ID: 1096427948

View in Genome Browser
Species Human (GRCh38)
Location 12:51520223-51520245
Sequence GCTCTAAGGCACCATCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096427937_1096427948 29 Left 1096427937 12:51520171-51520193 CCAGGAAAGAAGACCTTAAATGC 0: 1
1: 1
2: 0
3: 12
4: 186
Right 1096427948 12:51520223-51520245 GCTCTAAGGCACCATCAGATGGG 0: 1
1: 0
2: 1
3: 9
4: 55
1096427944_1096427948 7 Left 1096427944 12:51520193-51520215 CCAGGTTATGAGGTGGGGACTAT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1096427948 12:51520223-51520245 GCTCTAAGGCACCATCAGATGGG 0: 1
1: 0
2: 1
3: 9
4: 55
1096427940_1096427948 16 Left 1096427940 12:51520184-51520206 CCTTAAATGCCAGGTTATGAGGT 0: 1
1: 0
2: 3
3: 8
4: 133
Right 1096427948 12:51520223-51520245 GCTCTAAGGCACCATCAGATGGG 0: 1
1: 0
2: 1
3: 9
4: 55
1096427936_1096427948 30 Left 1096427936 12:51520170-51520192 CCCAGGAAAGAAGACCTTAAATG 0: 1
1: 0
2: 2
3: 26
4: 266
Right 1096427948 12:51520223-51520245 GCTCTAAGGCACCATCAGATGGG 0: 1
1: 0
2: 1
3: 9
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096427948 Original CRISPR GCTCTAAGGCACCATCAGAT GGG Intergenic
908246062 1:62228488-62228510 TCTCAAAGGCAACATGAGATTGG + Intergenic
910558170 1:88559874-88559896 TCCCTAAGACAGCATCAGATTGG + Intergenic
917015027 1:170520593-170520615 GCTCTAAGACACAAACAGGTTGG - Intergenic
1064404066 10:15045551-15045573 GCTCTAAGAAACAAACAGATGGG + Intronic
1067655902 10:48190947-48190969 GCTATAAGGTACCATTAGTTGGG + Intronic
1081735955 11:45404395-45404417 AGTCCAAGGCTCCATCAGATTGG + Intergenic
1086338630 11:85825127-85825149 GCTCTAAAGGACCATGAGTTGGG + Intergenic
1090868365 11:130721865-130721887 GCTGAAAGGCAACATCAGACTGG + Intergenic
1092033981 12:5314694-5314716 GTTCTAAGGAACCACCAGACAGG + Intergenic
1092986455 12:13850488-13850510 GCTCCCAGGCCCCATCAGACTGG + Intronic
1096427948 12:51520223-51520245 GCTCTAAGGCACCATCAGATGGG + Intergenic
1098522363 12:71447801-71447823 GCTTGAAGGCACCTTCAGTTCGG + Intronic
1105600436 13:21881788-21881810 GCTCTCAGGCAGCATTACATTGG - Intergenic
1106553646 13:30792001-30792023 GCTCTCAGGCAGATTCAGATGGG - Intergenic
1107817386 13:44256341-44256363 ACTCTAAGGCACCATGAGAGTGG + Intergenic
1112660353 13:101500852-101500874 GTTCAAAGGCACCCTCAGACTGG - Intronic
1113134036 13:107069399-107069421 GCCCCAAGGCACCATCAGATAGG - Intergenic
1121408146 14:93731848-93731870 TTTCTAAGGCACCATCAAAAAGG + Intronic
1121965362 14:98298658-98298680 GCTCCAAGGCACCAGCCCATCGG - Intergenic
1122530538 14:102422947-102422969 GCGCTAAGACACCAGCTGATAGG - Intronic
1125140272 15:36398135-36398157 GCTCTGTGGCTCCATCAGAATGG - Intergenic
1139339782 16:66260865-66260887 GCTCGATGGCAGCATCAGAAGGG - Intergenic
1141675904 16:85517202-85517224 GCACACAGGGACCATCAGATGGG + Intergenic
1147041269 17:37721231-37721253 GCTTTACGACACCAGCAGATTGG - Intronic
1155375670 18:25154443-25154465 GTTCTAAGGAACCATCAGGTAGG + Intronic
1162423492 19:10579742-10579764 GCTCAAAGTCACCATCAGGCGGG + Exonic
1166240184 19:41486070-41486092 TCTTTAAGGCACCATAAGTTGGG - Intergenic
1167292891 19:48634464-48634486 GCTCTAAGGTTCCAGAAGATTGG + Intronic
1168561767 19:57390244-57390266 GCTCTGAGGCTGCATCAAATCGG - Intronic
925399688 2:3563384-3563406 ACTCTGAGGCACCATCAGGTTGG + Intergenic
928603804 2:32925971-32925993 CCTCTAAGGTTCCTTCAGATGGG + Intergenic
937237750 2:120441047-120441069 GCTCTTGGGCCCCATCAGAGAGG + Intergenic
941416719 2:165230487-165230509 GTTCTCAGGAGCCATCAGATAGG - Intergenic
1175176497 20:57115479-57115501 GGATTAAGGCACCAGCAGATTGG + Intergenic
1181589333 22:23873900-23873922 GCTCAAAGTCACCAGCACATTGG - Intronic
1184065882 22:42120275-42120297 GAGCATAGGCACCATCAGATGGG - Intergenic
1184966140 22:47973621-47973643 ACTCTAAGGCACCCTTAGGTGGG + Intergenic
957834740 3:85572793-85572815 TCTCTGAGCCACCAGCAGATTGG + Intronic
958017550 3:87958777-87958799 GAGATAAGGCACAATCAGATTGG - Intergenic
966570411 3:181435887-181435909 ACTCTAAGTCACAATGAGATTGG - Intergenic
968066387 3:195761868-195761890 GCTCTAAGGGAGCATCAGGGGGG - Intronic
968905601 4:3449284-3449306 CCTCTACGGCATCATCAGCTGGG + Exonic
976273246 4:83250879-83250901 GCACTAAGGCACCAGCAGACTGG - Intergenic
978369953 4:108020106-108020128 ACGCTAAGGCACCATTACATGGG - Intronic
985235028 4:187863072-187863094 GGTCTAAGGCACCATCATTTTGG - Intergenic
986160582 5:5224783-5224805 GCTCAAAGGCAACATCAGAAAGG - Intronic
989326567 5:40203266-40203288 TCTCTAAGGCACCCTGATATTGG - Intergenic
995596018 5:113748446-113748468 GCACTAAGGCCCCAACAGACCGG + Intergenic
998726337 5:145019601-145019623 GTTCTGAGGTACCTTCAGATGGG + Intergenic
998878524 5:146624330-146624352 GCTCTATGGCACCTTCATCTAGG + Intronic
1029098774 7:98110128-98110150 TCTCTAAGGCACCATTAAACTGG - Intronic
1031627850 7:124010633-124010655 TCTAAAAGGCACCATCAGATAGG + Intergenic
1032844458 7:135740650-135740672 CTTGTAAGGCCCCATCAGATAGG - Intronic
1033415653 7:141159131-141159153 GATGTAAGCAACCATCAGATGGG - Intronic
1039284952 8:36029410-36029432 TCTCCAAGGCCCCATCAGAGTGG - Intergenic
1040988401 8:53321938-53321960 TCACTAGGGCACCATTAGATGGG - Intergenic
1045435738 8:102162115-102162137 GCTCTCAGCCAGCAACAGATAGG + Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048203554 8:132397258-132397280 GCACTGAGGCACGGTCAGATGGG - Intronic
1048483160 8:134820491-134820513 GCTGTAAGGCACCATGATTTTGG - Intergenic
1057725443 9:97564944-97564966 GCCCCACGGCACCATCAGATTGG + Intronic
1061249438 9:129417869-129417891 GCTATAAGGCACCATCTGTGAGG - Intergenic
1185792073 X:2934848-2934870 TCCCTAAGGCACCAGCAGAGGGG + Exonic
1187348362 X:18488653-18488675 GCTCCAGGGCACCATCATTTAGG - Intronic
1190492239 X:50993752-50993774 TCTCCAAGGCACCATCAGACAGG - Intergenic
1192688436 X:73332553-73332575 TCTCCAAGACACCATAAGATAGG - Intergenic