ID: 1096448697

View in Genome Browser
Species Human (GRCh38)
Location 12:51719030-51719052
Sequence TTTTTGGTATATAACTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 2, 1: 1, 2: 8, 3: 50, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096448693_1096448697 25 Left 1096448693 12:51718982-51719004 CCAGCCGATAGATTATTACAATA 0: 2
1: 0
2: 0
3: 7
4: 70
Right 1096448697 12:51719030-51719052 TTTTTGGTATATAACTTGGAAGG 0: 2
1: 1
2: 8
3: 50
4: 270
1096448694_1096448697 21 Left 1096448694 12:51718986-51719008 CCGATAGATTATTACAATAAATT 0: 2
1: 0
2: 1
3: 43
4: 539
Right 1096448697 12:51719030-51719052 TTTTTGGTATATAACTTGGAAGG 0: 2
1: 1
2: 8
3: 50
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096448697 Original CRISPR TTTTTGGTATATAACTTGGA AGG Intronic
901329436 1:8393886-8393908 TTTTTTGTTTATAATTTGAAGGG + Intronic
902057650 1:13615593-13615615 TTTTTCTTATATGAGTTGGAGGG + Intronic
903251941 1:22060874-22060896 AGTTTGGTTTATAACTTGAAAGG + Intronic
903363327 1:22790769-22790791 TTTTTAATATTTAGCTTGGATGG + Intronic
903587891 1:24430575-24430597 CTTTTAGCATGTAACTTGGAAGG - Intronic
906123748 1:43413442-43413464 TTTTGGGTATACACCTAGGAGGG - Intronic
908454696 1:64291709-64291731 CTTTTTGTATATAACATGAAAGG - Intergenic
908542426 1:65134259-65134281 TTTTTGGAATACAATTTGGAAGG + Intergenic
908826050 1:68133809-68133831 TGTTTGGTATGTGAGTTGGAGGG - Intronic
909081076 1:71112479-71112501 TTTTTGGCATATAACTTGGAAGG - Intergenic
909154895 1:72061715-72061737 TTTTAGATACATTACTTGGAGGG - Intronic
909352293 1:74668563-74668585 TTTTTGGCTTATAACTCTGAAGG + Intronic
910576813 1:88774573-88774595 TTTGTTGTATATAATTTGGCTGG - Intronic
911288005 1:96021276-96021298 TTTGTGTTATATTAATTGGAAGG + Intergenic
915263814 1:154700007-154700029 TTGAGGTTATATAACTTGGATGG - Exonic
915284346 1:154843297-154843319 TTTTTTGTCTAGAACCTGGATGG - Intronic
915783900 1:158586344-158586366 TGAATGGTATATAACTTGGATGG - Intergenic
915887454 1:159738297-159738319 TTTGGGGCATATAACTTGGAAGG + Intergenic
916935370 1:169622336-169622358 TTTGGGGCATATAACTTGGAAGG + Intronic
916954632 1:169819404-169819426 GCTTTGGTATATAACTAGGTAGG - Intronic
917307602 1:173642282-173642304 GTTTTTGTATAAAACTTTGAAGG - Intronic
918167459 1:181964035-181964057 TTTTGAGTGTATAACTGGGATGG - Intergenic
918294111 1:183139231-183139253 ATTTTGGTAAATAACTTCTAAGG + Intronic
918394609 1:184100843-184100865 TTTCTGGTATAAAACTTGGCCGG + Intergenic
918507431 1:185272083-185272105 TTCTGGGTATGTAAGTTGGATGG - Intronic
922074603 1:222230963-222230985 TATTTGGGAAATATCTTGGAAGG - Intergenic
923849022 1:237772174-237772196 GTTTTGGTTTATAACTAGAAAGG + Intronic
924040987 1:239983632-239983654 TTTTTATTCAATAACTTGGAAGG + Intergenic
924320899 1:242849135-242849157 TTTTTGGTATATACCATAGCAGG - Intergenic
924758402 1:246962872-246962894 TTTTTAGTAGATAACCGGGATGG + Intronic
1063746646 10:8891211-8891233 TTTTTGGTAATTGACTTGGAAGG + Intergenic
1065090167 10:22224116-22224138 TTTGTTGTAGATAACTTGGGAGG + Intergenic
1065109533 10:22426151-22426173 TTTTTACCATGTAACTTGGAGGG - Intronic
1066338930 10:34510057-34510079 TGTTTAGCATTTAACTTGGAGGG + Intronic
1071977805 10:90972749-90972771 TTTTCTGAATATAACTTAGAAGG - Intergenic
1072307082 10:94118074-94118096 TTTTTGGAATGTAAATTGGAAGG + Intronic
1081089322 11:38843210-38843232 TTTCTGAGATAGAACTTGGATGG - Intergenic
1081391518 11:42535012-42535034 TTTTTGAATTAGAACTTGGACGG + Intergenic
1083107829 11:60375674-60375696 TTGTTTGTATTTCACTTGGAAGG + Intronic
1086390124 11:86355189-86355211 TTTTTCCTAGAGAACTTGGAAGG + Intergenic
1087011509 11:93518455-93518477 TTTTGAGTATATAACTAGGATGG + Intronic
1088523085 11:110720319-110720341 TCATTGGTATTTAACTTTGAAGG + Intergenic
1088547231 11:110971849-110971871 TTTTTAAAATATAACTTTGATGG - Intergenic
1088849515 11:113693528-113693550 TGTTTGTTATAAAACTTGGAGGG - Intronic
1089045168 11:115495589-115495611 ATTTTGGTAGATAACATAGAGGG - Intronic
1090617055 11:128524176-128524198 TTTTTAGTATCTAATTTGGGTGG - Intronic
1090923284 11:131227436-131227458 TTTATGGTATATATTTTGAATGG + Intergenic
1091892270 12:4068628-4068650 TTTTTGGCATTTACCTTGGTTGG + Intergenic
1094073889 12:26451061-26451083 ATTTTGGTATATAACTGGAATGG + Intronic
1094764309 12:33574418-33574440 TTTTTGGCAGATTTCTTGGAAGG + Intergenic
1095240617 12:39854607-39854629 GTTTTGGGATATAGATTGGAGGG - Intronic
1095265313 12:40149782-40149804 TTTTTTCTTTATAAATTGGATGG - Intergenic
1095373260 12:41495626-41495648 TTAGGGGTATAAAACTTGGAAGG - Intronic
1095843098 12:46715876-46715898 TTTTAGGTATAAAACTTGTTTGG - Intergenic
1095916353 12:47483754-47483776 TATTTTTTATATAACTTGGCAGG - Intergenic
1096448697 12:51719030-51719052 TTTTTGGTATATAACTTGGAAGG + Intronic
1097273850 12:57797693-57797715 TTTTAGGTATATAACAAGCAAGG + Intronic
1098123005 12:67262885-67262907 TTTTTGGTGTATATTTTGTAGGG - Intergenic
1098654286 12:73008706-73008728 TTTCTGGTATATAATTCTGAAGG + Intergenic
1098765908 12:74488500-74488522 TTTTTGGTATATACCCAGTAAGG - Intergenic
1099724184 12:86403679-86403701 TTTTAGGTATAGATTTTGGAAGG + Intronic
1099727240 12:86447698-86447720 TATTTGGTCTATATATTGGATGG - Intronic
1100682528 12:96943192-96943214 TCTGTGGTATGTATCTTGGAAGG - Intronic
1101466671 12:104957027-104957049 TCTTGGGTATATACCTAGGAGGG - Intronic
1101591381 12:106128435-106128457 TTTTTGATGTATAGATTGGACGG + Intronic
1102313929 12:111870839-111870861 TTTTTGCTTTAGAACTTGTAAGG - Intronic
1103639303 12:122336317-122336339 TGTTCGATGTATAACTTGGAAGG + Intronic
1104520466 12:129469801-129469823 TTTTTTGTATTTCACTTTGAAGG - Intronic
1105522478 13:21143216-21143238 TTTTGGGTATGTACCTAGGAGGG + Intronic
1106254307 13:28008787-28008809 ATTTTGGTATATAAATTTGGGGG + Intronic
1106596674 13:31147477-31147499 TTTTTGGTACATATTTTGGGGGG - Intronic
1107148852 13:37089295-37089317 TTTTAGTTTTATAAATTGGAGGG + Intergenic
1107283608 13:38764650-38764672 TTTCTGGTATAAAAATTGGCAGG + Intronic
1107315028 13:39121670-39121692 TTTTTGGCATATAACTGAAAAGG - Intergenic
1108433418 13:50377664-50377686 ATTTTGGTATATATCTGTGAAGG + Intronic
1109380961 13:61558780-61558802 TTTGTGGTATACAACTTTAATGG + Intergenic
1110549984 13:76801316-76801338 TTTTTAGGATCTAGCTTGGAAGG - Intergenic
1112904312 13:104398356-104398378 TTTTTGGTATATATTCTGCAAGG + Intergenic
1114346464 14:21800484-21800506 TTTGTGGTATATACCTTTGGGGG + Intergenic
1115689679 14:35829744-35829766 TTATTTTTATATAACATGGAAGG - Intronic
1116797307 14:49405684-49405706 TTTTTGGCATCTAACTTGAAAGG + Intergenic
1116916832 14:50532923-50532945 TTTTCCGTGTTTAACTTGGAGGG - Intronic
1119478213 14:74943509-74943531 TTTCTGGCAAATAACTTGGAAGG + Intronic
1120604772 14:86560750-86560772 CTTCTGGTATTTAACTTGGTGGG + Intergenic
1121768479 14:96508439-96508461 TTTTTGGTAGAGAAGTTGGAAGG + Intronic
1124378883 15:29147783-29147805 TCTTGAGTATATACCTTGGAGGG - Intronic
1126001406 15:44213636-44213658 TTTTTGGTTTAGAACATGTATGG + Intergenic
1126364340 15:47878258-47878280 TCTCTGGCATATAATTTGGAGGG - Intergenic
1126414983 15:48408276-48408298 TTATGGGTATATAACTTTTAAGG + Intergenic
1126894748 15:53246147-53246169 CTTTTGATATATAACTCAGAGGG - Intergenic
1127609273 15:60621388-60621410 TTGTTGCTATATAACATGAAGGG + Intronic
1128333815 15:66773514-66773536 TTTTTGTTATCAAACTTAGAGGG - Intronic
1128490813 15:68141452-68141474 TTTATTGTATAAAACTTGCATGG + Intronic
1129442163 15:75589092-75589114 TTTGGGGTATATACCTAGGAGGG - Intergenic
1130431887 15:83856511-83856533 TTTTTGGTATATACCTACAATGG - Intronic
1130998558 15:88919766-88919788 TTTTTGTTATATAAATGGCAGGG + Intergenic
1131909248 15:97178451-97178473 ATTTTGTTTTATAACTTAGAAGG - Intergenic
1135208325 16:20500980-20501002 TTGTACGTAAATAACTTGGAGGG + Intergenic
1135210574 16:20522720-20522742 TTGTACGTAAATAACTTGGAGGG - Intergenic
1137305542 16:47196213-47196235 TTTTTGGTATTTATCCTGCATGG + Intronic
1140248115 16:73269657-73269679 TTTTGGGTAGATACCTAGGAGGG + Intergenic
1140749419 16:78009721-78009743 TATCTGGTATATATTTTGGAGGG + Intergenic
1141417210 16:83884980-83885002 TGTTTGGTATATACCTTGGAGGG + Intergenic
1143426176 17:6840324-6840346 TGTAAGGTATATAACTTGCAGGG + Intergenic
1144544676 17:16182053-16182075 TTGTTGGTCTAGAAATTGGAAGG + Intronic
1145281607 17:21471661-21471683 TTTTTGGTCTATAACTTTGAAGG + Intergenic
1145718730 17:27048725-27048747 TTTTGGGTATATAACCTGAATGG - Intergenic
1145859435 17:28195854-28195876 TTTTTAATATAAAAGTTGGAAGG - Exonic
1153829975 18:8913540-8913562 TTTTTAGTGTATAAATAGGAAGG - Intergenic
1154022278 18:10674752-10674774 TTTTCGCAATATAACTTGGATGG - Intronic
1154231566 18:12560224-12560246 TTTTGGGTATATAACTAGGAGGG - Intronic
1154470417 18:14694658-14694680 TTTTGGGTATATACCCTGAAAGG + Intergenic
1155547032 18:26926536-26926558 TTTTTCCTACAAAACTTGGAAGG - Intronic
1155684842 18:28536026-28536048 TTTTGGGTATATACCTAGAAAGG - Intergenic
1155799785 18:30087074-30087096 TTGTTGGAATTTAACTTGGGAGG - Intergenic
1156758831 18:40561677-40561699 TTTTATATATATAACTTTGATGG - Intergenic
1158490358 18:57904676-57904698 TTTTTGGCAGATACCTTGGAAGG - Intergenic
1158841852 18:61396271-61396293 TTTATGGCTTCTAACTTGGATGG - Intronic
1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG + Exonic
1165217914 19:34289896-34289918 TTTTTAATATATAAATTGAAGGG + Intronic
1165278712 19:34778086-34778108 TTTATTGTATACAACTTGGTTGG - Intergenic
1166189867 19:41169355-41169377 TTTTTGGCATATAGCTTAGAAGG + Intergenic
1167448038 19:49550507-49550529 TCTTGGGTAGATAACTAGGAGGG + Intergenic
1168610993 19:57799876-57799898 GTTTTTGTATAAAACTTTGAAGG + Intronic
927164394 2:20302504-20302526 TATTTGGAAAATAACTTGGGGGG - Intronic
928260452 2:29761884-29761906 TATTTGGTATCTAATTTAGATGG + Intronic
929022436 2:37566751-37566773 TTTTTGGTATATGACTCACATGG + Intergenic
929627037 2:43420010-43420032 TTTATGATTCATAACTTGGAAGG - Intronic
929816272 2:45235171-45235193 ATTTGGGTATATAACTGGGAAGG + Intergenic
929961372 2:46498694-46498716 TTTTTGGCATATAACTCGAAAGG + Intronic
930498826 2:52184474-52184496 TTTGTGGTATTTAATTTGGGAGG - Intergenic
930513214 2:52372633-52372655 TTTCTGGAATGTAACTTAGAGGG + Intergenic
930651257 2:53967036-53967058 ATATTGGTAGATAACTTGTATGG - Intronic
931988532 2:67765358-67765380 CTTTTGGTAACTCACTTGGATGG - Intergenic
935914561 2:107935390-107935412 TATTTGGGAGATAACCTGGAGGG + Intergenic
935985571 2:108669616-108669638 CTTTTGGCATATAACTTGTAAGG + Intronic
936137999 2:109913246-109913268 CTTTTGGCATATAACTTGTAAGG + Intergenic
936206698 2:110458239-110458261 CTTTTGGCATATAACTTGTAAGG - Intronic
936741528 2:115517104-115517126 CTTATGGTATATACCTAGGAAGG - Intronic
937563325 2:123252509-123252531 TTTTTGAAATATACCTTTGATGG + Intergenic
937569779 2:123342427-123342449 TTTTTGGTAGATAAACTTGAGGG + Intergenic
938166404 2:129031031-129031053 TTTTAGATATATAGCTGGGAGGG - Intergenic
938816747 2:134912445-134912467 TTTTGGGTATATACCTAGCAGGG + Intergenic
939814298 2:146874747-146874769 CTTTTGGACTTTAACTTGGAAGG - Intergenic
940533906 2:154914049-154914071 TTTTTGGTAAATAGTTTGGGGGG + Intergenic
940660808 2:156543055-156543077 TTTTTGGTATATGATTAAGACGG - Intronic
941437841 2:165493447-165493469 GTTTGGATAGATAACTTGGAAGG - Intronic
941808140 2:169730231-169730253 TTTTTGGCAAATAATTTGGAGGG - Intronic
942281303 2:174366357-174366379 TTTTTGGTATTTATCTTGCTTGG - Intronic
942618656 2:177823627-177823649 TTTTTGGAAGATAACTTTGATGG - Intronic
942736835 2:179124078-179124100 TTTATGCTTTATAACTTAGATGG - Intronic
942852927 2:180511970-180511992 TTTTTTTTACATATCTTGGAGGG - Intergenic
943356717 2:186865424-186865446 CTTTTGGCATATAACATGAAAGG + Intergenic
943945596 2:194058682-194058704 TTTTTGGTATACAAGTTAGATGG + Intergenic
945050999 2:205824331-205824353 TTTTGGCTATATACCTTGAAGGG - Intergenic
945123149 2:206479986-206480008 TATTTGGTGAATTACTTGGAAGG + Intronic
946118877 2:217491189-217491211 TTTTTGGTCTATAAAATGAAAGG - Intronic
947189062 2:227482520-227482542 TTTTTAGTAAATAACTAGGATGG + Intronic
1169318901 20:4614939-4614961 TTTTTGGGTTCTAACTTGGAGGG - Intergenic
1170983056 20:21232914-21232936 ATTTTGTTGTATGACTTGGAGGG + Intronic
1173450310 20:43157893-43157915 TTTTTGTTGGAAAACTTGGAAGG - Intronic
1174094004 20:48073503-48073525 TTTTTGGCACATAACCTGGAAGG - Intergenic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1176804070 21:13463209-13463231 TTTTGGGTATATACCCTGAAAGG - Intergenic
1181714630 22:24715351-24715373 TTTTTGGTTCACAACTTGGGTGG - Intergenic
1182744904 22:32598047-32598069 TTATTAGTACATAACTAGGAGGG - Intronic
1182919559 22:34066803-34066825 TTTCTGGTATAAGACTTTGAAGG + Intergenic
949115781 3:320876-320898 TCTTCTGTATATAATTTGGAGGG + Intronic
949607247 3:5666751-5666773 TTTTTGAAAAATAACTTCGATGG - Intergenic
950586137 3:13893892-13893914 ATTTTGCTATATAGCTTGAATGG + Intergenic
951374760 3:21899928-21899950 TTTTTGGTCTTTTACTTAGAAGG - Intronic
952726270 3:36589051-36589073 TTTTGGGTATATACCTAGCAGGG - Intergenic
956030473 3:65031531-65031553 TGTTTGGGCTATAACTGGGAGGG - Intergenic
957017823 3:75090484-75090506 TTATTTGTATATAACATAGATGG - Intergenic
957820658 3:85369878-85369900 TTTTTCTTAAATATCTTGGAGGG - Intronic
957820817 3:85372161-85372183 TTTTTCTTAAATATCTTGGAGGG - Intronic
958135276 3:89480825-89480847 GTTTTGGTGTGTAACTTAGAAGG + Exonic
959035337 3:101356501-101356523 TTATTTGTATATAACTTTAAAGG - Intronic
959153834 3:102641839-102641861 TTTTTTCTACAAAACTTGGATGG + Intergenic
959284050 3:104384282-104384304 TTATATATATATAACTTGGAGGG + Intergenic
959928111 3:111947835-111947857 TTTTTGGTAAAAACCTTGAAAGG - Intronic
960173704 3:114492648-114492670 ACTTTGGTAAATAATTTGGAAGG - Intronic
962147984 3:132861290-132861312 CTTTTGATACACAACTTGGATGG - Intergenic
962581057 3:136798257-136798279 TTTTTGGCATATAACTTAGGAGG - Intergenic
963821900 3:149906338-149906360 TCTTTGGTATATACCTAGAATGG + Intronic
964072684 3:152653854-152653876 GTTTGGGTAGATGACTTGGATGG - Intergenic
964590553 3:158359060-158359082 TTTTAGGTGTATACCTAGGAGGG + Intronic
965351794 3:167621466-167621488 TTTTGGGGATATAACTGGAAAGG - Intronic
966492599 3:180544838-180544860 TTTTGGGTATATAACCTGGAAGG + Intergenic
966757946 3:183388999-183389021 TCCTTAGTATATAACATGGAGGG - Intronic
967433010 3:189410377-189410399 TTTTTGGTATTCAACTTTTAAGG - Intergenic
968714615 4:2146896-2146918 TTTTTAGTATCTAGCTGGGATGG - Intronic
970011305 4:11462498-11462520 TTTTGGGTATATACCTAGCATGG - Intergenic
970063706 4:12066985-12067007 TTCTTGCTATAAAACTTGGAAGG + Intergenic
970388159 4:15577715-15577737 TTTTTTTTTTTTAACTTGGAAGG + Intronic
970900059 4:21148045-21148067 TCTTTGGTCTATGATTTGGAGGG - Intronic
973039684 4:45454777-45454799 TTTGGGGAATATAACTAGGAAGG + Intergenic
974192774 4:58528763-58528785 TTTTTGGTATATAACTCAGACGG - Intergenic
974861598 4:67528820-67528842 TTTTGGGTATATACCTAGGAGGG + Intronic
975281194 4:72564842-72564864 TTCTTAGTATTTAACTTAGAAGG - Intronic
975342174 4:73255356-73255378 TTTGTGGTATTTAACCTGAAAGG - Intronic
975390486 4:73811329-73811351 ATTTTGATATATAACCTAGAGGG - Intergenic
975872167 4:78791945-78791967 TTTTTGGTATATATCCGGAAGGG + Intronic
976241294 4:82959861-82959883 TTTTTGGTATAAGACTCAGAAGG - Intronic
978152808 4:105457293-105457315 ATTTTGGTATACAACTTTTAAGG - Intronic
978979129 4:114919856-114919878 TAATTGGGATATAATTTGGAAGG + Intronic
980095175 4:128482546-128482568 TTTTTAGTCTATAACATGAAGGG + Intergenic
981206625 4:142048573-142048595 TGTTTGCTATATGAGTTGGAGGG + Intronic
981568887 4:146131152-146131174 TTTTTGGAAGATAACTTACAGGG - Intergenic
982341245 4:154301328-154301350 TTTTTGGCATATAACTCAGAAGG + Intronic
984019995 4:174474192-174474214 TTTTTGCAATATAATTTAGAGGG + Intergenic
984438195 4:179730062-179730084 TTTTTTGTATCTAACTTTGGAGG + Intergenic
984800938 4:183716638-183716660 TGCTTGGAGTATAACTTGGATGG - Intergenic
985014682 4:185621409-185621431 TTTTTGAAACGTAACTTGGAAGG - Intronic
986748205 5:10761830-10761852 TTTTTGGTTCATAACGAGGAGGG - Intergenic
989087109 5:37687278-37687300 TTTTTGATATAAAATTTGGGAGG + Intronic
989289371 5:39745083-39745105 CTTTTGGCATAAAACTTGAATGG + Intergenic
989329704 5:40242483-40242505 TTTTTGGACTAATACTTGGAGGG + Intergenic
990501676 5:56402582-56402604 TTTTTGCTTTTTAACTTGGTGGG + Intergenic
990513283 5:56508864-56508886 TTTTTGGGATTTATTTTGGATGG - Intergenic
990652110 5:57912977-57912999 TATTTGGTGTATAAGTTGGTAGG - Intergenic
990896880 5:60709182-60709204 TTTTTGGGTTATAACATAGAGGG - Intergenic
991119697 5:62997467-62997489 TTTTTGGCATTTATCTTGGCTGG + Intergenic
991577235 5:68117280-68117302 TTTTTGGTAAATTACATGAATGG - Intergenic
991681049 5:69139815-69139837 TTTTGGGTATATACCTAGCAGGG + Intergenic
992012166 5:72539807-72539829 TATCTGGTATATAACTGAGATGG - Intergenic
992353755 5:75957955-75957977 TATTTGTCAGATAACTTGGAAGG + Intergenic
993213565 5:84988543-84988565 TTTTTGGAATAAAACTTGTCAGG - Intergenic
994854810 5:105104572-105104594 TTTTTTGTAGATCACTTGAAGGG - Intergenic
994886023 5:105563092-105563114 TTTATGGTATTTTAGTTGGATGG + Intergenic
995990720 5:118235803-118235825 TTTTTGGTGTATAGCGAGGAAGG - Intergenic
996549026 5:124711085-124711107 TTTATGGTTTAGAACTTGGTAGG - Intronic
996723736 5:126655314-126655336 TCATTGGGAAATAACTTGGAGGG - Intergenic
1000377618 5:160598029-160598051 TTTTGGGTATATACCCAGGATGG - Intronic
1000917826 5:167103311-167103333 TTTATGGTATCTGACTTGGAGGG + Intergenic
1001063439 5:168514892-168514914 TTTTTGGAATATCACTTAGTTGG + Intronic
1002123070 5:177020921-177020943 TGTTTTGTATATACCTAGGAGGG + Intronic
1002692021 5:181056657-181056679 TCTGGGGTATATAACTAGGAGGG + Intronic
1003843192 6:10144132-10144154 TTTCTAGTATATAAGTTGGCAGG - Intronic
1004010111 6:11676902-11676924 TGTTTGGTATTTAACTTGAATGG - Intergenic
1004207999 6:13610316-13610338 ATTTTGGCATACAACTTGGAAGG - Intronic
1004546053 6:16599222-16599244 TTCTTGGTTCATACCTTGGAAGG - Intronic
1004763418 6:18696782-18696804 TTTTAGTTAAACAACTTGGATGG + Intergenic
1010434105 6:75810640-75810662 TTTTTGGTTTATGACATGAAAGG + Intronic
1011637365 6:89386579-89386601 TTTAGGGGATATAACTTGGAAGG + Intronic
1011895363 6:92217772-92217794 ATTTTGGGATATCACTGGGAAGG + Intergenic
1012706969 6:102543879-102543901 TTTTGGGTATATACCCAGGAGGG - Intergenic
1012808631 6:103928594-103928616 TTTTTGCAACATAACTTTGAAGG - Intergenic
1013257403 6:108401574-108401596 TTCTTAGTAAAGAACTTGGACGG - Intronic
1014111332 6:117621246-117621268 GTTTTTGTATAAAACTTTGAAGG - Intergenic
1014302346 6:119697931-119697953 TTTTTGGCACATAACTTGGAAGG - Intergenic
1014870025 6:126582778-126582800 TTTTTGGACTGTAACTTGGGAGG - Intergenic
1015161518 6:130157307-130157329 TTTTTGGTATATAACTTTATAGG - Intronic
1015302426 6:131668975-131668997 TTTATGACATATAACTAGGACGG + Intronic
1018750385 6:166799050-166799072 TTTTTGGCATACAACTTGAAAGG + Intronic
1019877630 7:3828319-3828341 CTTTTGGCATATAACTTAGAAGG + Intronic
1021043731 7:15895198-15895220 TTTTTGGTATTTATCTTGCTTGG - Intergenic
1022788463 7:33662885-33662907 TGTTTAGAATATATCTTGGAAGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1026119394 7:67523720-67523742 TTTTTGGTACTAAACTGGGAAGG + Intergenic
1027515951 7:79141993-79142015 TGTATGGTAAATAACCTGGAAGG - Intronic
1027626850 7:80555685-80555707 TTTGAGGTATATAATTTGTATGG + Intronic
1028322614 7:89478968-89478990 TTTTTTGTATATAAATTACATGG + Intergenic
1028682196 7:93548455-93548477 TTTTTGACATATAACTAGGGAGG + Intronic
1029138042 7:98388996-98389018 TTTTTTGGATAAAACTTGAATGG - Intronic
1030182910 7:106729436-106729458 TCTTGGGTATATACCTAGGAGGG - Intergenic
1030966740 7:116002165-116002187 TTTTGGGTATATACCTTGCAGGG - Intronic
1031383553 7:121118075-121118097 TTTTTAACATATACCTTGGAGGG + Intronic
1031941960 7:127798519-127798541 TTATTTGTATAGAAGTTGGAGGG + Intronic
1032240769 7:130157100-130157122 TTTTTGATCTATAACTTAGCAGG + Intergenic
1032370470 7:131345147-131345169 TTTTTGGCATGTAATTTGGAAGG + Intronic
1032665308 7:134030214-134030236 TCTTGGGTATATACCTAGGAGGG - Intronic
1032773355 7:135083269-135083291 TTTCTGGTAAATCACTTTGATGG - Intronic
1032917418 7:136508198-136508220 TTTGTGTTATATATCTTGAAAGG - Intergenic
1033053283 7:138026673-138026695 TTGTTGGTATGTATCTTGCAGGG - Intronic
1035135145 7:156696348-156696370 TTCTTGTTATTTAACTTTGAGGG - Intronic
1035841493 8:2816260-2816282 TTTATGCTATATAAATTGGTAGG + Intergenic
1040376137 8:46826344-46826366 TTTTGGCTCTATAACTTGGCTGG + Intergenic
1040817293 8:51521663-51521685 TTTTTGGTATTTATCTTGCTTGG - Intronic
1041941752 8:63396019-63396041 TTTCTGGTATAGATCTTTGATGG + Intergenic
1042168755 8:65972474-65972496 TTTTTGCTTTATAACAAGGATGG - Intergenic
1042337782 8:67646716-67646738 TTTTTGAAATAAAACATGGATGG + Intronic
1043104781 8:76094305-76094327 TTTTTGACATGAAACTTGGAGGG - Intergenic
1044097451 8:88085345-88085367 TTTTTGGTATATAAATGTTAGGG + Intronic
1044391094 8:91652039-91652061 ATTTTGGTATATTACTTGGTTGG - Intergenic
1044886617 8:96785157-96785179 GTTTTGGTACATAATTTGGATGG - Exonic
1046737694 8:117794525-117794547 TTTTTCTTCTATAAATTGGAAGG + Exonic
1047047212 8:121067471-121067493 TCTTTGGTGTATTCCTTGGAAGG - Intergenic
1049488783 8:142880074-142880096 TTTTTGCTATAAACCTTGCAAGG - Intronic
1049858206 8:144877514-144877536 TTTTTGGGATATAACATCAAAGG - Exonic
1050189787 9:3012798-3012820 TTTTGGGTGTATAGCTAGGAGGG + Intergenic
1052180698 9:25523418-25523440 TTTTTGGTACATATCCTGAAGGG + Intergenic
1053336830 9:37282125-37282147 TTTTTGATAGAAAACATGGAGGG - Intronic
1054952674 9:70870288-70870310 TTTCTGGTCTGTAACTTGCAAGG + Intronic
1055127526 9:72735977-72735999 TCTTTGGTATAAAACTTGGTGGG + Intronic
1057115820 9:92520598-92520620 TTTTGGGTATATACTTAGGAGGG - Intronic
1057915956 9:99055385-99055407 TTTGGGGTAGATGACTTGGAGGG - Intronic
1058131131 9:101254810-101254832 TTTTTGGTTAAAAAGTTGGAGGG - Intronic
1059390309 9:113995611-113995633 TTTCTGGCATACAACTTGGAAGG - Intronic
1060285449 9:122247712-122247734 TTTTTGGTAAATAACTGGCAAGG + Intronic
1185895305 X:3853344-3853366 TTTTTAATATATGACTTGTAAGG + Intergenic
1185900422 X:3891768-3891790 TTTTTAATATATGACTTGTAAGG + Intergenic
1185905538 X:3930199-3930221 TTTTTAATATATGACTTGTAAGG + Intergenic
1185919624 X:4076414-4076436 TTATTGGTATATAATATTGAGGG + Intergenic
1187413084 X:19068109-19068131 TTTGGGGTATATACCTAGGAGGG - Intronic
1187469856 X:19559675-19559697 TTTTTGGTATATAATTTGCAAGG - Intronic
1187581763 X:20614694-20614716 TATTTGGTATATTAATTGGGGGG - Intergenic
1188202807 X:27312545-27312567 TGTTTGGTATATAACATACATGG + Intergenic
1188349023 X:29104112-29104134 TTTTGGGTATATACCTTGCAGGG - Intronic
1188532070 X:31152848-31152870 TTTTTGATGTTTAACTTGGGTGG + Intronic
1188854979 X:35182918-35182940 TTTTTAGTATATACCTAGGAGGG + Intergenic
1189578212 X:42378135-42378157 TTTTTGGTATGTAACTTGCAAGG - Intergenic
1189661541 X:43305320-43305342 TTTTTGGTATATAACTTGGAAGG - Intergenic
1190824784 X:54007892-54007914 TCTTGGGTATATATCTAGGAGGG - Intronic
1192098861 X:68242560-68242582 TTTTGGGTATATACTTTGGAGGG - Intronic
1192251774 X:69419446-69419468 TTTTTGGTATTTATCTTGTTTGG + Intergenic
1193608267 X:83594797-83594819 TTTTTGGAATATCACTTGCCTGG + Intergenic
1193739245 X:85198331-85198353 TTTTGGGTATATAGCTAGCAGGG + Intergenic
1194817360 X:98459779-98459801 TTTTGAGTATATACCTAGGAGGG + Intergenic
1196642261 X:118075750-118075772 TGTCTAGTAGATAACTTGGATGG - Intronic
1197101246 X:122658156-122658178 TTTTGGGTATACACCTAGGAGGG - Intergenic
1197692440 X:129516542-129516564 TATTTGTTAAATAACTTTGAAGG - Intronic
1197879462 X:131150693-131150715 TATTTGGTGTATATCTAGGAAGG + Intergenic
1198300995 X:135334200-135334222 TTTTTGGTATAATAGTGGGAGGG + Intronic
1198560222 X:137841743-137841765 TTTATGGAAGAAAACTTGGAAGG - Intergenic
1198997176 X:142586470-142586492 TTTATGGTATATTTCTTGGGGGG + Intergenic
1200180560 X:154147864-154147886 TTTTTGGCAGATTACTTGAAGGG - Intronic
1200186388 X:154186259-154186281 TTTTTGGCAGATTACTTGAAGGG - Intergenic
1200192040 X:154223397-154223419 TTTTTGGCAGATTACTTGAAGGG - Intronic
1200197795 X:154261201-154261223 TTTTTGGCAGATTACTTGAAGGG - Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic