ID: 1096456310

View in Genome Browser
Species Human (GRCh38)
Location 12:51790177-51790199
Sequence TCTAAGATCTTCCAGTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096456310_1096456313 3 Left 1096456310 12:51790177-51790199 CCTTGGGACTGGAAGATCTTAGA 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1096456313 12:51790203-51790225 CCTGAGCTAAAAACAAAGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 239
1096456310_1096456311 -1 Left 1096456310 12:51790177-51790199 CCTTGGGACTGGAAGATCTTAGA 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1096456311 12:51790199-51790221 AAATCCTGAGCTAAAAACAAAGG 0: 1
1: 0
2: 0
3: 41
4: 1229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096456310 Original CRISPR TCTAAGATCTTCCAGTCCCA AGG (reversed) Intronic
902630092 1:17699633-17699655 TCTAGGATCTAACAGGCCCACGG - Intergenic
902656544 1:17873072-17873094 TCTAAGATGGGCCTGTCCCATGG + Intergenic
902816940 1:18921930-18921952 GGTAATATCATCCAGTCCCAGGG - Intronic
903033402 1:20479239-20479261 GCCAAGATCTTCCCTTCCCAGGG + Intergenic
903857694 1:26346377-26346399 TCCAAGAACTTCCAGAGCCATGG - Exonic
904852875 1:33472583-33472605 TCTCAGACGTTCCATTCCCAGGG + Intergenic
905916782 1:41690016-41690038 TCTAAGATCTGAGACTCCCAAGG - Intronic
906504361 1:46367095-46367117 TCTGAGATCTTCTAATCCAAAGG - Intergenic
910401035 1:86838391-86838413 TTGAAGATCTTCTAGTCTCATGG + Intergenic
911069097 1:93817915-93817937 TCTTGGCTCTGCCAGTCCCAAGG + Intronic
912465320 1:109868799-109868821 TTTAAGTTCTTCCAGTCACCTGG - Intergenic
913489868 1:119368875-119368897 TCTAATGTCTTCCAGTCCTCAGG - Exonic
914990621 1:152496782-152496804 TCTGTGATGTTTCAGTCCCAAGG + Intergenic
915364342 1:155305995-155306017 TCCCAGATATCCCAGTCCCAAGG + Intergenic
915894963 1:159804661-159804683 TCCAAGATCTTGCAGTACCATGG + Intronic
920045469 1:203129532-203129554 GCTGAGCTCTGCCAGTCCCAGGG + Intronic
920232134 1:204477712-204477734 TCTAGATTCTCCCAGTCCCAAGG - Intronic
920689860 1:208137669-208137691 TCTAAGACCGGCCAGTCCCAGGG - Intronic
921534302 1:216326510-216326532 TATAAAATCTTTCACTCCCAAGG + Intronic
924627863 1:245710687-245710709 TCTATGACCTTCTAGTCCCAGGG - Intergenic
1065076361 10:22083611-22083633 TCTAAGCTCCTCCAATCCTATGG - Intergenic
1065172830 10:23049054-23049076 TTTAATATCTTCAAGGCCCAAGG - Intergenic
1066492392 10:35906419-35906441 TCTAAGTTGTTTCAGTCACATGG - Intergenic
1068887120 10:62109168-62109190 CCTAAGCTCTTCCTCTCCCATGG + Intergenic
1070276753 10:75014653-75014675 TCTAACAACTTCCTGTGCCATGG - Intronic
1071472051 10:85990611-85990633 TCTGAGCTCTTCGAGCCCCATGG - Intronic
1072235672 10:93451443-93451465 ACTAAGATCATTCTGTCCCACGG + Intronic
1072921233 10:99578906-99578928 TCTCAGATCATCCATTCCCCAGG + Intergenic
1074782401 10:116811447-116811469 TCTTAGATCTTCCAGGACCCGGG + Intergenic
1078220997 11:9351475-9351497 TCAAAGGCATTCCAGTCCCAGGG - Intergenic
1083040598 11:59681663-59681685 ACCAAGATATTCCATTCCCAGGG - Intergenic
1085664279 11:78399547-78399569 TCAAGGATCTGCCAGTCTCATGG - Intronic
1091260568 11:134230940-134230962 TCTTAGACCTTTCTGTCCCATGG - Intronic
1092673638 12:10891078-10891100 CCTGAGATCTTCCTGACCCAAGG - Intronic
1092684629 12:11028174-11028196 TCTTACATCATCCAGTCCCTTGG - Intronic
1092692673 12:11131076-11131098 TCTTACATCATCCAGTCCCTTGG - Intronic
1093834222 12:23806793-23806815 TCTAAACTTTTCCAGTCACAAGG + Intronic
1094769220 12:33635144-33635166 TTTAAGATCTTCCATTATCATGG - Intergenic
1094821607 12:34230584-34230606 TCTATGCTCCTTCAGTCCCATGG - Intergenic
1096119699 12:49080187-49080209 TCTTAGGTTTTGCAGTCCCAAGG + Intergenic
1096456310 12:51790177-51790199 TCTAAGATCTTCCAGTCCCAAGG - Intronic
1099827297 12:87792990-87793012 TCAAAGGTGTTTCAGTCCCATGG + Intergenic
1102525716 12:113511221-113511243 TCAAAGAGCTTACAGTCTCATGG - Intergenic
1102615779 12:114152818-114152840 TCTTTGATCTTCCAGCTCCAGGG - Intergenic
1104028002 12:125043193-125043215 CCTAAGTTCTTTCAGGCCCAGGG + Intergenic
1104723231 12:131058145-131058167 TCAAAGAACTTCTAGTCTCATGG - Intronic
1106547558 13:30743811-30743833 TCTAGGATCTTACAGTCTAAAGG - Intronic
1107087363 13:36440203-36440225 TCTAGGAACTTCCAGTGCCAAGG + Intronic
1108091512 13:46854651-46854673 TGTAAGATCTTACAACCCCAGGG - Intronic
1108520433 13:51242428-51242450 TCAAAGTCCTTGCAGTCCCAGGG + Intronic
1108969852 13:56360140-56360162 TCTAAGAACTTCCATTTTCATGG - Intergenic
1111757958 13:92422345-92422367 TCCAAGATCTTTCTGTACCAGGG + Intronic
1111866888 13:93779902-93779924 AGTAGCATCTTCCAGTCCCAGGG - Intronic
1113034297 13:106031905-106031927 TCTAAGAGCCTCCTCTCCCATGG - Intergenic
1113466387 13:110516392-110516414 TACAAGATGTTCCAGTCTCATGG - Intergenic
1116920788 14:50571316-50571338 TCCCATATCTCCCAGTCCCATGG - Intronic
1118501341 14:66365244-66365266 TCTATCTTATTCCAGTCCCAGGG - Intergenic
1120224132 14:81770974-81770996 TCTAAATTCATCTAGTCCCATGG - Intergenic
1122297707 14:100714537-100714559 TCCAGGAGCTTCCAGTCCCTGGG + Intergenic
1128245431 15:66129288-66129310 TCAGAGAACTTCCAGTCCAAGGG + Intronic
1129783134 15:78287930-78287952 TCTAATTTCTTCCTGTCCCCAGG + Intronic
1129930347 15:79405333-79405355 TATCAGATCTCCCAGTCACATGG + Intronic
1131183870 15:90258640-90258662 TCTAAGATATTCCTCTCCCATGG - Intronic
1131274484 15:90969411-90969433 TCTAATATCTACCAGTCTCTGGG - Intronic
1133536188 16:6704528-6704550 TCCAACAACTTCCAGACCCAAGG - Intronic
1135834896 16:25816289-25816311 TCTAAAATCCTCCAGACGCAAGG + Intronic
1136573004 16:31108172-31108194 TCTAAGATCTTCCAGCTCCCAGG + Intronic
1139308820 16:66011137-66011159 ATTAAGATCTTCCTGGCCCATGG + Intergenic
1139331758 16:66197750-66197772 TCTTAGACCTACCAGTCACAAGG + Intergenic
1141428795 16:83960444-83960466 TCTGAGACCCTCCAGTGCCAGGG + Intronic
1143401416 17:6646881-6646903 ACTAAGACATTCCATTCCCAGGG - Intronic
1143456701 17:7072472-7072494 TCCAAAATCTTTCAGACCCAGGG + Intergenic
1144592350 17:16535562-16535584 TGTAAGATCTTCCCACCCCAAGG - Intergenic
1144849264 17:18235789-18235811 GCCCAGATTTTCCAGTCCCAGGG - Intronic
1147120462 17:38332475-38332497 TCTAAGACCTGCCAGGTCCAGGG + Intronic
1148523577 17:48306910-48306932 TCTAATATTTTCCAGTGTCATGG - Intronic
1148928084 17:51105190-51105212 TCTAAGAATTTCTATTCCCAGGG - Intronic
1150228129 17:63534753-63534775 TCTCATAGCTTCCAGTCCCACGG + Intronic
1151402206 17:73863126-73863148 TCTCAGGTCGTCCACTCCCAAGG - Intergenic
1153505361 18:5791124-5791146 TCTCAGATCCTCCATCCCCACGG - Intergenic
1154966386 18:21361418-21361440 TCTAAGGTATTGCAGACCCAAGG + Intronic
1155477725 18:26251084-26251106 TCTAAGTGTTTCCAGTCCTATGG + Intronic
1155540276 18:26862798-26862820 TCAAAGATCATCCAGTTTCACGG + Intronic
1157710872 18:49848847-49848869 TCTAAGACCTTCCAGTCTAGAGG + Intronic
1157761359 18:50268115-50268137 TCTTTGATCTTCGAGTCCAACGG + Intronic
1158240529 18:55372354-55372376 TCTAGGATGCTCCAATCCCAGGG + Intronic
1159028824 18:63210289-63210311 CCTGAGATCTTCCACCCCCAAGG - Intronic
1163386103 19:17001504-17001526 TCTAAGTTCTTCCCTCCCCAAGG - Intronic
1166085964 19:40475279-40475301 TCTAAGATGTTAAGGTCCCAAGG - Intronic
1166094819 19:40531938-40531960 TCTATGGTCTTAGAGTCCCAGGG + Intronic
1166194235 19:41195566-41195588 TCTAAATTCCTACAGTCCCAGGG - Intronic
1166670858 19:44708854-44708876 TCTAAGAGCTCCCAGTCTGATGG - Intronic
1167824317 19:51958289-51958311 ACTGAGATATTCCATTCCCAGGG - Intergenic
1167913730 19:52724020-52724042 ACCAAGATATTCCATTCCCAGGG + Intronic
1167940891 19:52945041-52945063 TCTGAGACATTCCATTCCCAGGG + Intronic
925221011 2:2141065-2141087 TGTAAGATATTCAAATCCCATGG + Intronic
926400410 2:12490733-12490755 TCAAAGAGCATCCAGTCCAATGG + Intergenic
927338856 2:21957332-21957354 TCCAAGATCTCTCAGTCACATGG + Intergenic
930785875 2:55270940-55270962 TTTAAGATCTACCACTCCCCTGG + Intergenic
930906376 2:56573141-56573163 TCTAACATCTTCACATCCCAAGG + Intergenic
932140481 2:69273099-69273121 TCTAATCTGTTCCAGTCTCAAGG - Intergenic
933148606 2:78887849-78887871 TCGAAAATCTTCCTCTCCCAGGG - Intergenic
935414929 2:102805303-102805325 ACTAAGATGTTCCAGACTCAAGG - Intronic
935708937 2:105880579-105880601 TCTAAGACCATCCAGTCTTAGGG - Intronic
939437574 2:142198727-142198749 TCTAGGCTCTTCTGGTCCCAGGG + Intergenic
942371064 2:175285630-175285652 TCCAAGCTATTCGAGTCCCAAGG - Intergenic
943912776 2:193590017-193590039 TCTAAAGACATCCAGTCCCATGG - Intergenic
944499386 2:200342570-200342592 GCTGAGCTCTTACAGTCCCATGG + Intronic
946809179 2:223504731-223504753 TCTCAGATTTTCCAGTCATATGG - Intergenic
948712362 2:239833152-239833174 TCGAAGTTCTTCCAGTTCCGAGG + Intergenic
1169151084 20:3290053-3290075 TCTAAGGTTTTCCAGTGCCTAGG + Intronic
1169224143 20:3846149-3846171 CCTACGATCTTCCAGGCACAGGG - Intergenic
1170208246 20:13822680-13822702 TCTGAGATCATCCTGTCCAATGG - Intergenic
1171142187 20:22752946-22752968 TCTAGCACCTTCCAGTGCCATGG - Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172916937 20:38450344-38450366 TCTAACAGTTTCCAGACCCAAGG - Intergenic
1172963631 20:38817111-38817133 TCTGAGAGCATCCAGTCCAATGG + Intronic
1173783534 20:45775742-45775764 TCTGAGATCCTCCAGCGCCATGG - Intronic
1177144043 21:17388335-17388357 TCTAAGATGGTTCATTCCCATGG + Intergenic
1178129453 21:29555151-29555173 TCCAATATTTTCCACTCCCAGGG + Exonic
1180723356 22:17926039-17926061 AGTAAGACCTTACAGTCCCATGG - Intronic
1182780679 22:32864970-32864992 ATTAAGATCTTCCATTCCCTGGG - Exonic
1185164793 22:49254929-49254951 CCTGCGATCTTCCAGGCCCACGG + Intergenic
950126527 3:10513316-10513338 GCTAAGCTTTTCCAGTCTCAGGG - Intronic
951869820 3:27349049-27349071 TCAAGGAGCTTACAGTCCCATGG + Intronic
952307588 3:32159725-32159747 TCTCAGGACTTCCAGCCCCACGG + Intronic
953811568 3:46117140-46117162 GCCAAGCTCTCCCAGTCCCATGG + Intergenic
957215379 3:77313924-77313946 TCTAAGGTCTACCAGTCCTTGGG + Intronic
958818668 3:98947478-98947500 TCTAAGGGATGCCAGTCCCATGG + Intergenic
959653832 3:108778612-108778634 TCAAACATCTACCAGGCCCAGGG - Intergenic
963024286 3:140903010-140903032 TTTAAGCTCTTCAAGTCACAGGG + Intergenic
963719879 3:148850231-148850253 TCTAACACCTTCCAGTCCAGTGG + Intronic
963755301 3:149228651-149228673 TCTATCATCTTCCAATCCTAAGG + Intergenic
965570769 3:170169975-170169997 TCTAACATCTTCAAGTCATAGGG + Intronic
967247924 3:187506492-187506514 TCTAATATCTGCCATTCTCATGG - Intergenic
971324754 4:25634732-25634754 GCTAAGAGATTTCAGTCCCATGG - Intergenic
976037332 4:80839849-80839871 TCTGAGACCTTCAAGTCCCTAGG + Intronic
976754355 4:88482496-88482518 ACTGAGATCCTCCAGTCTCAGGG - Intronic
977634636 4:99282917-99282939 TCAAAGATCATCCAGTCGCCTGG - Intronic
977637332 4:99314415-99314437 TCAAAGATCATCCAGTCCCCTGG - Intronic
977639738 4:99343384-99343406 TCAAAGATCATCCAGTCCCCTGG - Intronic
978248730 4:106605163-106605185 TCTAATATCTTCCATTAGCATGG + Intergenic
979258015 4:118624501-118624523 TCTACCATCTTACAGTTCCAGGG - Intergenic
979579254 4:122336617-122336639 TCAAAGAGATTCCAGTCCAAGGG - Intronic
980137109 4:128868814-128868836 TCTAAGACCTACCTGTTCCATGG - Intronic
983019619 4:162659560-162659582 GCCAAGATATTCCAGCCCCAGGG + Intergenic
983070163 4:163258103-163258125 TCTAAGAACTTCCATTTCAAGGG + Intergenic
983073389 4:163295463-163295485 TCCAAGAATTTCCAGTCTCAAGG - Intergenic
984082194 4:175261046-175261068 TGTAAGATCATTCAGTCTCATGG - Intergenic
984694510 4:182766183-182766205 TCTGAGCACTTCCAGACCCATGG + Intronic
985919012 5:2952646-2952668 TTAAAGATCTTCCACTTCCATGG + Intergenic
987319835 5:16758335-16758357 TCTTAGTTCTTCCAGGCCTAGGG - Intronic
987370470 5:17188147-17188169 GCTGAGACCTTCCTGTCCCAGGG + Intronic
987851831 5:23364526-23364548 GCTAAGATCGTCCACTCCCATGG + Intergenic
992203302 5:74404964-74404986 TCTTTGATCTTCCAAACCCAGGG - Intergenic
992271779 5:75071861-75071883 TCTAGGAACTGCCAGTGCCATGG - Intronic
992301559 5:75387231-75387253 TCTAGGAACTGCCAGTGCCATGG - Intronic
994475479 5:100263038-100263060 TCTAAGATTATCCAATCCAAGGG - Intergenic
995376749 5:111482486-111482508 TCAAAGAACTTCCAGTCCACAGG + Intronic
996304699 5:122033780-122033802 TCTAAGGTCTTCCAGGCAAATGG - Intronic
996587115 5:125101478-125101500 TCTTAGATCTTCACTTCCCAGGG + Intergenic
1001253440 5:170166112-170166134 TCAAAGATCTTACAGTCTAATGG + Intergenic
1001956698 5:175852724-175852746 CCTCAGCTCTTCCAGTACCAGGG - Intronic
1002212328 5:177606356-177606378 GCAAAGAGCTTCCATTCCCATGG - Intronic
1003014609 6:2457909-2457931 TCTGAGAATTTCCATTCCCAAGG + Intergenic
1006960169 6:37921330-37921352 ACCAAGCTCTTCCAGTCCTATGG - Intronic
1007660015 6:43478153-43478175 TGTAATTTCTTCCAGTCCCTGGG - Exonic
1008422014 6:51312083-51312105 ACTAGGAAATTCCAGTCCCATGG - Intergenic
1010302546 6:74279056-74279078 TCTAAGATGTTTCACTCACATGG + Intergenic
1023312320 7:38900649-38900671 TCTCAGATCTTCCTGCCTCACGG - Intronic
1029171324 7:98631073-98631095 TCAAAGCTCTTCCAGTTGCAGGG - Intergenic
1030955334 7:115844885-115844907 TCTAGGATATTCCATTCCCCTGG - Intergenic
1032558181 7:132859821-132859843 GCGAAGCTCTTCCAGTCTCATGG + Intronic
1032577078 7:133066568-133066590 TCTAAGAGCTTTCAGTGCCCAGG + Intronic
1033945487 7:146711503-146711525 TCTAAGCTGTTCCAGGCACATGG - Intronic
1033945623 7:146714315-146714337 TCTAAGCTGTTCCAGGCACATGG - Intronic
1034308090 7:150062673-150062695 TCTAACATCTTAGATTCCCAAGG + Intergenic
1034798763 7:154037998-154038020 TCTAACATCTTAGATTCCCAAGG - Intronic
1035464396 7:159065138-159065160 TCTCAGATCTTCCACTCCCCAGG - Intronic
1036392592 8:8337322-8337344 ACAATTATCTTCCAGTCCCATGG - Intronic
1037241429 8:16783187-16783209 TCAAAGATGTTTCAGTCCCCAGG - Intergenic
1040069368 8:43177883-43177905 TCAAAAACCTTCCAGCCCCATGG + Intronic
1044673177 8:94703641-94703663 TCTAATAACTGACAGTCCCAGGG + Intronic
1045713383 8:105012671-105012693 TCTAGGAGCTTCCAGTCCAATGG + Intronic
1046195915 8:110862223-110862245 TCTAACATCTTCCAAGCCCAAGG + Intergenic
1046340956 8:112853573-112853595 TTTGAGATCTTTCAGTCTCATGG + Intronic
1047421114 8:124709207-124709229 TCTAAGAGCTTCCAGTGTCTTGG - Intronic
1054702474 9:68427150-68427172 ACTAAGCTCTTCCACTGCCAGGG - Intronic
1056471173 9:86905490-86905512 TCTGAGCTCCTCCAATCCCATGG - Intergenic
1057098864 9:92338813-92338835 TACAAGATCATCCAGCCCCAAGG - Intronic
1058127469 9:101211442-101211464 TCTAAGACCACACAGTCCCATGG + Intronic
1058535795 9:105958629-105958651 GCTAAGATTTTCAAGTCCTAGGG + Intergenic
1059263393 9:113002047-113002069 TCTGACATCTTCCAATGCCACGG + Intergenic
1060117162 9:120951104-120951126 ACTAAGATTTTCCACTTCCAGGG - Intergenic
1187501136 X:19839708-19839730 TCCAAGCTCTTCTAGACCCAAGG + Intronic
1192172354 X:68864979-68865001 TTGAAGATCTTGCAGTCCAAGGG + Intergenic
1192595895 X:72407954-72407976 TCTAAGAGTTTCAAGGCCCATGG + Intronic
1193565555 X:83072022-83072044 TCAAAGAACTTGCAGTCTCATGG + Intergenic
1199034769 X:143036878-143036900 TCTAAGATCTTTCAATGCTAGGG + Intergenic
1202299241 Y:23393949-23393971 GCTAGGATTTTCCAGTGCCAAGG - Intergenic
1202571568 Y:26276649-26276671 GCTAGGATTTTCCAGTGCCAAGG + Intergenic