ID: 1096446266

View in Genome Browser
Species Human (GRCh38)
Location 12:51695304-51695326
Sequence AGCCCCAGACTTCAAAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096446265_1096446266 -7 Left 1096446265 12:51695288-51695310 CCAATGAGATGATCTAAGCCCCA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1096446266 12:51695304-51695326 AGCCCCAGACTTCAAAGCTGAGG 0: 1
1: 0
2: 2
3: 48
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096446266 Original CRISPR AGCCCCAGACTTCAAAGCTG AGG Intronic
900095595 1:938874-938896 AGCCCCAGCCTTCAGCGCAGAGG - Intronic
901408557 1:9066898-9066920 AGCCCCGGACTTCAAGGCCGCGG + Intronic
901443864 1:9295091-9295113 AGCCCATCACTTCACAGCTGGGG - Intronic
902706167 1:18206469-18206491 AGCCCACGAGTTCAAGGCTGCGG + Intronic
903454212 1:23475873-23475895 AGCCCAGGAATTCAAGGCTGTGG + Intronic
903484249 1:23677814-23677836 GTCCCCAGACTTCAAAGCTCTGG - Intergenic
903745637 1:25584835-25584857 TGCCCCAGAATTGACAGCTGGGG - Intergenic
903928537 1:26848985-26849007 TGCCCCACACCTCAGAGCTGGGG - Intronic
904648446 1:31986300-31986322 AGCCCAGGAGGTCAAAGCTGCGG + Intergenic
906416555 1:45624513-45624535 AGCCCAAGAAATGAAAGCTGTGG + Intergenic
906789023 1:48642548-48642570 ATCCCCACATTTCAAAGATGGGG + Intronic
908770202 1:67589142-67589164 AGCCCAGGAATTCAAGGCTGCGG + Intergenic
910939979 1:92522833-92522855 AGCCCAGGAGTTCAAAGATGCGG - Intronic
911205490 1:95088082-95088104 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
912528521 1:110303202-110303224 AGTCAGAGACTCCAAAGCTGGGG - Intergenic
914416942 1:147493141-147493163 AGACCCATAATTCAAAGCTCTGG + Intergenic
915013704 1:152713623-152713645 AGCCCATGAGTTCAAGGCTGCGG - Intergenic
916074564 1:161193023-161193045 AGCCCCAGACTCCAGATATGTGG - Intronic
916484209 1:165243771-165243793 AGCCCTTGACTTCAATTCTGGGG - Intronic
916585573 1:166147018-166147040 AGACCCAGAACTCAAAGCTCTGG - Intronic
918047409 1:180949683-180949705 AGCCACATATTTCAAAGCTGCGG - Exonic
918071290 1:181134990-181135012 ATCCCCAGGCTCCCAAGCTGGGG - Intergenic
918502551 1:185214166-185214188 AACCACAGATTTCAATGCTGAGG - Intronic
921521354 1:216158311-216158333 AACCCAAGAGTTCAAGGCTGCGG - Intronic
923508297 1:234625930-234625952 AGCCCAAGAGTTCAAGGCTGCGG + Intergenic
923642641 1:235780324-235780346 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
923724548 1:236495068-236495090 AGCCCAGGAGTTCAAGGCTGTGG + Intergenic
924462057 1:244268635-244268657 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1064123088 10:12636403-12636425 AGCCCCAGAGGTCAAGGCTGCGG - Intronic
1064444073 10:15378333-15378355 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
1064781034 10:18838269-18838291 AGCCCCAGATTTCATGGATGTGG + Intergenic
1065378406 10:25065293-25065315 AGGCCCAAACTTCAACACTGGGG - Intergenic
1065671310 10:28121193-28121215 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1066104315 10:32143694-32143716 AGCCCAAGAGTTCGAGGCTGCGG - Intergenic
1067384179 10:45803784-45803806 AGCCCAAGAGGTCAAGGCTGTGG + Intergenic
1067880018 10:50035026-50035048 AGCCCAAGAGGTCAAGGCTGTGG - Intergenic
1067891865 10:50144354-50144376 AGCCCAAGAGGTCAAGGCTGTGG + Intergenic
1069371749 10:67755113-67755135 AGCCCAAGAGTTCAAGGCCGCGG + Intergenic
1069837336 10:71317816-71317838 AGCTCCAGGCTTACAAGCTGAGG - Intergenic
1070014525 10:72512775-72512797 AGCCCCAGAGGTCAAGGCTGCGG - Intronic
1070033411 10:72698879-72698901 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1070193202 10:74131623-74131645 AGCCCAGGAGTTCAATGCTGTGG - Intronic
1070718433 10:78739553-78739575 AGCCCCAGGCAGGAAAGCTGGGG - Intergenic
1071588737 10:86850707-86850729 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1072026962 10:91468856-91468878 AGCCCAGGAATTCAAAACTGTGG + Intronic
1072071043 10:91917949-91917971 AGCCCAAGAGGTCAAGGCTGTGG - Intergenic
1073089812 10:100926229-100926251 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1073187049 10:101621448-101621470 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1073447146 10:103588520-103588542 AGCCCCTGACTTCAAAGAGCTGG - Intronic
1073531157 10:104232856-104232878 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1074703404 10:116111486-116111508 AGCCCAGGAATTCATAGCTGCGG - Intronic
1076026541 10:127119426-127119448 AGCCCCACACTTCACAGATGTGG - Intronic
1076396309 10:130139849-130139871 AGCCCAGGAGTTCCAAGCTGCGG + Intronic
1076479918 10:130778144-130778166 AGCCCTAGAATTGAAGGCTGTGG - Intergenic
1076591395 10:131586192-131586214 AGCTCCAGAGATCAAAGGTGGGG + Intergenic
1077326785 11:1967419-1967441 TTTCCCAGACTTCAGAGCTGAGG - Intronic
1078055036 11:8002370-8002392 AGCCCAGGAGTTCAAGGCTGTGG + Intergenic
1078250016 11:9609187-9609209 AGCCCAAGAGTTCAAGGCTGTGG + Intergenic
1079483596 11:20910330-20910352 AGCCCCAGACTTAAGGGATGGGG + Intronic
1080366798 11:31583522-31583544 AACCCCAGAGTTCAAAGATGTGG + Intronic
1080582917 11:33658232-33658254 AGCCCAAGACTTGGAAGCTCGGG - Intronic
1081165842 11:39808397-39808419 AGCCCCAGACTGCAAATGAGAGG - Intergenic
1081987235 11:47314527-47314549 AGCCCAGGAGTTCAGAGCTGTGG + Intronic
1082106144 11:48223895-48223917 AGCCCCAGAGTTCAAGGATGCGG - Intergenic
1082611259 11:55300845-55300867 AGCCCTGGAATTCAAGGCTGCGG - Intergenic
1082658663 11:55882843-55882865 AGCCCTGGAATTCAAGGCTGCGG + Intergenic
1083156501 11:60826608-60826630 AGCCCATGAGTTCAAGGCTGCGG + Intergenic
1083396002 11:62392489-62392511 AGCCCAGGAGGTCAAAGCTGAGG + Exonic
1083711824 11:64554418-64554440 AGGCCTGGGCTTCAAAGCTGGGG - Intergenic
1084057955 11:66649464-66649486 AGCCCAAGAGTTTCAAGCTGTGG + Intronic
1084318537 11:68360087-68360109 AGCCCAAGAAGTCAAGGCTGTGG - Intronic
1084385399 11:68840670-68840692 AGCCGCAGAACTCAAAGATGAGG - Intronic
1084791720 11:71479155-71479177 AGCCCCAGAGGTCCAGGCTGCGG - Intronic
1085072323 11:73558389-73558411 AGCCCAGGAATTCAAGGCTGCGG + Intronic
1086083270 11:82927871-82927893 AGCCCTGGACTTCATAGATGAGG + Intronic
1086696453 11:89852386-89852408 AGCCCTGGAATTCAAGGCTGTGG + Intergenic
1086709705 11:89992104-89992126 AGCCCTGGAATTCAAGGCTGTGG - Intergenic
1087053814 11:93911886-93911908 AGCCTTAGAATTCAAGGCTGTGG + Intergenic
1087078561 11:94148613-94148635 AGCACCAGACTTGAAAGGTCTGG - Intronic
1088480353 11:110291245-110291267 AGCCCCGGAGTTCAAAGCCCTGG + Intronic
1089309478 11:117548311-117548333 TGCCCCAAATCTCAAAGCTGGGG + Intronic
1089400300 11:118160579-118160601 GGGCCCAGTTTTCAAAGCTGAGG - Intergenic
1089503356 11:118946269-118946291 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1089991512 11:122865497-122865519 AGCCCTGGAGTTCAAGGCTGCGG - Intronic
1090697997 11:129268025-129268047 AGGCCCCAACTTCAATGCTGAGG + Intronic
1090938717 11:131368860-131368882 AGCCCAGGAGTTCAAAGTTGCGG + Intergenic
1091169455 11:133507311-133507333 AGCCCCAGGCTCCAAGGCAGTGG + Intronic
1202809766 11_KI270721v1_random:22599-22621 TTTCCCAGACTTCAGAGCTGAGG - Intergenic
1091985488 12:4907886-4907908 AGCCCAATACTTCAAGGTTGCGG + Intergenic
1092180941 12:6446377-6446399 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1093250442 12:16796700-16796722 AGCAAATGACTTCAAAGCTGAGG - Intergenic
1093436677 12:19142289-19142311 AGCCCAGGAACTCAAAGCTGAGG + Intronic
1094437703 12:30439695-30439717 AGACCCAGACTCCAATACTGAGG - Intergenic
1094533189 12:31296955-31296977 AGCCCAAAAGTTCAAGGCTGTGG + Intronic
1094756972 12:33482361-33482383 AGCCCCTGCCTTTATAGCTGAGG + Intergenic
1095787644 12:46127822-46127844 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
1096446266 12:51695304-51695326 AGCCCCAGACTTCAAAGCTGAGG + Intronic
1097210159 12:57361604-57361626 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1097293404 12:57939491-57939513 AGCCCAAGAATTCAAGGCTGTGG + Intergenic
1097728791 12:63104582-63104604 TGACAAAGACTTCAAAGCTGGGG - Intergenic
1098114943 12:67165156-67165178 AGCCCAGGAGATCAAAGCTGCGG - Intergenic
1098952893 12:76660029-76660051 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1099906665 12:88779384-88779406 AGCCCTGGAGGTCAAAGCTGTGG - Intergenic
1101538253 12:105640613-105640635 AGCCCAAGACTTCAAGAATGAGG - Intergenic
1102304375 12:111793295-111793317 AGCCCAGGAATTCAAGGCTGAGG - Intronic
1102631666 12:114286260-114286282 TGAGCCAAACTTCAAAGCTGAGG - Intergenic
1102844891 12:116169937-116169959 AGCCCAGTAGTTCAAAGCTGCGG + Intronic
1103932036 12:124455951-124455973 AGCCCTGGAGTTCAAGGCTGCGG - Intronic
1103981467 12:124739550-124739572 AGCCCAAGAGTTCCAGGCTGAGG - Intergenic
1105436654 13:20384789-20384811 AGCCCCAGAGGTTAAGGCTGTGG - Intergenic
1106207691 13:27615085-27615107 AACCCCAGATCCCAAAGCTGAGG + Intronic
1106464111 13:29997409-29997431 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
1106558770 13:30831678-30831700 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1106621059 13:31371485-31371507 AGCCCAAGAGTCCAAGGCTGCGG - Intergenic
1107167491 13:37299567-37299589 AGCCCCAATCTCCAAATCTGGGG - Intergenic
1107382443 13:39871303-39871325 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1108420261 13:50241133-50241155 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1112761812 13:102700224-102700246 AGCCCCAGGCTTCACTGCAGGGG + Intergenic
1112805953 13:103163990-103164012 AGCCTCAGACTTCTCAGCTGTGG + Intergenic
1114520820 14:23334376-23334398 AGCCCAGGAGTTAAAAGCTGCGG - Intergenic
1115566674 14:34630331-34630353 AGACCCAGACCTCATGGCTGGGG + Intergenic
1116216592 14:42024824-42024846 AGCCCTAGCCAGCAAAGCTGAGG - Intergenic
1117169841 14:53082845-53082867 AGCCCAAGAGTTCAAGACTGTGG - Intronic
1117896276 14:60490544-60490566 AGCCCAGGAATTCAAGGCTGTGG + Intronic
1119242741 14:73075082-73075104 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1119266918 14:73268256-73268278 AGCTCCAGACTTCAAATCTGAGG + Intronic
1119279641 14:73394484-73394506 GGCCCAGGAATTCAAAGCTGTGG - Intronic
1120815736 14:88856004-88856026 AGCCCCAGAGGGCAAGGCTGCGG + Intronic
1121054963 14:90844976-90844998 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1121073827 14:91050301-91050323 AGCCCAAGAGTTTGAAGCTGCGG + Intronic
1121353367 14:93192565-93192587 AGCCCAGGAGTTCGAAGCTGCGG + Intronic
1121946394 14:98126809-98126831 CTCCCCAGAATTCAAAGATGAGG + Intergenic
1122036381 14:98952000-98952022 AGCTCCTGGCTTCCAAGCTGGGG - Intergenic
1122421998 14:101583642-101583664 AGCCACAGACTTCCACGCTCAGG + Intergenic
1123755549 15:23395097-23395119 AGCCCCAGCCTCCAAAACTAGGG - Intergenic
1124377827 15:29139901-29139923 AGCCCCAGCCTGCAGAGCAGAGG - Intronic
1125161854 15:36653474-36653496 AACCCCAGACATGGAAGCTGGGG - Intronic
1125917392 15:43501277-43501299 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1126167220 15:45663687-45663709 AGCCCAGGAGTTCAAGGCTGTGG + Intronic
1127507174 15:59608734-59608756 AGGCCCCAACTTCAATGCTGGGG + Intronic
1127763717 15:62164979-62165001 AGCCCCAGCCTCCAAGGATGCGG - Exonic
1129501967 15:76048078-76048100 AGCCCAGGAGTTCAAGGCTGTGG + Intronic
1129551515 15:76455553-76455575 AGCACAAGAGTTCAAAGCTGTGG - Intronic
1129780737 15:78269036-78269058 AGGCCCAGACTGCAGAGTTGAGG + Intronic
1130584131 15:85166978-85167000 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
1130631914 15:85578203-85578225 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1130645972 15:85727447-85727469 AGCCCGAGAATTAAAAGGTGAGG + Exonic
1131213279 15:90516208-90516230 AGCCCAGGAGTTCAAGGCTGTGG + Intergenic
1131436377 15:92425976-92425998 AGCCCCAGATGTCAAAGCATTGG + Intronic
1132821355 16:1872894-1872916 AGCCCAGGAGTTCAAGGCTGTGG + Intronic
1133692935 16:8233892-8233914 ATCCCAAGAGATCAAAGCTGGGG + Intergenic
1133912308 16:10077355-10077377 AGCCCCTGACTTCGTTGCTGAGG + Intronic
1133984344 16:10656816-10656838 AGCCCAGGAGATCAAAGCTGTGG - Intronic
1134111290 16:11516893-11516915 AGCCTCAGCCTCCAAAGCTCTGG + Intronic
1134116360 16:11551752-11551774 AGCCCAGGAGATCAAAGCTGCGG + Intronic
1134146286 16:11765777-11765799 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1134460827 16:14427929-14427951 AGCCCCAGCCTCCAAAACTAGGG + Intergenic
1134655435 16:15944946-15944968 AGCCCCAGAGTTCCAGACTGCGG - Intergenic
1135100495 16:19601004-19601026 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1135705875 16:24674325-24674347 AGCCCAGGAATTCAAAGCTACGG + Intergenic
1138021236 16:53483458-53483480 AGCCCAAGAGTTCAAGGCTGCGG + Intronic
1138856618 16:60701363-60701385 AGCCCCAAACTCCAAGGCTTTGG - Intergenic
1139006923 16:62584223-62584245 ATCCCAAGAGTTCAAGGCTGCGG + Intergenic
1140448270 16:75049406-75049428 AGCCTCAGCCTTCCAAGCTCAGG + Intronic
1140711152 16:77678675-77678697 AGCCCAGGACATCAAGGCTGTGG + Intergenic
1141144975 16:81523002-81523024 AGCCTCAGAGGTCAAAGCTGCGG - Intronic
1141462326 16:84184845-84184867 AGCCCCAGAACTCAGAGGTGAGG - Exonic
1142484148 17:235945-235967 AGATCCAGGGTTCAAAGCTGGGG + Intronic
1142490509 17:275623-275645 AGCCCCAGAGGTCGAGGCTGCGG - Intronic
1142537038 17:625382-625404 AGCCCGGGAGTTCAAGGCTGGGG + Intronic
1143062253 17:4211779-4211801 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1143062258 17:4211806-4211828 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1143471772 17:7179772-7179794 AGCCCCAGGCTTCCCAGCTCTGG + Intergenic
1143477362 17:7210616-7210638 AGCCCCAGAATTGAGACCTGGGG + Intronic
1144302708 17:13937264-13937286 AGCCCAGGAATTCAAGGCTGCGG + Intergenic
1144404446 17:14939304-14939326 AGCCCAAGAGTTCAAAGTTATGG + Intergenic
1144459101 17:15443355-15443377 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1144643727 17:16954304-16954326 AGCCTGAGAGTTCAAGGCTGAGG + Intronic
1144674663 17:17154109-17154131 AGCAGGAGACGTCAAAGCTGTGG - Intronic
1145205058 17:20980083-20980105 AGCCTGAGAGTTCAAGGCTGAGG - Intergenic
1146048292 17:29529047-29529069 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1146612075 17:34315375-34315397 AACCCCATACTTCATAGATGAGG + Intergenic
1148325897 17:46783279-46783301 GGCCCCAGTCTTGACAGCTGGGG - Intronic
1148804033 17:50255125-50255147 AGCCCAAGAGGTCAAAGCTGAGG - Intergenic
1148918271 17:51003159-51003181 AGCCCAGGAGTTCAAGGCTGTGG + Intronic
1149455036 17:56780825-56780847 AGCCCCAGATTTGGAAACTGAGG + Intergenic
1149463312 17:56851988-56852010 AGCCCAAGAGTTCAAGGCTGCGG + Intronic
1149608127 17:57939340-57939362 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1149937529 17:60823484-60823506 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1150088268 17:62295064-62295086 AGCCCAGGAGTTCAAGGCTGTGG - Intergenic
1150270415 17:63860806-63860828 AGCCCCAGACCTCCCTGCTGGGG + Intergenic
1150706497 17:67491752-67491774 AGCCCAGGAATTCAAGGCTGCGG + Intronic
1150803834 17:68303200-68303222 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1151183783 17:72349085-72349107 AGCCCTTGACATCAGAGCTGGGG + Intergenic
1151412962 17:73943211-73943233 AGGCCCAGATTTCCAGGCTGAGG - Intergenic
1152022709 17:77789110-77789132 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1152224994 17:79088684-79088706 AGCCCCAGGCTTCTGAGCTCTGG + Intergenic
1152265096 17:79289472-79289494 TGCCCCTGACTTCAGAGCTGAGG + Intronic
1152352467 17:79791333-79791355 GGCCGCAGACTTCACAGCAGTGG - Intergenic
1152825299 17:82460990-82461012 AGCCTCAGAGGTCAAGGCTGCGG - Intronic
1153040367 18:807419-807441 GGCCCCAGAGGTCAAGGCTGCGG + Intronic
1153192914 18:2562293-2562315 AGCCCAAGAGTTCAAAGCCACGG + Intronic
1153483560 18:5572649-5572671 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1153826919 18:8883464-8883486 AGCCCAGGAGTTCAAGGCTGTGG - Intergenic
1154214094 18:12402749-12402771 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1155639920 18:28000537-28000559 AGAGCCAGAGTTCAAACCTGGGG + Intronic
1155682448 18:28505403-28505425 AGCCCAGGATTTCAAGGCTGTGG - Intergenic
1155825363 18:30435746-30435768 AGCCCGAGAGATCAAGGCTGTGG - Intergenic
1155844217 18:30685244-30685266 AGCCCAGGACCTCAAGGCTGTGG - Intergenic
1156550006 18:38005354-38005376 AGGCCCAGCATTCAAAGGTGGGG + Intergenic
1157852444 18:51068841-51068863 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1160031597 18:75266300-75266322 AGCCTCTGACTTCAATGCAGTGG + Intronic
1160889570 19:1370154-1370176 AGCCCGAGAGTTCAAGGCTGTGG + Intronic
1161179539 19:2870372-2870394 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1161673665 19:5629351-5629373 AGCCCAAGAGGTCAAGGCTGCGG + Intronic
1162041338 19:7972702-7972724 AGCCCAGGAGTTCACAGCTGTGG - Intronic
1162146141 19:8613032-8613054 AGCCCCAGACTTCACTGGGGTGG + Intergenic
1162414971 19:10530342-10530364 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1162492399 19:11001130-11001152 AGCCCAGGACGTCAAGGCTGCGG - Intronic
1163244582 19:16085329-16085351 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1164400283 19:27897371-27897393 TGCCCCAGCCTCCAAAGATGAGG - Intergenic
1164776781 19:30858933-30858955 AGCCCCAGGCCTCCAGGCTGTGG + Intergenic
1164990422 19:32678543-32678565 AGCCCAGGAGTTCAAGGCTGTGG - Intergenic
1165016836 19:32887293-32887315 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1165296044 19:34926800-34926822 AGCCATAGACCTCGAAGCTGGGG - Intergenic
1165315078 19:35049985-35050007 TGCCCCAGACTACAGAGCTATGG + Intronic
1165883178 19:39057757-39057779 ACCCCAAGACTTCAGAGGTGTGG + Intergenic
1166615248 19:44238361-44238383 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1166647479 19:44542962-44542984 AGACCCAGAGGTCACAGCTGGGG - Intergenic
1166806931 19:45493032-45493054 AGCCCCAGCCTGCAGCGCTGCGG + Intronic
1166938779 19:46350584-46350606 AGCCCCAGGCTCCAGGGCTGTGG + Intronic
1166965626 19:46528119-46528141 AGCCCCAGGCTCCAGGGCTGTGG - Intronic
1167153958 19:47726752-47726774 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1167467054 19:49655746-49655768 AGCCCGAGAGATCAAGGCTGAGG - Intronic
1167470207 19:49671558-49671580 AGCCCAGGAGTTCAAGGCTGTGG + Intronic
1167634036 19:50643294-50643316 AGCCCCAGAAGTCGAGGCTGTGG + Intronic
1168439241 19:56349330-56349352 AGCCAAAGCCTGCAAAGCTGAGG + Intronic
1168551259 19:57297410-57297432 AGCCCAAGAATTCAAAACTGAGG - Intergenic
925203442 2:1987503-1987525 GGCCCCAGACTTGAAAGCTGTGG - Intronic
925923860 2:8656868-8656890 AGCCCAGGAGTTCAATGCTGTGG + Intergenic
926388213 2:12359740-12359762 AGCCCCAGACTTATATACTGTGG + Intergenic
926965488 2:18405383-18405405 AGACCCAGACTACAAACTTGGGG + Intergenic
927210622 2:20636997-20637019 GGCCCCAGAGTACAGAGCTGGGG + Intronic
928378630 2:30799566-30799588 TGCCCCCAGCTTCAAAGCTGGGG + Intronic
928551224 2:32372750-32372772 AGCCCTGGAGGTCAAAGCTGTGG + Intronic
929030938 2:37649375-37649397 AGCCCAGGAATTCAAGGCTGCGG + Intronic
930168615 2:48229078-48229100 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
932640291 2:73439192-73439214 AGCCCAGGAATTCAAGGCTGTGG - Intronic
933275205 2:80276827-80276849 AGGCCCAGACTCCAAAATTGGGG + Intronic
933723179 2:85410936-85410958 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
933779573 2:85792128-85792150 ACCCCCAGACGGCCAAGCTGTGG - Intergenic
934721213 2:96578227-96578249 AGCCCGAGAGTTCAAAGCTTCGG - Intergenic
934970763 2:98762274-98762296 AGCCCCACACTTCAAAAATTAGG - Intergenic
937034195 2:118767028-118767050 AGTCCCAGTCTTCAACGCAGTGG - Intergenic
938876435 2:135536215-135536237 AGCCTCAGAGTTCAAGGCTGTGG - Intronic
939517280 2:143184757-143184779 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
939630901 2:144524665-144524687 CGCCCCAGCCTTCCAAGTTGAGG - Intergenic
939925475 2:148168663-148168685 AGCCCAAGAGGTCAAGGCTGTGG + Intronic
940262131 2:151792060-151792082 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
940614553 2:156034015-156034037 ATCCCATGACTTCAGAGCTGGGG + Intergenic
940780461 2:157928076-157928098 AGCCCATGAGTTCAAGGCTGCGG - Intronic
941388359 2:164880812-164880834 AGCTCAAGAGTTCAAGGCTGTGG - Intergenic
942549536 2:177100636-177100658 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
943736230 2:191358156-191358178 AGAGCCAGAATTCAAAGCTCTGG - Intronic
943757236 2:191569396-191569418 AGCCCAAGAATTCAAGGCTGCGG - Intergenic
945600431 2:211856295-211856317 TTCCCCAGACTTCACAGCTCTGG - Intronic
947397230 2:229698124-229698146 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
947452427 2:230220932-230220954 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
947770874 2:232669114-232669136 AGCAGCAGACTTCAGGGCTGCGG - Intronic
947863383 2:233378951-233378973 AGCCCAAGAGGTCAAGGCTGCGG + Intronic
948482987 2:238262031-238262053 AGCCCCAGACTGCTAGGCAGGGG - Intronic
1169944792 20:10977248-10977270 TGCCCTAGACTCCAAGGCTGAGG - Intergenic
1171279568 20:23884290-23884312 AGCCTTAGACATCAAAGCTGAGG - Intergenic
1172074405 20:32283112-32283134 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1172638613 20:36427103-36427125 AGCCCAGGAGATCAAAGCTGCGG + Intronic
1173333420 20:42094498-42094520 AGCCCAGGAGATCAAAGCTGTGG - Intronic
1173521369 20:43702717-43702739 AGCCCCCGACTTCAGTGCTGGGG - Exonic
1173959312 20:47058760-47058782 AGCCCAGGAATTCAGAGCTGTGG + Intronic
1173967035 20:47120296-47120318 AGCCCAGGAGTTCAAGGCTGTGG + Intronic
1174341738 20:49901364-49901386 AGCCCCGGTTTTCAAATCTGTGG - Intergenic
1174501228 20:50986203-50986225 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
1175662771 20:60830755-60830777 AGCCCAGGAGTTCAAGGCTGTGG - Intergenic
1176097055 20:63349091-63349113 AGCCCCACACGGCCAAGCTGGGG - Intronic
1176981663 21:15387874-15387896 AGCCCAGGATTTCAAGGCTGCGG + Intergenic
1178066945 21:28915001-28915023 AGCCCAGGAGTTCAAGGCTGGGG - Intergenic
1178406786 21:32331108-32331130 ACTCCCAGACTTCACAACTGGGG - Intronic
1178862699 21:36302570-36302592 AGCCCAGGAGTTCAAGGCTGAGG + Intergenic
1179058803 21:37960458-37960480 AGTCCCAGTCTCCAGAGCTGTGG - Intronic
1179187001 21:39092685-39092707 AGCCCAGCAGTTCAAAGCTGCGG + Intergenic
1180120521 21:45744270-45744292 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1180261515 21:46672750-46672772 AGCCCAAGAGTTCAAGGCTGCGG + Intergenic
1180632033 22:17236328-17236350 AGCCCAGGAGTTCAAGGCTGTGG + Intergenic
1182084486 22:27551871-27551893 GGCCCCACACTCCAACGCTGAGG - Intergenic
1182596568 22:31425516-31425538 AGCCCGGGAGTTCAAGGCTGCGG - Intronic
1182864297 22:33589187-33589209 AGACCAAGACTTCTTAGCTGTGG - Intronic
1184284660 22:43463407-43463429 AGCCCAGGAATTCAAAGATGTGG - Intronic
1185100326 22:48836859-48836881 CGCCCCAGACCTCAAAGCAGAGG - Intronic
949208504 3:1469885-1469907 AGCCTTAGACTTCACAGCAGTGG + Intergenic
949327660 3:2885220-2885242 AGCCACAATCTTAAAAGCTGTGG + Intronic
949352323 3:3136730-3136752 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
949957432 3:9280428-9280450 TGTCCCAGCCTTCAGAGCTGGGG + Intronic
950218182 3:11174715-11174737 ACCCCCAGCCTTCAAAGCACTGG - Intronic
952411865 3:33056489-33056511 AGCCCACGAGTTCAAGGCTGCGG - Intronic
952966593 3:38624752-38624774 AGCCCAAGATTTCAAGACTGCGG - Intronic
953328515 3:42032842-42032864 AGCCCGAGAGTTCAAGGCTGTGG + Intronic
953336603 3:42099135-42099157 GGTCCCAGACTTGAGAGCTGGGG + Intronic
953616470 3:44495030-44495052 AGCCCAGGAGTTCAAGGCTGAGG + Intergenic
954282809 3:49595567-49595589 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
955195797 3:56803722-56803744 AGCCCAAGAGTTCAAGGCTGTGG + Intronic
956024881 3:64972402-64972424 AGACTCAGAATTCAAAACTGGGG + Intergenic
956217631 3:66865550-66865572 AGCCCAGGAATTCAAAGCTGTGG - Intergenic
959205056 3:103297264-103297286 TGCCACAGACTTCAAAGTTTAGG - Intergenic
959447183 3:106454782-106454804 AGTCCCAGCCTGCAAGGCTGAGG + Intergenic
959769043 3:110071140-110071162 AGCCCCAAACTCCAACACTGGGG - Intergenic
959924307 3:111904504-111904526 TGCCCCAGATTGCAAAGCTCTGG + Intronic
960119082 3:113927981-113928003 ACCCCCACACTTCTAAACTGAGG - Intronic
960636997 3:119794085-119794107 AGCCCAGGAATTCAAGGCTGTGG - Intronic
961512759 3:127413167-127413189 ACCCCCAGTCTTCAATGCTGGGG + Intergenic
963138996 3:141932353-141932375 AGCCCAGGAGGTCAAAGCTGTGG + Intergenic
963434444 3:145250194-145250216 AACCCCAGGCTTCACAGCTTAGG - Intergenic
963910705 3:150815344-150815366 AGTCCCAGAGGTCAAGGCTGTGG - Intergenic
964095805 3:152929945-152929967 AGCCCAAGAGGTCAAGGCTGAGG + Intergenic
964357772 3:155866097-155866119 AACCCAAGACTTCAGAGTTGTGG + Intergenic
964437637 3:156671427-156671449 AGCCCAAGAGGTCAAGGCTGCGG - Intergenic
966664128 3:182451388-182451410 AGCCCCAGCCTGCTAATCTGCGG - Intergenic
967526338 3:190498150-190498172 AGACCCAGAACTCAAAGCTGAGG - Intergenic
968383421 4:113913-113935 AGCCCTGGAGTTCAAAGCTGTGG + Intergenic
968710842 4:2116152-2116174 AGGGACAGACATCAAAGCTGGGG - Intronic
968820694 4:2848544-2848566 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
969324355 4:6432303-6432325 AGCCCCAGAAGGCAGAGCTGTGG - Intronic
972956674 4:44400912-44400934 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
973773061 4:54224158-54224180 AGCCCAAGAGTTCGAGGCTGAGG - Intronic
974099707 4:57403242-57403264 AGGCCCAGCCGTCAAACCTGCGG - Intergenic
974857016 4:67473628-67473650 AGCCCAGGAGTTCAAAGTTGCGG - Intronic
978075638 4:104526130-104526152 AGCCCAAGAGTTCAAGGCTGTGG - Intergenic
978410196 4:108417198-108417220 AGCCCCAGACCTCAGGTCTGTGG + Intergenic
978796876 4:112716641-112716663 AGCCCAGGAGTTCAAGGCTGTGG - Intergenic
980107775 4:128604191-128604213 AGCCCAGGACTTCAAGGCAGAGG + Intergenic
980867993 4:138576366-138576388 TATCCCAGACCTCAAAGCTGAGG + Intergenic
981582113 4:146260457-146260479 AGCCTCAGTCCTCAAATCTGGGG - Intronic
984330082 4:178303371-178303393 AGCCCAGGAATTCAAGGCTGTGG - Intergenic
984711588 4:182889938-182889960 AGCCCCAGACATCAACCCTGGGG + Intergenic
985690328 5:1306241-1306263 AGCCCAAGAGTTCAAGGCTACGG - Intergenic
986181076 5:5393434-5393456 AGTCCCAAACTTCAAAGGTAGGG + Intergenic
986345063 5:6827051-6827073 ATCCGCAGGCTCCAAAGCTGGGG - Intergenic
987058905 5:14223130-14223152 TGCCCAAGATTCCAAAGCTGGGG - Intronic
987707053 5:21471086-21471108 AGTCCCAAACTTCAAAGGTAGGG - Intergenic
987711055 5:21500837-21500859 AGTCCCGGAGGTCAAAGCTGTGG - Intergenic
987795934 5:22626464-22626486 AGCCCAAGAGTGCAGAGCTGAGG + Intronic
988749089 5:34176777-34176799 AGTCCCGGAGGTCAAAGCTGTGG + Intergenic
990427705 5:55704226-55704248 AGCACCAGAATTAAAAGCTTAGG + Intronic
991761393 5:69919878-69919900 AGTCCCGGAGGTCAAAGCTGTGG - Intergenic
991785936 5:70198222-70198244 AGTCCCGGAGGTCAAAGCTGTGG + Intergenic
991840621 5:70794926-70794948 AGTCCCGGAGGTCAAAGCTGTGG - Intergenic
991878380 5:71198613-71198635 AGTCCCGGAGGTCAAAGCTGTGG + Intergenic
991904285 5:71493335-71493357 AGCCCAAGAGTTCAAGGTTGTGG - Intronic
992071436 5:73152713-73152735 GGCCACAGGCTTCAAGGCTGTGG - Intergenic
993610674 5:90050356-90050378 AACCCCAGACACCAAAGCTTGGG + Intergenic
993632547 5:90303549-90303571 AGCCCCAAACTTCAAATTGGAGG - Intergenic
993839417 5:92858532-92858554 AGCCCAAGAGGTCAAGGCTGCGG + Intergenic
993983679 5:94572008-94572030 AGCCCAAGAGTTCAAGCCTGTGG + Intronic
994373927 5:98996937-98996959 AGCCCAAGAGGTCAAGGCTGTGG - Intergenic
996422370 5:123277159-123277181 AGCCTCAAACTTCCAACCTGTGG + Intergenic
997777390 5:136623227-136623249 AGCCTTAGATTTAAAAGCTGAGG + Intergenic
999276562 5:150334710-150334732 AGCCAAAAACTTCAAAGCTATGG + Intronic
999315535 5:150581122-150581144 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
999890553 5:155974631-155974653 TGCCCCAGACATCATAGGTGGGG + Intronic
1000064586 5:157683634-157683656 AGGCCAAGACTTCAAGACTGTGG - Intergenic
1000811585 5:165869700-165869722 AGCCTAAGATTGCAAAGCTGAGG + Intergenic
1000944967 5:167410950-167410972 AACCCCACACTTGAAACCTGAGG + Intronic
1001141980 5:169152148-169152170 GCCCCCTGACTTCAAACCTGGGG - Intronic
1001196830 5:169680641-169680663 AGCCCAAGAGTTCAAGGCTGTGG + Intronic
1001720435 5:173852594-173852616 AGCCCAGGAGTTCAAGGCTGTGG + Intergenic
1001808564 5:174609560-174609582 CGCCCCTGACTGCAAAGCTTTGG + Intergenic
1002102918 5:176866236-176866258 AGCCCCTCACATCAAAGATGGGG + Intronic
1002562757 5:180093415-180093437 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
1002866920 6:1129970-1129992 AGCCCAGGAGTTCAAGGCTGTGG + Intergenic
1002882455 6:1264933-1264955 AGCCCAGGAGTTCAAGGCTGAGG + Intergenic
1005343420 6:24865023-24865045 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1005425514 6:25699101-25699123 AGCCCCTGAAATCAAACCTGCGG + Intronic
1005546636 6:26879660-26879682 AGTCCCGGAGGTCAAAGCTGTGG + Intergenic
1005788436 6:29271220-29271242 AGCCCCAACCTTTAAATCTGAGG + Intergenic
1005925143 6:30438240-30438262 AGCCCAAGAAGTCAAAGCAGCGG + Intergenic
1007322472 6:41037583-41037605 TGCCCCAGTCTTCAATCCTGAGG - Intronic
1008432413 6:51434747-51434769 AGGCCCACACTTAAAACCTGAGG + Intergenic
1008601176 6:53096826-53096848 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1008606198 6:53141924-53141946 AGCCCGGGAATTCAAGGCTGTGG + Intronic
1009017390 6:57920745-57920767 AGTCCCGGAGGTCAAAGCTGTGG + Intergenic
1009021171 6:57949422-57949444 AGTCCCAAACTTCAAAGGTAGGG + Intergenic
1010024519 6:71200442-71200464 AACCCCACACTTCATAGATGAGG + Intergenic
1010272203 6:73927293-73927315 AGACCCAGAGAACAAAGCTGGGG + Intergenic
1010409173 6:75541314-75541336 AGCCCAGGAGTTCAAGGCTGTGG - Intergenic
1011962400 6:93107324-93107346 AGCTCGAGAGTTCAAGGCTGCGG - Intergenic
1012279343 6:97310408-97310430 AGCCCCAGAATTAAAATCTATGG - Intergenic
1012541205 6:100364127-100364149 AGCACCAGGATTGAAAGCTGGGG - Intergenic
1013285190 6:108675246-108675268 ATCCTCATACTTCATAGCTGAGG - Intronic
1013548171 6:111180727-111180749 AGCCCAGGAGTTCAAGGCTGTGG + Intronic
1013771045 6:113628797-113628819 AGCCCAGGAATTCAAGGCTGTGG - Intergenic
1013776081 6:113679612-113679634 AGCCCAGGAGTTCAAGGCTGTGG + Intergenic
1014489233 6:122041959-122041981 AGGCAAAGACTTCAAAGTTGAGG - Intergenic
1014814621 6:125921721-125921743 AGCCCTATACATCAAAGCTATGG - Intronic
1015099229 6:129455152-129455174 AGCCCAGGAATTCAAGGCTGTGG + Intronic
1015723799 6:136277602-136277624 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1016383471 6:143508965-143508987 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1017024997 6:150173796-150173818 AGCCCAAGACTGCAGACCTGAGG + Intronic
1018006427 6:159626602-159626624 AGCCCAGGAGGTCAAAGCTGTGG - Intergenic
1019356331 7:581791-581813 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1019671342 7:2281339-2281361 AGCCCAAGAGTTCACGGCTGCGG + Intronic
1019688645 7:2397003-2397025 AGCCCAAGAGTTCAAGGCTGGGG - Intergenic
1020022675 7:4878424-4878446 AGCCTCAGCCTTCAGAGCAGTGG - Intronic
1021611141 7:22459241-22459263 AGCCCCAAGCTTAAAAGCTGAGG - Intronic
1021741867 7:23695045-23695067 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1021976768 7:26018815-26018837 AGCCCTAGACTTAAAATCAGAGG - Intergenic
1022390446 7:29939289-29939311 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1023679904 7:42674860-42674882 ACCCCCAGAAATCTAAGCTGGGG + Intergenic
1024853080 7:53744187-53744209 AGCGCCAGCCTGCAAAGCTCAGG - Intergenic
1025092447 7:56075018-56075040 AGCCTAGGAGTTCAAAGCTGCGG + Intronic
1026480774 7:70777404-70777426 AGCCCAGGAATTCAAGGCTGTGG - Intronic
1026586189 7:71657980-71658002 AGCCCATGAATTCAAGGCTGCGG - Intronic
1026715132 7:72782209-72782231 AGCCCAGGAGTTCAAGGCTGTGG + Intronic
1027157284 7:75777669-75777691 AGCCCAGGAGTTCAAAGCTCAGG + Intronic
1027361503 7:77415561-77415583 AGCCCCAGCCTGCACAGGTGCGG + Intronic
1027555003 7:79653080-79653102 AGCAACAGAGATCAAAGCTGAGG + Intergenic
1029208677 7:98886977-98886999 AGCCCAGGAGTTCAATGCTGTGG - Intronic
1029231387 7:99071999-99072021 AACCCAAGAGTTCAAGGCTGCGG + Intronic
1029365771 7:100115202-100115224 AGCCCAAAACTTCAAAGTGGTGG - Intronic
1029588274 7:101489506-101489528 AGCCCAGGAGTTCAAAGCTGAGG - Intronic
1029877269 7:103767373-103767395 AGGCCTAGAATTCAAAGCTCTGG - Intronic
1031611206 7:123829751-123829773 AGCCCAGGAGTTCAAAGCTGTGG + Intronic
1031738984 7:125403639-125403661 CTCCCCACACTTCAAAGCAGTGG - Intergenic
1031970257 7:128059892-128059914 AGCCCCAGTCCCCACAGCTGGGG - Intronic
1032007343 7:128313676-128313698 AGGCCCAGCCTTCAACACTGGGG - Intronic
1032997850 7:137467904-137467926 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1033121352 7:138669328-138669350 AGCCCAGGAGTTCAAAGCTGCGG + Intronic
1033349775 7:140552781-140552803 AGCCCAAGAGTTCGAGGCTGTGG - Intronic
1033374563 7:140745548-140745570 AGTCCCAGAATTTGAAGCTGGGG - Intronic
1035431317 7:158824950-158824972 AGCCCAAGAGTTCAAGCCTGGGG + Intronic
1036745870 8:11408929-11408951 AGCCCAAGAATTCAAGGCTACGG + Intronic
1036823132 8:11955601-11955623 AGCCACAGCCTTCAAATCAGAGG - Intergenic
1037239713 8:16762747-16762769 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1037537571 8:19839618-19839640 AGCCCAGGAGGTCAAAGCTGTGG + Intronic
1038288193 8:26225283-26225305 AGCCCAGGAGTTCAAGGCTGCGG - Intergenic
1039191884 8:34985343-34985365 AGCCCAGGAATTCAAGGCTGAGG + Intergenic
1039507382 8:38061724-38061746 AGCCCAGGAGTTCAAAGCTGTGG + Intergenic
1039728877 8:40253056-40253078 AGCTCCTGACTTCCAAGCTGAGG - Intergenic
1039821760 8:41141231-41141253 AGCCCAAGAAGTCAAGGCTGCGG - Intergenic
1039968485 8:42300930-42300952 AGCCCAGGAATTCAAGGCTGCGG - Intronic
1040289213 8:46115802-46115824 AGCCCCAGGCTTTAAAGAGGAGG - Intergenic
1041644679 8:60239179-60239201 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1041724658 8:61006729-61006751 AGGCTCAGGCTTCAAACCTGTGG - Intergenic
1044248680 8:89981410-89981432 ATCCCCCGACTTCAAAGTTCGGG + Exonic
1045189947 8:99872319-99872341 AGCCACAGAATACAAAGCAGTGG - Intronic
1047332445 8:123903968-123903990 CTCCCCACACTTCAAAGCAGAGG + Intronic
1047485955 8:125330831-125330853 AACCCCACACTTGACAGCTGGGG - Intronic
1047510365 8:125511220-125511242 AGCCCCAGACCACACAGCTAAGG - Intergenic
1047926617 8:129688768-129688790 AGGCCCAGAACACAAAGCTGGGG + Intergenic
1047938651 8:129806492-129806514 AGCCCAAGAGTTCAAGGCTGTGG - Intergenic
1049546758 8:143235648-143235670 AGCCCCAGACGACACAGCTCCGG - Intergenic
1050149225 9:2602408-2602430 AGCCCAGGAGTTCAAGGCTGTGG - Intergenic
1050301121 9:4259968-4259990 AGCCCTAGACTTCCAAGAAGTGG + Intronic
1050361068 9:4831552-4831574 AGCCCAGGACTTCAAGGCTTTGG - Intronic
1051082906 9:13313531-13313553 AGCCCCAGAAGTCAATGCTGTGG - Intergenic
1051627446 9:19111810-19111832 AGCCCAGGAGTTCAAGGCTGCGG - Intronic
1051781181 9:20690624-20690646 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1052966274 9:34342946-34342968 AGCCCAGGAATTCAAGGCTGCGG + Intronic
1053074510 9:35121521-35121543 AGCCCAGGAATTCAAGGCTGTGG - Intergenic
1053362074 9:37495505-37495527 AGCCCCACAGGTCTAAGCTGTGG - Intronic
1056328636 9:85503244-85503266 AGCCACAGACCTCCCAGCTGAGG - Intergenic
1056421014 9:86426182-86426204 AGCCCAGGAGTTCAAGGCTGCGG + Intergenic
1056999173 9:91491840-91491862 TGACCCACACTTCAGAGCTGGGG - Intergenic
1057380141 9:94560045-94560067 AGCCCCGGAGTTCAAGGCTGCGG + Intronic
1058537621 9:105978307-105978329 AGACTCAGACTTCACAGATGAGG + Intergenic
1058929743 9:109707378-109707400 AGTGCCTGACTTCAAAGCTGGGG - Intronic
1060195892 9:121623153-121623175 AGCCCCAGATTGCCAAGCCGGGG + Intronic
1060520023 9:124289056-124289078 AGCCCAGGAGTTCAAGGCTGTGG - Intronic
1187883727 X:23869537-23869559 AGCCCAGGAGTTCAAGGCTGCGG + Intronic
1189535700 X:41933373-41933395 AGCCCAGGAGTTCAAGGCTGTGG + Intergenic
1190958919 X:55226143-55226165 GGCTTCAGTCTTCAAAGCTGAGG - Intronic
1191221870 X:57998255-57998277 AGCCCCAGGCTGCACAGCTCAGG + Intergenic
1192122822 X:68473175-68473197 AGCCCAGGAATTCAAGGCTGTGG + Intergenic
1196818753 X:119686259-119686281 AGCGCCAGTGTTCAGAGCTGGGG + Intronic
1197147163 X:123183782-123183804 AGCCCCGGACTGCAAAGCCTAGG - Intergenic
1197791750 X:130261903-130261925 AGCCCAAGAGTTCAAGGCTGTGG - Intronic
1199567624 X:149231934-149231956 AGCATCAGACTTCAAGGCTCAGG + Intergenic