ID: 1096453179

View in Genome Browser
Species Human (GRCh38)
Location 12:51762535-51762557
Sequence GATCCATGGCTATGAGCTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096453179_1096453182 -1 Left 1096453179 12:51762535-51762557 CCTGAAGCTCATAGCCATGGATC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1096453182 12:51762557-51762579 CCCTACTATTATTTCCAAGAAGG 0: 1
1: 1
2: 0
3: 9
4: 114
1096453179_1096453184 3 Left 1096453179 12:51762535-51762557 CCTGAAGCTCATAGCCATGGATC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1096453184 12:51762561-51762583 ACTATTATTTCCAAGAAGGTTGG 0: 1
1: 1
2: 0
3: 22
4: 231
1096453179_1096453186 17 Left 1096453179 12:51762535-51762557 CCTGAAGCTCATAGCCATGGATC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1096453186 12:51762575-51762597 GAAGGTTGGAACATTTTTGACGG 0: 1
1: 0
2: 5
3: 158
4: 1922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096453179 Original CRISPR GATCCATGGCTATGAGCTTC AGG (reversed) Exonic
900574680 1:3377216-3377238 ACTCCATGGCCATGGGCTTCTGG + Intronic
901190793 1:7408653-7408675 CATGCATGGCTATCAGCTTCTGG + Intronic
904047376 1:27616689-27616711 GATCCAGCTCTGTGAGCTTCTGG - Intronic
905285842 1:36879802-36879824 GGCCCGTGGCTATGAGCTGCGGG - Intronic
905344197 1:37300421-37300443 TATCCTTGGCTCTGAGCTGCGGG - Intergenic
906160509 1:43645511-43645533 GATACATGGATCTGAGCTCCAGG + Intergenic
906788674 1:48639347-48639369 GATCCCTGGCTAGGAGCCTGGGG + Intronic
908899316 1:68937934-68937956 GATCCATTGCTATGTGACTCTGG - Intergenic
915252678 1:154601836-154601858 GATCCTTGGCTATGACTGTCTGG + Exonic
915252696 1:154601983-154602005 GCTCCTTGGCTATGACCGTCTGG + Exonic
920879851 1:209869684-209869706 GATACAAGGCTAAGAACTTCGGG - Intergenic
921334765 1:214075245-214075267 GATGCATGTCTCTGAGGTTCTGG + Intergenic
923894383 1:238252773-238252795 TATCCATGGGTATGAGATACGGG + Intergenic
1076403991 10:130200586-130200608 CATCCATGTCTCTGAGCCTCTGG - Intergenic
1077670760 11:4155016-4155038 GATACATGGCTCTGAGATGCAGG - Intergenic
1080686337 11:34518346-34518368 CTTCCTTGGCTATGAGCCTCAGG + Intergenic
1083261155 11:61523842-61523864 TGTCCATGGCTTTGAGGTTCCGG + Exonic
1085046328 11:73355926-73355948 GATCCCACGCTACGAGCTTCTGG + Exonic
1085077630 11:73605800-73605822 GTTCCATGCCTCTCAGCTTCTGG - Intergenic
1089709293 11:120303273-120303295 AGCCCATGGCTATGAGATTCTGG - Intronic
1090646511 11:128770819-128770841 GATCCATGCCTAATTGCTTCTGG + Intronic
1092107534 12:5932970-5932992 GATCCATTGCAATGGGCCTCGGG + Intronic
1096453179 12:51762535-51762557 GATCCATGGCTATGAGCTTCAGG - Exonic
1097187788 12:57204872-57204894 GATCCATTGCTAGGAGCCTGGGG + Intronic
1100373632 12:93992322-93992344 GGGCCATGGTTATGACCTTCAGG + Intergenic
1103164258 12:118756735-118756757 GATCCATGTTTATCAGCTTGGGG - Intergenic
1103339568 12:120214298-120214320 TGTCTATGGCTATGAGCTGCGGG - Intronic
1107388934 13:39943017-39943039 ACTCCATGGCTCTGAGCTGCTGG - Intergenic
1108525848 13:51285356-51285378 GATCCCTGGGTATGAATTTCAGG + Intergenic
1108704174 13:52970232-52970254 TATCCATGGCAGTGAGCTGCTGG + Intergenic
1112120946 13:96410960-96410982 CATTCCTGGCTATGAGCTCCAGG - Intronic
1113504508 13:110805996-110806018 GAGCCATGCCTATGATCTTGTGG + Intergenic
1115730233 14:36260477-36260499 GAACCATGTCTCTGAGCTGCAGG - Intergenic
1117278896 14:54218723-54218745 CATACACTGCTATGAGCTTCAGG - Intergenic
1121897316 14:97660445-97660467 GGTAAATGGCTAGGAGCTTCAGG - Intergenic
1129312157 15:74720376-74720398 GATCAGTGTCTATGAGTTTCAGG + Exonic
1130539782 15:84814033-84814055 AATGAATGGCTATGACCTTCAGG + Intergenic
1132676542 16:1123532-1123554 GAGCCTTGGCTTTGGGCTTCTGG + Intergenic
1133981096 16:10633827-10633849 GATCCAAGGCTTTGAACTTGAGG - Intronic
1137686432 16:50390187-50390209 GATCCAAGGCTTTGGGCTCCAGG + Intergenic
1138435782 16:56999417-56999439 GATCCAGGGCTCAGAGCTGCAGG - Intronic
1139609951 16:68048785-68048807 AATCCATGGGCATGAACTTCTGG + Intronic
1141332065 16:83119945-83119967 TATCCATGGCTCTGCGTTTCTGG - Intronic
1141434881 16:83994377-83994399 GTTCCATAGCCATGAGCTTGTGG - Exonic
1144813703 17:18018638-18018660 GGCCCATGACTATGAGCTGCAGG - Exonic
1145739627 17:27262376-27262398 GATCCAGAGCTATGAGCTGAAGG + Intergenic
1147504304 17:40999847-40999869 AATCCATGGCAATGGGCGTCTGG + Exonic
1148843885 17:50517355-50517377 GATCCATGGGTTTGAGTTTACGG - Exonic
1151510421 17:74555736-74555758 GATCCATAGATATGAGCCACGGG + Intergenic
1157646360 18:49277173-49277195 GATACATGGATATGAGATACAGG + Intronic
1158938388 18:62385055-62385077 GAGCCCTGGCTCCGAGCTTCGGG - Exonic
1160094336 18:75857781-75857803 TTACCATGGCTTTGAGCTTCAGG + Intergenic
1166043754 19:40217839-40217861 GGTCCAGGGCTGTGGGCTTCTGG - Intronic
1166689089 19:44812204-44812226 GATGCAGGGCTCTGAGCTCCAGG + Exonic
925582715 2:5427659-5427681 TTTCCATGGCTATAGGCTTCAGG - Intergenic
937668506 2:124514570-124514592 CAACCATGCCTATGAGCTCCTGG - Intronic
1173149274 20:40551622-40551644 GGTACAAGGCTGTGAGCTTCAGG + Intergenic
1175606738 20:60317429-60317451 GATCCTTGGATATGATCTTCAGG + Intergenic
1176967523 21:15228108-15228130 GATACATAGCTATGAGATTGAGG + Intergenic
1178808766 21:35861645-35861667 GCTCCATGCCCATGAGATTCAGG + Intronic
1179474635 21:41635325-41635347 AATCAAAGGCTTTGAGCTTCTGG + Intergenic
1180253947 21:46609663-46609685 AATCCATGTCTATGGGCTCCTGG + Intergenic
1184047740 22:41982011-41982033 GACCCAGGGGTAGGAGCTTCAGG + Intronic
1184755521 22:46513752-46513774 TATCTATGGCTTTGAGCTTCTGG - Intronic
1185042434 22:48512021-48512043 GAACCGTGGCCATCAGCTTCTGG - Intronic
954080204 3:48209163-48209185 GATGCATGGCTATTGGCTTGGGG + Intergenic
955001088 3:54928595-54928617 AAACCATGGCTATGAATTTCAGG - Intronic
956750615 3:72341286-72341308 GTTCCTTGGCTATGACCTTGGGG - Intergenic
957220666 3:77378536-77378558 GGTACATGACTTTGAGCTTCTGG - Intronic
960179041 3:114552627-114552649 ACTCCATGGTTATGAGCTTTGGG + Intronic
969623894 4:8292832-8292854 CAGCCATGGATAGGAGCTTCAGG - Intronic
969831441 4:9800871-9800893 TATCCATGGCTATTGGTTTCAGG - Intronic
971221980 4:24716978-24717000 GACCCATGGCCATGGGCTCCAGG - Intergenic
974877939 4:67720660-67720682 GATCCATGGCAATAACCTTCAGG + Intergenic
982115876 4:152098004-152098026 GATCCGTGGATACGAGCTCCAGG + Intergenic
991357256 5:65781863-65781885 GATCCTGGTCTTTGAGCTTCAGG - Intronic
1000136867 5:158361501-158361523 GATCATTGGCTAAGAGCTGCTGG - Intergenic
1000967207 5:167672452-167672474 GATCCATGCCTGTGGCCTTCTGG + Intronic
1003445901 6:6184246-6184268 GTTTCATGGCTAGGAGCTGCTGG + Intronic
1007511605 6:42378631-42378653 GATCCATGCAGATGGGCTTCGGG - Intronic
1012296471 6:97531022-97531044 GATCAATGGGTAGGAGATTCAGG + Intergenic
1016603739 6:145893249-145893271 GAACCCTGCCCATGAGCTTCAGG - Exonic
1018863181 6:167727099-167727121 TATCCATAGCTCTGAGGTTCTGG + Intergenic
1019973005 7:4557406-4557428 AATCATTGGCTATGAGCCTCAGG + Intergenic
1020145497 7:5639274-5639296 GATCCTTGGCTATGATCTAGGGG + Intronic
1021098562 7:16562091-16562113 GACGCATGGCTGAGAGCTTCAGG + Intronic
1021772382 7:24018470-24018492 TAAACATGGATATGAGCTTCAGG + Intergenic
1021976839 7:26019521-26019543 AATGCATGGCCATGAGCATCAGG + Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1023844185 7:44111882-44111904 GATCCATGGCAACGAGGTGCTGG + Exonic
1024983254 7:55174846-55174868 GGTCCATGGCTCTGAACCTCAGG + Intronic
1031445732 7:121851433-121851455 AATTCATGGCTCTGAACTTCAGG - Intergenic
1034391442 7:150790668-150790690 GATCCAAGGCGATGGGCTGCAGG - Intergenic
1034453367 7:151149784-151149806 GAGCCATGGAAATGAGGTTCAGG - Intronic
1034885131 7:154793500-154793522 GGTTCATGGCTCTGGGCTTCAGG - Intronic
1037184140 8:16041202-16041224 TTTCCAGGGCTCTGAGCTTCAGG + Intergenic
1037270648 8:17126107-17126129 GATCCAGGGGGATGAGTTTCAGG + Intergenic
1037921539 8:22809801-22809823 GTTCTATGGATATGAGCTACAGG + Intronic
1047807339 8:128374191-128374213 GATGCATCTCTGTGAGCTTCGGG - Intergenic
1048614617 8:136059589-136059611 CAGCCATGGCTCTGAGTTTCAGG + Intergenic
1049360282 8:142209550-142209572 GATCCATGGCTCAGAGCTCAAGG + Intergenic
1050779740 9:9317736-9317758 GATCCATGGCTTTGTGCTTCAGG - Intronic
1054711839 9:68518246-68518268 AATCCATGGCTCTGATCTTCTGG + Intronic
1061140856 9:128765620-128765642 GCTCCAAGGCTCAGAGCTTCTGG - Intronic
1190346861 X:49345805-49345827 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190348110 X:49536832-49536854 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190349211 X:49546388-49546410 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190350315 X:49555944-49555966 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190351417 X:49565503-49565525 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190352517 X:49575056-49575078 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190353618 X:49584604-49584626 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190354720 X:49594126-49594148 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190627008 X:52346149-52346171 TAGCCATGGAAATGAGCTTCTGG - Intergenic
1190701023 X:52989968-52989990 TAGCCATGGAAATGAGCTTCTGG + Intronic