ID: 1096437264

View in Genome Browser
Species Human (GRCh38)
Location 12:51604434-51604456
Sequence GCGCCTTCCTCAATACCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096437263_1096437264 -1 Left 1096437263 12:51604412-51604434 CCATCAGTCTGTATGTGTGTCTG 0: 1
1: 0
2: 5
3: 174
4: 1255
Right 1096437264 12:51604434-51604456 GCGCCTTCCTCAATACCACACGG 0: 1
1: 0
2: 0
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096437264 Original CRISPR GCGCCTTCCTCAATACCACA CGG Intronic
902385190 1:16072358-16072380 GCTCCTTGCTCAATACCCCCAGG + Intronic
913222269 1:116668603-116668625 GCCCCTCCCCCAATAACACAGGG - Intergenic
913603034 1:120440196-120440218 GTGCCTTCTCCAACACCACATGG - Intergenic
913603782 1:120446548-120446570 GTGCCTTCTCCAACACCACATGG - Intergenic
913640648 1:120809265-120809287 GTGCCTTCTCCAACACCACATGG - Intronic
914211877 1:145587359-145587381 GTGCCTTCTCCAACACCACATGG + Intergenic
914277831 1:146141080-146141102 GTGCCTTCTCCAACACCACATGG + Intronic
914364214 1:146963811-146963833 GTGCCTTCTCCAACACCACATGG - Intronic
914365739 1:146976390-146976412 GTGCCTTCTCCAACACCACACGG - Intronic
914381392 1:147119560-147119582 GTGCCTTCTCCAACACCACACGG + Intergenic
914486705 1:148117052-148117074 GTGCCTTCTCCAACACCACACGG + Intronic
914487468 1:148123325-148123347 GTGCCTTCTCCAACACCACACGG + Intronic
914538876 1:148592028-148592050 GTGCCTTCTCCAACACCACATGG + Intronic
914587812 1:149078479-149078501 GTGCCTTCTCCAACACCACATGG + Intronic
914627803 1:149479596-149479618 GTGCCTTCTCCAACACCACATGG - Intergenic
914940868 1:152021891-152021913 GTGCCTTCTCCAACACCACACGG - Intergenic
919535164 1:198778277-198778299 GCGTCTTCCTCAATACACCTCGG - Intergenic
920069949 1:203295775-203295797 GCTCCTTCCTCCAAACCACACGG + Intergenic
922484666 1:225964197-225964219 GCGCCTTCCTCAAGAACTCCTGG + Intergenic
922787837 1:228291989-228292011 GCCCCTTCCTCCACTCCACAGGG - Exonic
1062772870 10:117537-117559 ACTCCTTCCTCAATTCAACAAGG + Intergenic
1063666225 10:8062207-8062229 GCGCCTTCCTAAGTACCCAACGG - Intronic
1064389339 10:14928039-14928061 GCTCCTTTCTCCAAACCACATGG + Exonic
1067488230 10:46672856-46672878 GTACCTTCCTAAATACCACATGG + Intergenic
1067558056 10:47285935-47285957 GCTCCTTCCTCAAGGCTACAGGG - Intergenic
1067606571 10:47669172-47669194 GTACCTTCCTAAATACCACATGG - Intergenic
1071622139 10:87130524-87130546 GTACCTTCCTAAATACCACATGG - Intronic
1079436772 11:20462153-20462175 ACACCTACCTTAATACCACAAGG - Exonic
1084331512 11:68433162-68433184 GCGCCCTCCTCAGGACCAGAGGG - Intronic
1085767041 11:79292191-79292213 GTGCCTTCCCCAAGACCTCATGG - Intronic
1089256850 11:117198743-117198765 GCGTCTTCCTCAAGGCCACATGG - Intergenic
1089490103 11:118877622-118877644 GCTCCCTCCACAAGACCACACGG - Intergenic
1092428885 12:8394136-8394158 GAGCCTTCCCCAAGACCACCAGG - Intergenic
1096411910 12:51383127-51383149 AAGCCTTCCTCAAACCCACAGGG - Intronic
1096437264 12:51604434-51604456 GCGCCTTCCTCAATACCACACGG + Intronic
1098870239 12:75809280-75809302 GAGTCTTGCTCAAGACCACATGG + Intergenic
1102647988 12:114415989-114416011 GGGCCTTCCCCAGTACCAGAAGG + Intergenic
1103394424 12:120597131-120597153 GCGACTTTCCCAAAACCACATGG + Intergenic
1115219910 14:31048836-31048858 CCTCCTCCCTCAAAACCACAGGG - Intronic
1127836256 15:62793359-62793381 GAGCCTTCTTCACTACCCCATGG - Intronic
1129766676 15:78173996-78174018 GCTCCTTCCACAATAACACGAGG - Intronic
1137589262 16:49683567-49683589 GTGCTTTCCTCTATGCCACAAGG + Intronic
1141129988 16:81429660-81429682 AAGCCTTCCCCAAGACCACACGG - Intergenic
1142425650 16:90000935-90000957 GTGCCTTCCTCAGCACCACAGGG - Intergenic
1142774108 17:2122892-2122914 GCCCCTTCCTCTTTGCCACATGG + Intronic
1146269806 17:31477364-31477386 GCTCCTTCCTCAGCCCCACAGGG - Intronic
1151795456 17:76342069-76342091 CCCCTTCCCTCAATACCACAGGG + Intronic
1153670194 18:7404321-7404343 GTCCCTTCACCAATACCACACGG + Intergenic
1156458734 18:37309284-37309306 GTGACTTCCTCAACAACACATGG - Intronic
1159573295 18:70144603-70144625 CCGCCTTCCTCCATACATCAGGG + Intronic
1162013926 19:7833531-7833553 GTGCCTTCCCCAACACCCCAGGG - Intronic
1163856653 19:19707657-19707679 GCGGCTTCCCGTATACCACAAGG + Intergenic
1166144691 19:40826021-40826043 GCCCCTGCCTCAAACCCACAGGG - Intronic
1166183052 19:41122186-41122208 GCCCCTGCCTCAAACCCACAGGG + Intronic
1168677926 19:58292349-58292371 GCCCCTTCCTCAATTGCAGAAGG + Intronic
925741294 2:7008009-7008031 GTGCTTTCCACTATACCACAGGG - Intronic
926797767 2:16632920-16632942 CTGCCTTCCCCAATAGCACAGGG + Intronic
936080338 2:109428640-109428662 GAGCCTTCCTCACCACCACCTGG - Intronic
936652872 2:114449623-114449645 TTGCCTTCCGCAAGACCACATGG - Intronic
937880219 2:126858981-126859003 GCCCCCTCCTCACCACCACATGG + Intergenic
942157813 2:173149594-173149616 GAACCTTGCTCAATAGCACAGGG + Intronic
947428055 2:230001689-230001711 GCTCCTTCCTCTTTACCTCAGGG + Intronic
1170526433 20:17242733-17242755 GCTCCTCTCTCAATAGCACAAGG - Intronic
1175007523 20:55701154-55701176 GGGACTTCTACAATACCACAGGG - Intergenic
1181837478 22:25622731-25622753 GCGACTTCCTAAATGCGACAGGG - Intronic
950072201 3:10161661-10161683 GCTCCTCCCTCAGTGCCACAGGG - Intergenic
950269775 3:11604696-11604718 GGGCCTCCCTCCATACAACAAGG + Intronic
955061094 3:55491912-55491934 GGGGCTTCCTCACAACCACATGG + Intergenic
957692154 3:83585569-83585591 GCGTTTTTCTCAATAACACATGG - Intergenic
969254993 4:5995433-5995455 GCTCCTTCCTCCCTGCCACAGGG + Intergenic
969409039 4:7015752-7015774 CAGCCTTCCCCAAGACCACAAGG - Intronic
972075169 4:35078852-35078874 GCACATTCCGCAATAGCACAGGG - Intergenic
976416463 4:84781731-84781753 GCTCTTTCCACTATACCACAGGG + Intronic
976730129 4:88253192-88253214 GCTCCATCCTCACTACAACACGG - Intergenic
983630002 4:169840581-169840603 GAGCCTTCATCAGTACCACATGG + Intergenic
987179728 5:15354922-15354944 CCCCCTTCCTCACCACCACAGGG + Intergenic
1003744409 6:8983446-8983468 GAGCCTTCCAGAATACCATAAGG - Intergenic
1017676569 6:156820326-156820348 ACAGCTTCCTCAATACCACATGG - Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1035817423 8:2556416-2556438 GAGACTTCTTCACTACCACAAGG + Intergenic
1036807444 8:11845341-11845363 GCACAGTCCTCAACACCACAAGG + Intronic
1037254317 8:16935008-16935030 GAGACTTATTCAATACCACAAGG - Intergenic
1042266165 8:66910926-66910948 GTTACTTCCTAAATACCACAGGG - Intronic
1044935428 8:97289203-97289225 GCCCCCTCCTCCATCCCACATGG - Intergenic
1045600223 8:103707040-103707062 TCTCCTTCATCAATTCCACACGG + Intronic
1048898188 8:139013621-139013643 GCGCCATCCACAACACCGCAGGG + Intergenic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1051017116 9:12491782-12491804 GAGACTTACTCACTACCACAAGG - Intergenic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1057665218 9:97039302-97039324 GCGCCTACCTCAATACACCCTGG + Intronic
1058269081 9:102946901-102946923 GCGCCTCCCTCAAGAGCATAAGG - Intergenic
1187550747 X:20302657-20302679 ATGCCTTCCTCCATACAACATGG - Intergenic
1188073491 X:25746916-25746938 GCAGCTCCCTCAATACAACATGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1192195931 X:69028156-69028178 TCTCCTTCCTCTACACCACATGG - Intergenic
1201545876 Y:15161525-15161547 GTGACCTCCTCATTACCACAAGG + Intergenic