ID: 1096430287

View in Genome Browser
Species Human (GRCh38)
Location 12:51537586-51537608
Sequence GGTCTAGGGAAACTGTGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096430282_1096430287 4 Left 1096430282 12:51537559-51537581 CCACACGTGGGTGGCCAGCTAAA No data
Right 1096430287 12:51537586-51537608 GGTCTAGGGAAACTGTGCTTAGG No data
1096430281_1096430287 5 Left 1096430281 12:51537558-51537580 CCCACACGTGGGTGGCCAGCTAA No data
Right 1096430287 12:51537586-51537608 GGTCTAGGGAAACTGTGCTTAGG No data
1096430286_1096430287 -10 Left 1096430286 12:51537573-51537595 CCAGCTAAAAGCAGGTCTAGGGA No data
Right 1096430287 12:51537586-51537608 GGTCTAGGGAAACTGTGCTTAGG No data
1096430277_1096430287 17 Left 1096430277 12:51537546-51537568 CCATCAAGACAGCCCACACGTGG No data
Right 1096430287 12:51537586-51537608 GGTCTAGGGAAACTGTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096430287 Original CRISPR GGTCTAGGGAAACTGTGCTT AGG Intergenic
No off target data available for this crispr