGCACAGCTGGAAGGAGG + Intronic
935137574 2:100321494-100321516 CAGCCTGCGCAGCCGGCACTCGG + Exonic
937077184 2:119115668-119115690 CAGCCTTCACTGCTGGGACCTGG - Intergenic
937229608 2:120389917-120389939 GAGGCTGCGCAGCTGGTAAGTGG - Intergenic
937854997 2:126665945-126665967 CAGCCTGCCCTGCTGGGAGGGGG + Intronic
937966213 2:127513335-127513357 CAGGCTGCACATGAGGTACGGGG + Intronic
938305766 2:130253119-130253141 CATCCTGCACAGCTGGGGTGCGG - Intergenic
938406500 2:131035822-131035844 CACCCTGCACGTCTGGTAGGTGG + Intronic
940765402 2:157784712-157784734 CAGCCTGCACCGCTGGTTTGTGG - Intronic
943858516 2:192829000-192829022 CAGCTTCCACAGCTGGCACCAGG - Intergenic
945770311 2:214034684-214034706 CAGCTTCCACAGCTGGCACCAGG + Intronic
946215011 2:218177405-218177427 CATCCTGCACAGATGGGACACGG + Intergenic
947511816 2:230762194-230762216 CACCGTGCCCAGCTGGTAAGTGG + Intronic
948311372 2:236989471-236989493 GAGCCTGCACAGCTGAGTCGGGG + Intergenic
948384078 2:237570929-237570951 CAGCCTGGACAGTGGGTACATGG + Intergenic
1168983321 20:2026306-2026328 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1169084677 20:2819332-2819354 CCTCCTGCCCAGCTGGTATGGGG + Intronic
1169093367 20:2874594-2874616 CTGCCTGCACAGCTAGCAGGTGG - Intronic
1172251176 20:33480295-33480317 CAGCCTGAACAACTGGGACAAGG + Intergenic
1173884449 20:46445308-46445330 CAGCTTCCACAGCTGGTACTGGG + Intergenic
1174305124 20:49609613-49609635 AAGCTTGCACAGCTTGTAGGTGG + Intergenic
1176077833 20:63256543-63256565 CGGTCTGCACACCTGGTTCGCGG + Intronic
1176408524 21:6434985-6435007 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1177262698 21:18750665-18750687 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1177792603 21:25735917-25735939 CAGCCTGCTCAGCTGGGATGTGG + Intronic
1178828506 21:36035325-36035347 CATCCTGCACAGCTGGGCCGTGG - Exonic
1179231101 21:39504484-39504506 CAGACTGCAGAGGTGGTGCGTGG - Intronic
1179684017 21:43043311-43043333 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1179925596 21:44532424-44532446 CAGCCTGCACAGCACGTCCCTGG + Intronic
1180709534 22:17830563-17830585 GAGCATGCACAGCTGGTCCAGGG - Intronic
1181181293 22:21070264-21070286 CAGCCTGCCCTGCTGGCATGCGG + Intergenic
1182532693 22:30972921-30972943 CAGCCTACAGACCTGGTACCTGG + Intergenic
1183024872 22:35057570-35057592 CAGCTTTCACAGCTGGCACTGGG + Intergenic
1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG + Intronic
1184054161 22:42033253-42033275 CAGCTTCCACAGCTGGCACCAGG + Intronic
1184363438 22:44032710-44032732 CAGAGTCCAGAGCTGGTACGTGG + Intronic
1184560812 22:45261991-45262013 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
1184865726 22:47200970-47200992 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1203294929 22_KI270736v1_random:32768-32790 CAGCCTGTACAGGAGGTACAGGG + Intergenic
950757198 3:15185217-15185239 CTGCCTGCTGAGCTGGTCCGAGG + Intergenic
953817393 3:46170583-46170605 CAGCATGCCCAGCTGGTGCCAGG - Intronic
954196577 3:49000687-49000709 CACCAGGCACAGCTGGTAGGTGG - Intronic
956304141 3:67805464-67805486 GAGGCTGCTCAGCTGGTAGGAGG + Intergenic
957767060 3:84639030-84639052 CAGCCCGCATAGCTGTAACGGGG + Intergenic
960939093 3:122922060-122922082 CAGCCTCCACGGCTGCTACCTGG - Exonic
961942873 3:130656002-130656024 CAGCTTCCACAGCTGGCACTGGG + Intronic
962785822 3:138767769-138767791 CAGCTTCCACAGCTGGCACTGGG + Intronic
963311877 3:143718610-143718632 CTGCCTGTTCAGCTGTTACGTGG - Intronic
964590601 3:158359569-158359591 CAGCTTCCACAGCTGGCACCGGG + Intronic
966563737 3:181352434-181352456 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
968189852 3:196659901-196659923 CAGCCTGCACAGCTGCCACCTGG + Exonic
968538529 4:1150375-1150397 CAGCTTCCACAGCTGGCACTGGG + Intergenic
969397479 4:6931961-6931983 CAGCAAGCAGAGGTGGTACGAGG + Intronic
969635634 4:8368120-8368142 CAGGCCGCACAGGTGGCACGTGG + Intronic
970959761 4:21857951-21857973 CAGCTTCCACAGCTGGCACTGGG - Intronic
972417720 4:38859097-38859119 CAGCTTGCACTGCTGGTCAGTGG + Intergenic
974165140 4:58191575-58191597 CACCCAGCAGAGCTGGTACTGGG - Intergenic
976647443 4:87400516-87400538 CAGCTTCCACAGCTGGCACTGGG - Intergenic
976734429 4:88295986-88296008 CAGCTTCCACAGCTGGCACTGGG + Intergenic
980253528 4:130348788-130348810 CAGCTTCCACAGCTGGCACTGGG + Intergenic
980493424 4:133560324-133560346 CAGCTTCCACAGCTGGGACTAGG + Intergenic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
982157933 4:152539853-152539875 CAGCTTCCACAGCTGGCACCAGG + Intergenic
982189063 4:152834933-152834955 CAGCTGGCACAGCTGGGATGTGG + Intronic
983784663 4:171716094-171716116 CAGCTTCCACAGCTGGCATGGGG - Intergenic
985438980 4:189964590-189964612 CAGCCTCCACTGCTGATACCTGG + Intergenic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
989520778 5:42397296-42397318 CAGCTTCCACAGCTGGCACTGGG - Intergenic
991254545 5:64599787-64599809 CAGGGTGCAAAGCTGGTAGGTGG - Intronic
991359171 5:65802383-65802405 CAGCTTTCACAGCTGGCACTGGG + Intronic
992838823 5:80667708-80667730 CAGCTTCCACAGCTGGCACCAGG + Intronic
993707057 5:91183052-91183074 AAGCCTGAACAGCTGTTACCCGG - Intergenic
997352928 5:133243961-133243983 CAGCCTGCACAGCGGCCACTCGG - Intronic
997999374 5:138611562-138611584 CAGCCTGCACTGCTGGGCTGGGG + Intronic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
999645874 5:153716594-153716616 CAGCCTGCTCAGCTGGAGTGAGG + Intronic
1002312633 5:178323911-178323933 CAGCTGGAACAGCTGGTATGTGG + Intronic
1003254237 6:4460207-4460229 CATCCTGCACAGCTGGGCCCGGG + Intergenic
1004321746 6:14636876-14636898 CATCCTCCTCAGCTGGTACTCGG + Intergenic
1006381177 6:33698195-33698217 CAGGTTGCACAGCTGGGAAGTGG + Intronic
1007162554 6:39803738-39803760 CAGCCTGCACAGGTTCTAGGGGG - Intronic
1009846805 6:69145347-69145369 CAGCTTCCACAGCTGGCACTGGG + Intronic
1010463736 6:76143007-76143029 CAGCCTCCACTGCTGATACCCGG - Intergenic
1012752862 6:103184847-103184869 CAGCTTCCACAGCTGGCACCAGG - Intergenic
1016287189 6:142486389-142486411 CAGATTGCACAACTGGTAAGTGG - Intergenic
1016758760 6:147715413-147715435 CAGCTTCCACAGCTGGCACTGGG + Intronic
1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG + Intronic
1023624505 7:42102576-42102598 CAGCCTGTACAGCTGCTCGGTGG - Intronic
1024973249 7:55089839-55089861 CATCCTGCATAGCTGGTTAGAGG - Intronic
1025244444 7:57305679-57305701 CAACTTGCCCAGCTGGTAAGTGG + Intergenic
1027493689 7:78861127-78861149 AAGCCTTCACAGATGGTACCTGG - Intronic
1028378815 7:90176012-90176034 CAGCTTCCACAGCTGGCACCAGG + Intronic
1029515495 7:101020733-101020755 CAGGGTGCACAGCTGGTTCATGG - Intronic
1029692364 7:102190818-102190840 CAGCCTGCAGAGATGGGAGGTGG - Intronic
1029899427 7:104023154-104023176 CAGCTTCCACAGCTGGCACCAGG - Intergenic
1030513960 7:110518779-110518801 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1035775907 8:2188111-2188133 CTGCCTTCTCAGCTGCTACGAGG + Intergenic
1035827259 8:2657959-2657981 CAGCCTGCACACTTCATACGTGG + Intergenic
1036915361 8:12799214-12799236 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1037815387 8:22109222-22109244 CAGCGTGCACAGCTGCGACTCGG - Exonic
1038172207 8:25145766-25145788 CAGGCTGCTCAGCTAGTAAGTGG - Intergenic
1038368331 8:26960929-26960951 CAGGCTGCACAGCAGGTGAGTGG + Intergenic
1043082448 8:75783926-75783948 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1043344319 8:79282071-79282093 CAGCATCCACAGCTAGTAAGTGG - Intergenic
1044261871 8:90134495-90134517 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
1045472934 8:102528475-102528497 CAAACCGCACAGCTGGTAAGTGG + Intergenic
1046395156 8:113631939-113631961 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1046407234 8:113790548-113790570 CAGCTTCCACAGCTGGGACCAGG + Intergenic
1048462610 8:134635089-134635111 CAGGCTGCACAGCAGGTGAGTGG - Intronic
1048682809 8:136864899-136864921 AAGCCCTCACAGCTGGTAAGTGG - Intergenic
1049050683 8:140192550-140192572 CTGACTGCACAGCTGGTGCGAGG - Intronic
1049206968 8:141368095-141368117 CAGCCTGCACACCTGGCATCTGG + Intergenic
1049558617 8:143296410-143296432 CTTCCTGCACAGCTCGAACGTGG + Exonic
1051360823 9:16280223-16280245 CAGATTGCACAGCTGGAAAGAGG + Intergenic
1052218919 9:25997017-25997039 CAGCCTGCACAGGTGGGGCATGG - Intergenic
1053128308 9:35600326-35600348 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1053164289 9:35833704-35833726 CAGAATGCACAGCTAGTAGGTGG - Intronic
1055890819 9:81122081-81122103 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1058077783 9:100668114-100668136 CAGCTTCCACAGCTGGCACCAGG - Intergenic
1059376756 9:113888094-113888116 AAGGCTACACAGCTGGTAAGTGG + Intronic
1060007351 9:120012347-120012369 CAGCAGGCACAGCTGGTAGCAGG + Intergenic
1060790426 9:126482191-126482213 AAGCCTGCGCAGCTGGGAGGGGG - Intronic
1061916933 9:133760195-133760217 CAGCCTGCACATCTGGGAGAAGG + Intergenic
1188859760 X:35243379-35243401 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1189083687 X:37998433-37998455 CAGCTTCCACAGCTGGCACCGGG - Intronic
1189090757 X:38080178-38080200 GAGCATGCACAGCTGGTAAAAGG + Intronic
1190369607 X:49727946-49727968 CAGCTTCCACAGCTGGCACCGGG - Intergenic
1190759881 X:53430389-53430411 CAGCCTGCACAGCTGCCTGGTGG - Exonic
1192343654 X:70283731-70283753 CATCCTGCAGTGCTGGTAGGGGG - Intronic
1192631115 X:72778394-72778416 CAGCCTTCACTGCTGGCAGGAGG - Intronic
1192650594 X:72942407-72942429 CAGCCTTCACTGCTGGCAGGAGG + Intronic
1193108314 X:77703474-77703496 CAGCATCCACAGCTGGCACCAGG + Intronic
1194714969 X:97277541-97277563 CAGTCTGTACAGCTGGAATGTGG - Intronic
1195178909 X:102338377-102338399 CAGCCTCCACAACTGGCACTTGG + Intergenic
1200206660 X:154321291-154321313 CAGCCTGCTCAGGTGGGAGGGGG + Intronic
1200975414 Y:9207433-9207455 CAGCTTCCACAGCTGATACTGGG + Intergenic
1201780545 Y:17716675-17716697 CAGCTTCCACAGCTGATACTGGG + Intergenic
1201796993 Y:17906559-17906581 CAGCTTCCACAGCTGATACTGGG - Intergenic
1201804560 Y:17999426-17999448 CAGCTTCCACAGCTGATACTGGG + Intergenic
1201821009 Y:18189315-18189337 CAGCTTCCACAGCTGATACTGGG - Intergenic
1202172064 Y:22060455-22060477 CAGCCTCCACAGCTGATACTGGG + Intergenic
1202219298 Y:22525916-22525938 CAGCCTCCACAGCTGATACTGGG - Intergenic
1202323882 Y:23670149-23670171 CAGCCTCCACAGCTGATACTGGG + Intergenic
1202341589 Y:23874581-23874603 CAGCTTCCACAGCTGATACTGGG - Intergenic
1202358366 Y:24075618-24075640 CAGCTTCCACAGCTGATACTGGG - Intergenic
1202512412 Y:25594495-25594517 CAGCTTCCACAGCTGATACTGGG + Intergenic
1202529177 Y:25795505-25795527 CAGCTTCCACAGCTGATACTGGG + Intergenic
1202546889 Y:25999905-25999927 CAGCCTCCACAGCTGATACTGGG - Intergenic