ID: 1096431242

View in Genome Browser
Species Human (GRCh38)
Location 12:51545048-51545070
Sequence GCTGGGGACCCCTGCTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096431242_1096431244 -8 Left 1096431242 12:51545048-51545070 CCTCTACAGCAGGGGTCCCCAGC No data
Right 1096431244 12:51545063-51545085 TCCCCAGCCTTTTTGGCACCAGG 0: 90
1: 1092
2: 1715
3: 1394
4: 963
1096431242_1096431251 29 Left 1096431242 12:51545048-51545070 CCTCTACAGCAGGGGTCCCCAGC No data
Right 1096431251 12:51545100-51545122 AAGACAATTTTTCCACCGACTGG 0: 4
1: 225
2: 713
3: 832
4: 649
1096431242_1096431246 -7 Left 1096431242 12:51545048-51545070 CCTCTACAGCAGGGGTCCCCAGC No data
Right 1096431246 12:51545064-51545086 CCCCAGCCTTTTTGGCACCAGGG 0: 92
1: 1082
2: 1680
3: 1324
4: 897
1096431242_1096431252 30 Left 1096431242 12:51545048-51545070 CCTCTACAGCAGGGGTCCCCAGC No data
Right 1096431252 12:51545101-51545123 AGACAATTTTTCCACCGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096431242 Original CRISPR GCTGGGGACCCCTGCTGTAG AGG (reversed) Intergenic
No off target data available for this crispr