ID: 1096446581

View in Genome Browser
Species Human (GRCh38)
Location 12:51698336-51698358
Sequence CACCCTTCAAAGCCAGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096446581 Original CRISPR CACCCTTCAAAGCCAGGATT AGG Intronic
901433229 1:9230925-9230947 CCACCTTCAAAGCCAGCAATGGG - Intergenic
901884912 1:12216057-12216079 CCCCCTTCATAGGCAGGAATTGG - Intergenic
902821976 1:18949029-18949051 CACCCTGCACTGCCAGGCTTGGG + Intronic
903419245 1:23206661-23206683 CACCCTTCAGAGCTAGGCTCTGG + Intergenic
906553482 1:46687443-46687465 CACCCTTCAAAGCCAAGTCCAGG + Intronic
906727598 1:48055286-48055308 CACCCGTGAGAGCCAGGCTTGGG - Intergenic
908402188 1:63781919-63781941 CAGTCCTAAAAGCCAGGATTAGG - Intronic
910825733 1:91405003-91405025 GACCCTTAGAACCCAGGATTAGG - Intergenic
912728381 1:112079202-112079224 CAGACTCCAAAGCCAGGATACGG - Intergenic
915146162 1:153796796-153796818 CACCCTTCAACACCCGGCTTGGG - Intergenic
916749856 1:167714221-167714243 CCCCTTTCTTAGCCAGGATTCGG + Intergenic
916770032 1:167899034-167899056 CACCCTCCTAACCCAGGATGAGG - Intronic
921632741 1:217454926-217454948 CACCATTAAAAACAAGGATTTGG - Intronic
922538800 1:226403471-226403493 CACTCTGTAAAGCCAGGACTGGG - Intronic
923832570 1:237574307-237574329 AACCATTCAAAATCAGGATTGGG + Intronic
1062798064 10:358933-358955 TAGCCTTCAAACCAAGGATTAGG - Intronic
1065095578 10:22277668-22277690 CACCTTTCAGATACAGGATTCGG + Intergenic
1066044453 10:31583576-31583598 CACCCTGCAGAGCCAGGACAGGG - Intergenic
1066670160 10:37828584-37828606 TACTCTGCAGAGCCAGGATTGGG + Intronic
1067478466 10:46580924-46580946 AACCCTTCAAGGCCGAGATTGGG + Exonic
1067616271 10:47760877-47760899 AACCCTTCAAGGCCGAGATTGGG - Intergenic
1069888955 10:71641183-71641205 CACACTGCATAGCCAGGGTTGGG - Intronic
1070189705 10:74100775-74100797 GATCCATCAAGGCCAGGATTTGG + Intronic
1072162919 10:92784983-92785005 CTCCATTGAAAGCAAGGATTTGG + Intergenic
1073101313 10:101008207-101008229 CAACCTCCCAAGCCAGGATAGGG - Intronic
1074973384 10:118561439-118561461 CACCCACTAAAGCCAGGAGTAGG + Intergenic
1075520931 10:123143115-123143137 CACACCTCAAAGCCCGGGTTAGG - Intergenic
1081570866 11:44289987-44290009 CTCCCTTCACAGCCAAGATGCGG + Intronic
1084754361 11:71225604-71225626 CACCCATCAAACCAAGGATCAGG + Intronic
1085591262 11:77763449-77763471 CAGCATTCAAATCCAGGACTTGG - Intronic
1087607355 11:100393088-100393110 CATCCTTCAAAACCAAGATAGGG + Intergenic
1088420869 11:109645141-109645163 GACCCTTAAAAGGCAGGTTTGGG - Intergenic
1089609165 11:119660063-119660085 CATCCTCCACACCCAGGATTGGG - Intronic
1090413918 11:126527838-126527860 CTCCCTCCAAGGCCAGGCTTGGG - Intronic
1090714805 11:129421045-129421067 CAACCTTCATAGACAGGATTTGG + Intronic
1095926642 12:47585527-47585549 CAGCCTTCAATGCCAGGCTGGGG + Intergenic
1096446581 12:51698336-51698358 CACCCTTCAAAGCCAGGATTAGG + Intronic
1102123326 12:110460495-110460517 CATCCTTCTAACCCAGGATAAGG - Intronic
1103153986 12:118667649-118667671 CACCATTCAATGCCAGTACTAGG - Intergenic
1103319067 12:120080079-120080101 CACCCTACACAGCCAGGCTCTGG + Intronic
1104959700 12:132482814-132482836 CAGCATTCAAAGCCAGGAGTGGG + Intergenic
1106784480 13:33093099-33093121 GAGCCTCCAAAGCCAGGTTTGGG + Intergenic
1110067945 13:71132559-71132581 CACCCTTAGAAGCTAGGAATAGG + Intergenic
1112608525 13:100931827-100931849 CAACCTACAAAGACAGCATTCGG + Intergenic
1113867141 13:113534063-113534085 GACCAATCAAAACCAGGATTCGG - Exonic
1114947215 14:27698258-27698280 CTCCCTTCAGTGCCAGCATTTGG - Intergenic
1116871081 14:50069734-50069756 CATCTCTCAAATCCAGGATTGGG - Intergenic
1120448877 14:84640252-84640274 CTCCCTTCAAAGAAAGCATTTGG - Intergenic
1122487909 14:102094136-102094158 CATCCTTCAAAGGCCGGCTTGGG + Intronic
1123675419 15:22706416-22706438 GCTCCTTCAAAGACAGGATTGGG + Intergenic
1124327411 15:28779372-28779394 GCTCCTTCAAAGACAGGATTGGG + Intergenic
1124769233 15:32516315-32516337 GCTCCTTCAAAGACAGGATTGGG - Intergenic
1124815252 15:32984221-32984243 CAGCCTCCAATGCAAGGATTAGG + Intronic
1126290759 15:47074883-47074905 CACCCTTCCAAGCAAGAGTTAGG + Intergenic
1128335713 15:66784543-66784565 CACCCTGCAATGCCTGGATGTGG + Intergenic
1128724868 15:69981059-69981081 CAGCCTTGAATGCCAGGATAAGG - Intergenic
1129178169 15:73854991-73855013 CAGCCTCTAAAGCCAGGACTGGG - Intergenic
1131748393 15:95476489-95476511 CTCCCTTCAAAGCCAGCAAGAGG + Intergenic
1131866387 15:96715786-96715808 CACCCTTCAAATACAGTAGTTGG - Intergenic
1133891091 16:9879668-9879690 TAAATTTCAAAGCCAGGATTTGG - Intronic
1135122810 16:19781094-19781116 CACCCTTTAAATCCAGGAGAGGG + Intronic
1138081870 16:54098230-54098252 CACAGTTCAAATTCAGGATTAGG - Intronic
1140752633 16:78039779-78039801 CAGCCTTGAATGCCAGGGTTAGG - Intronic
1141172118 16:81698010-81698032 CACCCTACAATGTGAGGATTCGG + Intronic
1141639128 16:85330948-85330970 CACATTTCAAAGCCTGGCTTTGG + Intergenic
1141879796 16:86850274-86850296 CCCCTCTCAAAGCCAGGACTTGG + Intergenic
1142284709 16:89167022-89167044 CACCCTCCAAAGACAGGCTGTGG - Intergenic
1142786876 17:2231395-2231417 CACCATTCAAAGCAAGCATAAGG + Intronic
1146612044 17:34314842-34314864 CACTCTTCAAAGCAAGTTTTGGG + Intergenic
1146749017 17:35360556-35360578 CACCCTGAAAAGCCATTATTTGG + Intronic
1152356115 17:79808373-79808395 CTCCCTGCAAAACCAGCATTCGG + Intergenic
1153518892 18:5933430-5933452 AACCCTTCAATGCCAGCACTCGG - Intergenic
1155168108 18:23247442-23247464 GCCCCTTCCAAGCCAGGATCTGG + Intronic
1157643910 18:49247111-49247133 CTCCCTTCAAAGCAAAGGTTGGG + Intronic
1158156827 18:54435414-54435436 CAGCCATCAAAGCCACGATGAGG - Intergenic
1158956675 18:62546854-62546876 CACCCTGCTTAGCCAGTATTTGG + Intronic
1160183524 18:76656452-76656474 GACTTTTCCAAGCCAGGATTGGG - Intergenic
1161772293 19:6237299-6237321 CTCCCCTCACATCCAGGATTGGG - Intronic
1164473196 19:28552881-28552903 CAGCTGCCAAAGCCAGGATTCGG - Intergenic
1167758181 19:51426434-51426456 CACCCTGCACAGCCAGGCTCAGG + Intergenic
1168625551 19:57915265-57915287 AAACCTTAAAAGCCTGGATTTGG + Intronic
925388940 2:3482652-3482674 CACTCTCCACAGCCAGGGTTGGG - Intronic
926592940 2:14759018-14759040 CACTCACCAAAGCCAGGATTGGG + Intergenic
928430263 2:31212499-31212521 CACCAAAGAAAGCCAGGATTTGG - Intronic
931239211 2:60437637-60437659 CACCCTTCAAAGGAAGCACTTGG + Intergenic
932148836 2:69349776-69349798 CTCCCTTCAAAACCTGGATAAGG + Intronic
932317542 2:70795937-70795959 TCCCCTTCCAAGGCAGGATTCGG - Intergenic
932715846 2:74100388-74100410 CACCCTTCAGAGACAGGCCTGGG - Exonic
935359631 2:102236446-102236468 AACTCTTCAAAGACAGGAGTGGG - Intronic
936003207 2:108856128-108856150 AAACCTGCAAGGCCAGGATTGGG - Intronic
937720228 2:125086457-125086479 CAACCTACAAAGCCAGAATTTGG - Intergenic
939152946 2:138494662-138494684 CCCCCTTCAAAGCCCTGATCTGG - Intergenic
939291376 2:140199718-140199740 CACCCTTCAGAACCATGACTTGG - Intergenic
941585672 2:167355020-167355042 CATCCTTCATGGCCAGGATCAGG + Intergenic
941716126 2:168765205-168765227 CATCTTTCAAAACCAAGATTCGG - Intronic
942759601 2:179382915-179382937 CACCCATCAAAGCCAAGACTGGG + Intergenic
945644840 2:212478333-212478355 CACCTTTCCAAGCCAGGCCTGGG - Intronic
946617370 2:221524274-221524296 CACCCTTTAATGCTAGGCTTCGG + Intronic
948805365 2:240451593-240451615 CACTCTTCGAACCCAGGATGAGG - Intronic
948830563 2:240596564-240596586 GGCCCTTCCAAGGCAGGATTTGG + Intronic
1168774779 20:438523-438545 CACCCTTCCATGGAAGGATTGGG - Exonic
1170475615 20:16711222-16711244 CACCCTTGAAAACCAGCACTTGG + Intergenic
1170654233 20:18271030-18271052 CAGCCCTCAAAGCCAGGTCTAGG - Intergenic
1172979715 20:38931717-38931739 CAGGCTGCAAAGCCAGGATTAGG - Intronic
1173062340 20:39674671-39674693 AACCCTTCAAAGCCAGGATAAGG + Intergenic
1173940230 20:46904716-46904738 CACCATTCAAAGCCAGGGTTGGG - Intronic
1174858949 20:54072016-54072038 CACCCTGCAAAACGAGGATGGGG + Intergenic
1175958810 20:62624664-62624686 CACACCTCAGAGCCAGGATGAGG + Intergenic
1176205045 20:63883682-63883704 CACCCATCTTTGCCAGGATTGGG - Intronic
1177795058 21:25767162-25767184 TACCTTTTAGAGCCAGGATTTGG + Intronic
1177870778 21:26570483-26570505 CAGGCTACAAAGACAGGATTCGG - Intronic
1179562440 21:42224196-42224218 CCCCCTCCAAAGCCCAGATTTGG + Intronic
1183671917 22:39278092-39278114 CACCCCTGAAAGGCAGGATGTGG + Intergenic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1185082517 22:48717856-48717878 CACCCTGGAGAGCCAGGCTTAGG + Intronic
950526952 3:13529759-13529781 CACCCTACAGAGCCCGGTTTAGG - Intergenic
951694478 3:25431445-25431467 AAGCATTCAAAGTCAGGATTAGG + Intronic
952457721 3:33489503-33489525 CACCCTGCCCATCCAGGATTTGG + Intergenic
952495289 3:33910603-33910625 CACCCTTCAGAGGCAGGGGTGGG + Intergenic
952835314 3:37597073-37597095 CAACCTTCAAAGCCTGAAGTAGG + Intronic
954360709 3:50121380-50121402 CACCGTTCAAATTCAAGATTTGG - Intergenic
955099668 3:55834793-55834815 AACCCTTCAAAACCAGGAGCTGG + Intronic
966691230 3:182743513-182743535 CATCCTCCAAAACCAAGATTAGG + Intergenic
969134952 4:5021945-5021967 CACTCTACCAAGCCAGGAGTGGG + Intergenic
972631370 4:40844636-40844658 CACCTATCAAAGCCAGGCTTGGG + Intronic
973744883 4:53954371-53954393 CTCATTTTAAAGCCAGGATTAGG - Intronic
975418864 4:74139010-74139032 CACCTTCCCCAGCCAGGATTAGG + Intronic
977426641 4:96874957-96874979 CACCCTCCAAAACCAGGAAGGGG + Intergenic
983267111 4:165518946-165518968 AACTCTCCAAAGACAGGATTTGG - Intergenic
984683917 4:182644429-182644451 CACACTTAAAAGCCAGCATGTGG - Intronic
984881558 4:184413973-184413995 CACCCCTCAAGGCCTGGCTTAGG + Intronic
985379505 4:189377415-189377437 CACCTTTCAAGGGGAGGATTAGG + Intergenic
985511700 5:317464-317486 GACCCTTCAGAGCCTGGGTTTGG + Intronic
985665934 5:1181545-1181567 CAGCCTTCAAGGCCAGGACTGGG - Intergenic
987144919 5:14982654-14982676 CACCTTGCAAAGGCAGGAATGGG - Intergenic
990654504 5:57940148-57940170 CACCCATCTAAGCCAGGTTCTGG - Intergenic
992184321 5:74229236-74229258 CACCTTTAAAAACCAGGGTTGGG + Intergenic
993764219 5:91835391-91835413 CCCCCTTCTAAGCCAAGATATGG - Intergenic
997471538 5:134120076-134120098 CCCCCTTCACAGCCAGGGCTGGG - Intronic
997671420 5:135677653-135677675 CACCCTTCACTTCCAGGTTTAGG + Intergenic
998528450 5:142863666-142863688 CACCCTCCAAGGCAAGGGTTTGG - Intronic
1000323664 5:160155636-160155658 CAGGCTTTAAAACCAGGATTGGG - Intergenic
1000610605 5:163369444-163369466 AAGGCTTCAGAGCCAGGATTTGG + Intergenic
1004079290 6:12375344-12375366 CAAACTGTAAAGCCAGGATTTGG + Intergenic
1005226521 6:23649759-23649781 CACCCTTCACAGGCTGGACTGGG + Intergenic
1012019885 6:93905182-93905204 CACCCTGCAAAGCCATGGCTTGG + Intergenic
1013765465 6:113569210-113569232 CACTTTTCAAAGACAGGTTTAGG + Intergenic
1015739057 6:136433840-136433862 CCCACTTCAAAGCCAGAATCAGG + Intronic
1015938605 6:138426747-138426769 CACCCTTCAGACCCTGTATTGGG - Intronic
1020258236 7:6514647-6514669 TACCCTTCAAAGACAGAAGTGGG + Intronic
1021821657 7:24504332-24504354 CACCGTGCCAGGCCAGGATTTGG - Intergenic
1022352544 7:29579490-29579512 GACCCTTTGAAGCCTGGATTTGG - Intergenic
1023224977 7:37959838-37959860 CACCTTTCAAAGCCTGGAAATGG - Intronic
1024049834 7:45611409-45611431 CACTGCTCAAAGCCAGGTTTAGG - Intronic
1027222572 7:76223421-76223443 CTGGCTTCAATGCCAGGATTTGG + Intronic
1029582927 7:101449279-101449301 AGCCCTTCAATGCCAGGACTTGG + Intronic
1030083554 7:105798271-105798293 CCCCCTTCAGAGCCAGTGTTTGG + Intronic
1032077932 7:128844893-128844915 CGCCCTTCAAAGCCACCATTCGG + Exonic
1032323179 7:130902539-130902561 ACCCCTTAAAAGCCATGATTAGG - Intergenic
1034121159 7:148628978-148629000 AATCCCTCAGAGCCAGGATTTGG - Intergenic
1035677074 8:1463470-1463492 CACCGTCCAAAGCCAGGGTCAGG + Intergenic
1041794243 8:61729431-61729453 CACCCTTCAAAGGCAGTCTGAGG + Intergenic
1045166489 8:99612167-99612189 CAGTCTCTAAAGCCAGGATTAGG - Intronic
1045237718 8:100369747-100369769 CAGCTTTCAAAGGAAGGATTTGG + Intronic
1045520370 8:102897890-102897912 CAGCCAAGAAAGCCAGGATTTGG + Intronic
1048623755 8:136162222-136162244 ACCCATTCAGAGCCAGGATTTGG - Intergenic
1049607528 8:143536620-143536642 CACCCTCCACAGCCAGGCTGAGG + Intronic
1056244490 9:84680700-84680722 CTCCCTTCAAAGCCAGATCTTGG + Intronic
1058655762 9:107219111-107219133 CACCCTTCAAGGCCATGCCTGGG + Intergenic
1058915409 9:109559895-109559917 TACCCTTCAGGCCCAGGATTGGG - Intergenic
1059897734 9:118886735-118886757 CACCCTTCAAAACACGGCTTGGG - Intergenic
1061410963 9:130421463-130421485 CCCCCTACAAGGCCAGGATTGGG - Intronic
1185595221 X:1302223-1302245 CTCTCTTCAAAGCCAGGTCTCGG + Intronic
1192207309 X:69105072-69105094 CACCTCTGAAAGCCAGGATGGGG + Intergenic
1192332465 X:70187444-70187466 AACCCTTCTAAGCCAGGGTTAGG + Intronic
1195160029 X:102162099-102162121 CACCCTGCAAAGCCAGGGGAAGG - Intergenic
1200286570 X:154828441-154828463 CACCCTTTGAAAGCAGGATTTGG - Intronic