ID: 1096456667

View in Genome Browser
Species Human (GRCh38)
Location 12:51793047-51793069
Sequence GATTTAAAACAAATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 351}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096456667_1096456672 17 Left 1096456667 12:51793047-51793069 CCATGATCCATTTGTTTTAAATC 0: 1
1: 0
2: 2
3: 35
4: 351
Right 1096456672 12:51793087-51793109 ATGAGGACTGCATTGGATGAGGG 0: 1
1: 0
2: 0
3: 10
4: 197
1096456667_1096456671 16 Left 1096456667 12:51793047-51793069 CCATGATCCATTTGTTTTAAATC 0: 1
1: 0
2: 2
3: 35
4: 351
Right 1096456671 12:51793086-51793108 TATGAGGACTGCATTGGATGAGG 0: 1
1: 0
2: 0
3: 22
4: 1086
1096456667_1096456669 0 Left 1096456667 12:51793047-51793069 CCATGATCCATTTGTTTTAAATC 0: 1
1: 0
2: 2
3: 35
4: 351
Right 1096456669 12:51793070-51793092 ATTACACTTGCTATTATATGAGG 0: 1
1: 0
2: 0
3: 23
4: 197
1096456667_1096456670 10 Left 1096456667 12:51793047-51793069 CCATGATCCATTTGTTTTAAATC 0: 1
1: 0
2: 2
3: 35
4: 351
Right 1096456670 12:51793080-51793102 CTATTATATGAGGACTGCATTGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096456667 Original CRISPR GATTTAAAACAAATGGATCA TGG (reversed) Intronic
903024126 1:20415080-20415102 GATTTTAAAGAAAATGATCAAGG + Intergenic
903092969 1:20939425-20939447 CATTTCAAACAAATGTACCATGG + Intronic
903842273 1:26251930-26251952 GATTTAAAACATATTGCTTATGG + Intronic
906531745 1:46527574-46527596 GATTCAATGCATATGGATCAGGG + Intergenic
907779037 1:57547762-57547784 TATTTTGAACAAATGCATCATGG + Intronic
907911124 1:58827260-58827282 TTTTTAAAACAAATACATCATGG - Intergenic
908933889 1:69350930-69350952 GATTTTAATCAAATGCACCAAGG + Intergenic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
909818083 1:80022412-80022434 CATTTTAAAAAAATGGCTCATGG + Intergenic
910553184 1:88499407-88499429 GGTTACAAACAAAAGGATCAAGG - Intergenic
911289203 1:96035834-96035856 CATTCAATACAAATGGATTAAGG + Intergenic
913845913 1:123511231-123511253 CATTTCCAACGAATGGATCAAGG - Intergenic
914797404 1:150932083-150932105 GATTTAAAAAAAAAAGATCTTGG + Intronic
918538287 1:185599552-185599574 GACTTAAAACAACTGCAGCAAGG + Intergenic
919405728 1:197180630-197180652 GCTATAAAACAGATGGATCAAGG - Intronic
919490031 1:198195375-198195397 GATTTAAAAGGAATGTATTATGG + Intronic
919700650 1:200628075-200628097 CCTTTAAAACAAAGGGAGCATGG - Intronic
920868432 1:209772690-209772712 GATTTTTATCAAATGGCTCAGGG - Intronic
920889148 1:209965818-209965840 GATTTGATACAAAAGGATAAAGG - Intronic
920914176 1:210246214-210246236 GGTTTAAAATAAATGCATTAAGG + Exonic
922400486 1:225249244-225249266 GAAATAAAAAAGATGGATCAAGG + Intronic
922521626 1:226257881-226257903 GATTAAAAGTAAATGGATGAAGG + Intronic
923193534 1:231642516-231642538 GATTGATACCAAATGTATCATGG + Intronic
923911844 1:238456345-238456367 GTTTTCAAACAAATGCTTCAGGG - Intergenic
924481301 1:244437136-244437158 AATTTTAAGCAAATGGAACATGG + Intronic
924632233 1:245751949-245751971 GATTAAAAACAAATGTTTGATGG + Intronic
924650659 1:245924160-245924182 GTTTTATAAAACATGGATCAGGG - Intronic
1062981910 10:1731296-1731318 GATTTAAAAGGAATGGAGGACGG - Intronic
1063479573 10:6362763-6362785 GATTTAAAAAAAAGGGCTTAAGG + Intergenic
1064961237 10:20967257-20967279 GAGTTAAAATAAGTGAATCATGG + Intronic
1066003452 10:31125930-31125952 GATTAAAAAAAAAAGAATCATGG + Intergenic
1068465791 10:57389140-57389162 GTTTTAAAAAAAATCTATCACGG + Intergenic
1068797205 10:61096712-61096734 GATTTAGAACAAATGAAGCAAGG + Intergenic
1069036433 10:63650377-63650399 GATCTAAAAATCATGGATCATGG + Intergenic
1069095656 10:64256677-64256699 GAGTTAACACAACTGGATGAAGG - Intergenic
1069891356 10:71654505-71654527 TTTTTAATACAAATGGCTCATGG + Intronic
1071642709 10:87328942-87328964 GATTGAAGACAAATCCATCACGG + Intergenic
1071965574 10:90848574-90848596 GATTTAAAATAATTGGATGAAGG + Intronic
1071998434 10:91169912-91169934 AAAATTAAACAAATGGATCATGG + Intronic
1072187818 10:93059523-93059545 GATTTAAAACAAGTGCTTCCTGG + Intergenic
1072250146 10:93575466-93575488 GATGTAAAACCAATGGAATATGG - Intronic
1072909500 10:99487281-99487303 CATTAAAAACAAATGAATCATGG + Intergenic
1075523774 10:123164926-123164948 GAATTAAAAAAAATACATCACGG - Exonic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1077865869 11:6221310-6221332 TATTTTAAACACATGGATCCAGG + Intronic
1078454972 11:11467836-11467858 GATTTAGAACCACTGGATTAAGG + Intronic
1078875217 11:15387815-15387837 GATTTAAAACATATAAATAATGG - Intergenic
1079281015 11:19087148-19087170 GACTTAAAACAAATGATCCAAGG - Intergenic
1079638746 11:22778197-22778219 GATTTTAAATAACTTGATCAAGG - Intronic
1081120657 11:39261504-39261526 GACTTAAAACAAATGCTTAAGGG + Intergenic
1081819176 11:45975011-45975033 GATTTAAAACAGATGGACTCAGG + Intronic
1086607311 11:88711105-88711127 GACCTAAAACAAAGGGATAATGG + Intronic
1087186808 11:95208095-95208117 TTTTTAAAAAAAATGAATCAAGG + Intronic
1087905540 11:103692617-103692639 GATTTAAGAAAAAAGGATCTTGG - Intergenic
1089186258 11:116617227-116617249 GATTTTAAACAAATCTAACATGG + Intergenic
1089273788 11:117319639-117319661 GATTCAAAACAAATGAAGCTGGG + Intronic
1089382104 11:118041553-118041575 GACCTATAACCAATGGATCAAGG + Intergenic
1090436555 11:126691835-126691857 GATTTAAAAAAAATGGGAAAAGG + Intronic
1091126575 11:133104810-133104832 GATTTTAATTAAATGGATCATGG + Intronic
1092056343 12:5511310-5511332 AATTTAAAACAGGAGGATCAGGG + Intronic
1094172843 12:27512225-27512247 GGAGTGAAACAAATGGATCATGG + Intergenic
1094454057 12:30612911-30612933 GATTTTAAAAAAATGTATCAGGG - Intergenic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1096019304 12:48308862-48308884 ATTTTAAGGCAAATGGATCATGG + Intergenic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1096950838 12:55468769-55468791 AATGTGAAACAAATGCATCATGG - Intergenic
1097495309 12:60324330-60324352 GAATTAAAATAAATGTATAAAGG + Intergenic
1097807725 12:63984597-63984619 GATTTAAAACAAAAGTTTTAAGG + Intronic
1097852385 12:64425593-64425615 CATTTAAAAGAAATGGAGGAGGG - Intronic
1097946173 12:65370752-65370774 TATTTAAAAAAAATCTATCATGG + Intronic
1098459590 12:70718239-70718261 GATTTAAAATAAATACCTCATGG + Intronic
1098740033 12:74161806-74161828 TATTTAAAACAAATTAATGAGGG + Intergenic
1099403739 12:82233523-82233545 TATTTATTACAAATGGATCTTGG - Intronic
1099499413 12:83393522-83393544 GCTTTAAAACAAAAGGCTGAGGG + Intergenic
1105416861 13:20220865-20220887 GATTTAAAAGGAAAGGAACAGGG + Intergenic
1107917241 13:45165284-45165306 GATATAAATCTAATGGATAATGG - Intronic
1108943947 13:55997769-55997791 ATTTTAAAACAAATTAATCATGG - Intergenic
1109813180 13:67542766-67542788 GATTTATAACACATAGATCAAGG - Intergenic
1111224129 13:85247072-85247094 CATTTAAAACAAATGGATCTTGG - Intergenic
1111812153 13:93104593-93104615 GATGTAAAAAAAAATGATCAGGG + Intergenic
1112151271 13:96767139-96767161 GATATAAAACACAAAGATCACGG - Intronic
1112745296 13:102520773-102520795 GATTCAAAATAAATGACTCAGGG + Intergenic
1114966644 14:27969467-27969489 GGTTCAAAATAAATGGATGAAGG + Intergenic
1115955095 14:38768909-38768931 GCTTTAAAACATATTGATTATGG - Intergenic
1116281789 14:42917470-42917492 GCTTTAAAAGAAATGCATAAAGG - Intergenic
1117575084 14:57089659-57089681 GATATAAAACAAATTGATCTTGG + Intergenic
1117815543 14:59593839-59593861 GATTTTTCACAAATGGAACATGG - Intergenic
1119565280 14:75623748-75623770 GATTTAAAAAAAAATAATCAGGG + Intronic
1119894672 14:78209803-78209825 AATTTAAAACAAAGGGTTCAGGG - Intergenic
1120037936 14:79719120-79719142 GATTTCAAACAAAGGGACGAAGG - Intronic
1120628493 14:86859098-86859120 AAATTCAAACAAATGGATCATGG - Intergenic
1120694707 14:87631663-87631685 GATTTAAAAAAAGTGAGTCATGG - Intergenic
1120837043 14:89049264-89049286 GATTAAAAGTAAATGGATCGAGG + Intergenic
1121034491 14:90689129-90689151 GATTTTAAACAAAAGGATCAAGG + Intronic
1121784985 14:96650919-96650941 GATTTATAACAAAGGTGTCAAGG - Intergenic
1121911635 14:97797281-97797303 GATTTAGAACAAGTGGAAAAAGG - Intergenic
1125157508 15:36605122-36605144 TATTTAAAAGAAATGCATCTAGG - Intronic
1125800994 15:42446841-42446863 GATTTAAAAAAAAAGAATCCAGG + Intronic
1126730116 15:51673986-51674008 GATTAAACCCACATGGATCAAGG + Intergenic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127237039 15:57065079-57065101 GATTTAAAATAAATTAAACATGG - Intronic
1128623556 15:69174841-69174863 GACTTTAAAAAAATGGATCAGGG - Intronic
1130464070 15:84181865-84181887 GATTTAAACAAAATGTATCAGGG - Intronic
1130500197 15:84491676-84491698 GATTTAAACAAAATGTATCAGGG + Intergenic
1130586366 15:85186497-85186519 GATTTAAACAAAATGTATCAGGG - Intergenic
1130786355 15:87100852-87100874 GATACAAAACAAAAGTATCAAGG - Intergenic
1130963905 15:88683125-88683147 GATTTAAAAAAAATGTCTCCAGG - Intergenic
1131462206 15:92625404-92625426 CATTTAAATCAGATGAATCATGG - Intronic
1132371408 15:101301961-101301983 AGTTTAAAACAAATGCATCATGG + Intronic
1133329021 16:4959645-4959667 GATAGAAAACAAAGGTATCAGGG + Intronic
1133952636 16:10409486-10409508 AATAAAAAAAAAATGGATCAAGG - Intronic
1134769660 16:16796442-16796464 GATTGGAAACAAAGGGATAATGG + Intergenic
1135277774 16:21128272-21128294 GATTTAAAACAAAGAGTTTATGG + Intronic
1138715588 16:59018177-59018199 GATTTAAGACATTTGGCTCAGGG + Intergenic
1138855180 16:60682089-60682111 GATTTAAAAGAAATGTTTCCAGG - Intergenic
1139292263 16:65869677-65869699 GCTTTAAAACAAATGGGTTTGGG + Intergenic
1140177394 16:72676256-72676278 GCTGTATAACAAATGGGTCAAGG + Intergenic
1140574450 16:76149427-76149449 GTTTTTAAACAAATGAATCAAGG - Intergenic
1143894431 17:10125215-10125237 AATTTAAAAAAAATAGGTCAAGG + Intronic
1147491425 17:40870885-40870907 GAAATTAAACAAATGGATCATGG - Intergenic
1148377864 17:47165796-47165818 AATTTAACTCAAATGAATCATGG - Intronic
1150700426 17:67442540-67442562 GATTAAAAAAAAATGCATTATGG + Intronic
1151257832 17:72893160-72893182 GAATGAAAACATATGGACCAGGG + Intronic
1154003060 18:10501410-10501432 GATCAGAAACATATGGATCATGG - Intergenic
1155568819 18:27167460-27167482 GTCCTAAAACAAATGGCTCAAGG + Intronic
1155889895 18:31254839-31254861 GATTTAAAAAAAATGTACAAAGG - Intergenic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1156804118 18:41155963-41155985 TATTTAAAACTAATGGGACATGG + Intergenic
1157175154 18:45445022-45445044 AATGCAAAACAAATGGATGATGG + Intronic
1158532335 18:58274670-58274692 GATTCAAAAGAACTGGATCTTGG - Intronic
1158542316 18:58368350-58368372 TATTTAAAGCATATAGATCATGG + Intronic
1159299992 18:66550839-66550861 GGCTTAAAACAAATGTATTATGG - Intronic
1164138160 19:22433049-22433071 GAGTAAAAACAATTGGTTCAGGG + Intronic
1166395807 19:42440009-42440031 GTTTGAAAACAATTGGATGAAGG + Intronic
1168167161 19:54557379-54557401 GATTTAGTACAAATGAATCTGGG + Intergenic
924987480 2:285450-285472 GAATTAAAAAAAATGGGTTAGGG + Intronic
925532564 2:4881045-4881067 AATTGTAAACAAATGGAACATGG - Intergenic
926438046 2:12857594-12857616 GTTTTAAAACAAAGGGATAAAGG + Intergenic
927612177 2:24551926-24551948 GATTTCAAACAAAAGTACCAGGG - Intronic
927837424 2:26411003-26411025 GATTTAAAAAAATTGGAACTTGG - Intronic
928817251 2:35312988-35313010 TCTTTAAAACAAATAGAACAAGG + Intergenic
930858998 2:56050439-56050461 ACTTTAAAACAAATGGCTCTTGG - Intergenic
932302514 2:70677160-70677182 TATTTAAAACAAATTCCTCAGGG - Intronic
932444929 2:71773778-71773800 GTTTTAAAATAAATGGATTCGGG - Intergenic
933242233 2:79934850-79934872 GATTTAGAATAAATGCACCAAGG + Intronic
933464393 2:82634079-82634101 GATTCAATACAAAGGGAACAGGG + Intergenic
935025054 2:99268873-99268895 GACTTAAGACAAATGCTTCAAGG - Intronic
935139358 2:100339084-100339106 GAGTTAACCCAAATGGATGAGGG + Intergenic
935445027 2:103147224-103147246 GAGTTTAAAGAAATAGATCAAGG + Intergenic
935527774 2:104192598-104192620 CATTTAAAACAAATGGAGTCGGG + Intergenic
936729698 2:115365835-115365857 GAATTAAAATAAATGAATCCTGG + Intronic
937183385 2:120015636-120015658 TATTTAAAACAACTGTATTATGG + Intronic
937503747 2:122512932-122512954 GTTTCAGAACAAATGGATGAGGG + Intergenic
938079511 2:128362221-128362243 GATTTAACACATATGGCTGAAGG + Intergenic
938684691 2:133726763-133726785 TATTAAAAAAAAATGGATAATGG + Intergenic
939257792 2:139766749-139766771 GACTTAAAACATTTGGATTAAGG - Intergenic
939645116 2:144688083-144688105 GATTCAATTCAAATGGATTATGG + Intergenic
939680486 2:145125301-145125323 AATTAAAAAAAAATGCATCATGG + Intergenic
940491031 2:154361019-154361041 TATGTAAAACAATTGGAGCATGG + Intronic
941663020 2:168215025-168215047 TGTTGAAAACACATGGATCATGG - Intronic
941755473 2:169181238-169181260 CTTTTAAATCATATGGATCAGGG - Intronic
942007933 2:171726399-171726421 TATTTAAAATTAATGGATGATGG + Intronic
942179176 2:173363626-173363648 GATTTAAAAAAAGTAGTTCAGGG - Intronic
942707872 2:178797543-178797565 GGATTAAAAGAAATGGATCTGGG - Intronic
943590300 2:189788055-189788077 GATTTAAAAAAAAAAGATCTTGG + Intronic
943748324 2:191485486-191485508 GATATAAAAGATATGGCTCAAGG + Intergenic
944613435 2:201434841-201434863 ATTTGAAAACAAATGGATGATGG - Intronic
945001451 2:205355340-205355362 TTTATAAAACAAATGCATCATGG - Intronic
945086150 2:206134651-206134673 GATACAAAACAAATGGAAAAAGG + Intronic
945181083 2:207091883-207091905 GGATGAAAACAAATGTATCATGG - Intronic
945186339 2:207143825-207143847 GATTCAAAACAAAAGCTTCAGGG + Intronic
945751995 2:213798726-213798748 AATTAAATAAAAATGGATCACGG - Intronic
947779257 2:232742703-232742725 GATTTAAAACTAATAGGACATGG + Intronic
948842664 2:240662754-240662776 GATTTATTACAAATAGATCTTGG - Intergenic
1169648618 20:7842306-7842328 GTTTTAAAAAAAATGGCTTATGG + Intergenic
1169755570 20:9039787-9039809 GGCTTAAAACAAATGGGCCATGG - Intergenic
1171127732 20:22618756-22618778 GACTAAAAACAAAAGCATCAAGG - Intergenic
1173017802 20:39242252-39242274 AAATTTAAAAAAATGGATCATGG + Intergenic
1174067266 20:47874686-47874708 GATTTAATACACATGGAGTACGG + Intergenic
1174157032 20:48522187-48522209 GATTTAATACACATGGAGTATGG - Intergenic
1175572911 20:60037526-60037548 GCTTGAGAACAAATGGACCAAGG + Intergenic
1175760080 20:61556543-61556565 AATTGAGAACAAATGGAACAAGG + Intronic
1176713163 21:10325833-10325855 CATTTAAAAAATATGGATCTTGG - Intergenic
1177056544 21:16311341-16311363 TATTTAAAGCAAATAGAACATGG - Intergenic
1177685641 21:24434331-24434353 GACAGAAAACAAAGGGATCAAGG - Intergenic
1177918550 21:27122836-27122858 GATCTAAAACAGCTGGTTCAAGG + Intergenic
1179205543 21:39273745-39273767 TATTTAAAAAAAATGGTTTAGGG - Intronic
1179321144 21:40292055-40292077 GATTTAAAAAAAAAAAATCAGGG - Intronic
1182986475 22:34722792-34722814 GATTTAAAAGAAACAGGTCATGG - Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1185144099 22:49120190-49120212 GATTTAAAAAATATAGATCCTGG + Intergenic
949318040 3:2778315-2778337 TCTTTAAAACAATTGTATCATGG - Intronic
950823831 3:15793763-15793785 CATTTAAAACAAATAAATCATGG + Intronic
951201476 3:19879829-19879851 GTTTTAAAACATATAAATCATGG - Intronic
951514858 3:23547595-23547617 GATTTATAACTAATGCAGCATGG + Intronic
952272181 3:31843882-31843904 GATTTAGAACTAATGGTCCAGGG - Intronic
953505174 3:43479038-43479060 GTTATTAAACAAAAGGATCAGGG - Intronic
953505181 3:43479122-43479144 GTTATTAAACAAAAGGATCAGGG - Intronic
953529903 3:43731126-43731148 ACTTTAAAAAAAATGGATTAGGG - Intronic
955804988 3:62724412-62724434 GTTTAAAAACAAATGAATCAAGG + Intronic
957009961 3:74993010-74993032 GATTTAAAGCAATTGGAAGATGG - Intergenic
957125155 3:76149376-76149398 GGTTTAGATCAAAGGGATCAAGG - Intronic
957241162 3:77663007-77663029 GATGTAAAACAAATACATCAGGG + Intergenic
957397435 3:79660384-79660406 AATGTAAGACACATGGATCAGGG + Intronic
958498730 3:94878122-94878144 GATTTAAAAGAAATGGCTGTAGG - Intergenic
958663659 3:97106010-97106032 GGCTCAAAACAAAGGGATCATGG - Intronic
959084062 3:101832891-101832913 AATTAAAAACAAATTCATCATGG - Intronic
959231265 3:103654986-103655008 GATTGAAAAAGAATGGATGATGG + Intergenic
959307399 3:104687006-104687028 TATTTATAACAAATATATCAGGG - Intergenic
959400239 3:105892033-105892055 GAATTAAAACAACTTGATCAAGG - Intergenic
959455592 3:106557047-106557069 GATTTCAAACATAGGGCTCAAGG + Intergenic
959624515 3:108433906-108433928 GATTTACACTAAATGGATAATGG - Intronic
960082448 3:113555579-113555601 GATTATAAACAAAAGGATGAAGG + Intronic
961851749 3:129826618-129826640 TATTTAAAACATATAGATAATGG - Intronic
962947988 3:140189785-140189807 ACTTTTAAACAAATGGATGAGGG - Intronic
963453171 3:145510497-145510519 GATTATTAACAAATGGAGCATGG + Intergenic
964197120 3:154077807-154077829 GATTCATAACAAATAGAACAGGG + Intergenic
964295756 3:155231430-155231452 TATTAAACACAAATGTATCATGG + Intergenic
964543811 3:157810368-157810390 CATTAAAAACAAATGAATCTGGG + Intergenic
964955405 3:162349557-162349579 AATTTAAAACTAATTGATCTTGG - Intergenic
965494694 3:169383541-169383563 GATTTGAAAGAATTGGATGAAGG - Intronic
967377718 3:188824212-188824234 GATTTAAAAGAAATGACTCCTGG + Intronic
967378947 3:188836009-188836031 GATTTAGAACAAATGCATTTGGG + Intronic
968420644 4:481496-481518 GATTTTTAATAAATGGACCAAGG - Intronic
970526633 4:16939061-16939083 GATCTAAAACAAATGTGTAATGG - Intergenic
970816931 4:20167835-20167857 GATTTAAGTAAAATGGCTCAGGG + Intergenic
970915141 4:21323647-21323669 TATCAAAAACAAATGGATAAAGG - Intronic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
971940126 4:33203174-33203196 GATTTAATACAAATGGAGGAAGG - Intergenic
972127354 4:35785321-35785343 GATTTAAAAAAAAAAGAACAAGG - Intergenic
973218798 4:47701856-47701878 GATTTAAAAAAAATGCTTCCAGG - Intronic
974263199 4:59551564-59551586 CATTTTAAAAAAATGGATTAAGG + Intergenic
974412593 4:61561493-61561515 TTTTTAAAACAAATGATTCAGGG + Intronic
974431913 4:61809366-61809388 AATTTAAAATAAATGGGTTAGGG + Intronic
974451886 4:62073911-62073933 TAATTAAAAAAAATGGATAAAGG + Intronic
975167622 4:71195642-71195664 TTTTTAAAACAAATGCATCCAGG + Intronic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
975893879 4:79062671-79062693 AATTTAAAAAAAATGGATAATGG + Intergenic
976799558 4:88973577-88973599 GATTTAAAACAATAGGATAAGGG - Intronic
976901463 4:90181926-90181948 GATTTAGAAAAAATGGAGGATGG + Intronic
977357447 4:95965495-95965517 AATTTAAAACAATAGGATCGGGG - Intergenic
978329900 4:107601077-107601099 AATTTAATACAAATGGGCCAAGG + Intronic
978802674 4:112770349-112770371 GATTTAAAACAAAACAATGAAGG - Intergenic
979069830 4:116187961-116187983 CAGTGAAAACAAATGCATCATGG + Intergenic
979100573 4:116607169-116607191 GGTGAAAAACAAGTGGATCAAGG + Intergenic
979442115 4:120763034-120763056 GATTCAAAACAAATGGAGTCTGG + Intronic
979545855 4:121939227-121939249 GAGTGAAAAGAAAAGGATCATGG + Intronic
981185341 4:141795402-141795424 GATTAAAAACAAATTGAAAAAGG + Intergenic
981629951 4:146806512-146806534 GACTTAAAATAAAGGGATGAAGG + Intronic
981816893 4:148840932-148840954 ATTTTAAAACATATGGATAAAGG - Intergenic
982023720 4:151231235-151231257 GATTCCAAACAAATAGACCATGG + Intronic
982228856 4:153189989-153190011 GATTTAAATCAAATCCATCTTGG + Intronic
982866541 4:160520118-160520140 TATTTAAAACAAACTGTTCATGG - Intergenic
982973176 4:162017054-162017076 GTTTTAAAAAATATGGATAAAGG + Intronic
983003110 4:162444986-162445008 CATTTAAAAGAAATTTATCATGG + Intergenic
983797244 4:171880121-171880143 GATCTAAAATAAATGAAACATGG - Intronic
984021885 4:174495311-174495333 TATTTAAAAAAAATGTATTAAGG - Intronic
984196863 4:176667470-176667492 AGCTTAAAACAAATGAATCAAGG + Intergenic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
986510888 5:8505162-8505184 GTTTTAAAAAAAATAGTTCAGGG - Intergenic
986864463 5:11969586-11969608 AATTTAAAAATAATTGATCAAGG - Intergenic
988054085 5:26070216-26070238 TATTTAAATAAATTGGATCATGG + Intergenic
990245239 5:53857793-53857815 GATTTAAAAAAATTGGCTTAAGG + Intergenic
990634812 5:57712817-57712839 GATTTAAAACAAATTGTTATAGG - Intergenic
990770840 5:59242950-59242972 TATCTAAAGCAAATGAATCAGGG + Intronic
990836956 5:60032480-60032502 CATTTAAAACAAATGAGTCCTGG - Intronic
991022240 5:61991869-61991891 GATTTAGATCAACTGAATCACGG - Intergenic
991322843 5:65394719-65394741 GATTTACCACACATGCATCATGG - Intronic
991538482 5:67700016-67700038 AATTTCTAAGAAATGGATCAGGG + Intergenic
992244619 5:74807705-74807727 TATTTAAAACAAATGAATTATGG + Intronic
992898403 5:81268319-81268341 GAATTAAAACTAATGGATAGGGG - Intergenic
993283371 5:85957961-85957983 AATTAAAAAAAAATAGATCATGG + Intergenic
993340030 5:86713799-86713821 TATGTAAAACAAATGCATTATGG - Intergenic
993398080 5:87415219-87415241 GATTTAAAACTAATGGAGTTGGG - Intergenic
993421423 5:87706076-87706098 GATTTAAAACAGATGTGTCTTGG + Intergenic
995102061 5:108323909-108323931 AATTTTTAACATATGGATCAAGG - Intronic
995526040 5:113051374-113051396 GATTTAAAACAAAGTGATACAGG + Intronic
995759676 5:115550071-115550093 GATTTAAAAAAAATTCATCCTGG - Intergenic
996724266 5:126660232-126660254 GATTTAGAGAAATTGGATCATGG + Intergenic
997349717 5:133221810-133221832 GATTTAAAAGAAATGAAGAAAGG - Intronic
999779827 5:154840373-154840395 AATTTAAAAAAAAGGGTTCATGG - Intronic
1004579803 6:16939177-16939199 GATTCATAACACATGGATCCTGG + Intergenic
1004984953 6:21070997-21071019 GATTAAAAACAAATGAAGAAAGG - Intronic
1005183962 6:23142010-23142032 AATTTAATACAAATAAATCATGG - Intergenic
1005201997 6:23357803-23357825 GATTTATAACGAAAGGGTCAGGG + Intergenic
1005252055 6:23958252-23958274 GTTTTAAAATAAGTGGATAATGG + Intergenic
1005387180 6:25296719-25296741 GATTTAAGACAGATGGATTCAGG - Intronic
1005533667 6:26733794-26733816 GCCTTAAAACAAAGGGAACATGG + Intergenic
1005534981 6:26745902-26745924 GCCTTAAAACAAAGGGAACATGG - Intergenic
1005537128 6:26767860-26767882 GCCTTAAAACAAAGGGAACATGG - Intergenic
1005607959 6:27494380-27494402 CAGGTAAAACAAATGAATCAGGG - Intergenic
1005679564 6:28192712-28192734 AATTAACAAAAAATGGATCATGG + Intergenic
1007310114 6:40938553-40938575 GAGTTAAAACCATTGAATCATGG - Intergenic
1007972440 6:46066545-46066567 GATTTAAACCAAATTGGTTATGG - Intronic
1009265873 6:61554259-61554281 GATTTTAAAAAAATGAAACAAGG - Intergenic
1010338247 6:74715179-74715201 AATTTAAAACAAATGGAAGAGGG - Intergenic
1010576883 6:77542631-77542653 AATTAAATAAAAATGGATCATGG + Intergenic
1011372736 6:86655735-86655757 AAATTAATACAAATAGATCATGG + Intergenic
1012044008 6:94245833-94245855 GTTTGAAAACAAAAGGACCATGG - Intergenic
1012300715 6:97584457-97584479 GATTTAAGAGAAATGTTTCATGG - Intergenic
1012868260 6:104643553-104643575 GATGTAAAACAAATTGATGAAGG + Intergenic
1013019333 6:106196974-106196996 GATAAAACACAAATGTATCAAGG + Intronic
1014111815 6:117626392-117626414 GATTTAAAAAAAATTAATTAAGG + Intergenic
1015479598 6:133693089-133693111 GATTTAGAGCAAATGGGGCAAGG - Intergenic
1017414950 6:154210013-154210035 GATTTAAAATAAATAAATGAAGG - Intronic
1017609852 6:156173975-156173997 GCTTTGAAACAAAGAGATCACGG + Intergenic
1018352167 6:162971295-162971317 CATTTACAAAATATGGATCATGG + Intronic
1020895334 7:13932094-13932116 GTTCTAAATCAATTGGATCACGG + Intronic
1021380744 7:19962779-19962801 GAAGTAACACATATGGATCAAGG - Intergenic
1022988006 7:35679013-35679035 GGTTTAAAACAAATTTTTCACGG + Intronic
1023132147 7:37013975-37013997 AATGTAAAACAAATGGTTAATGG - Intronic
1024430537 7:49283151-49283173 GATACAAAACAAATGGCTCCTGG - Intergenic
1025097387 7:56106759-56106781 GATTTAATACAAATGTTTGAAGG - Intergenic
1026198282 7:68191992-68192014 GAGGTTAAACAAATTGATCAAGG - Intergenic
1027937695 7:84631308-84631330 TTTTTAAAACCAATGGATCCCGG - Intergenic
1028097781 7:86783779-86783801 CATGTAATACAAATGAATCATGG - Intronic
1028419530 7:90617198-90617220 GAAATACAACAAATGGATAATGG + Intronic
1030573579 7:111258329-111258351 GATTGAAAACAAGAAGATCAAGG + Intronic
1030925342 7:115445999-115446021 GATTTAAAAAAAATGGGTAAGGG + Intergenic
1031685121 7:124723976-124723998 GATTTAAAACAAAAAGACCCTGG + Intergenic
1032814045 7:135453086-135453108 TAATTAAAACAAAAGGATCCAGG + Intronic
1034301895 7:150023630-150023652 GATGTAAAACTAATGGATGTGGG + Intergenic
1034804151 7:154073685-154073707 GATGTAAAACTAATGGATGTGGG - Intronic
1035033075 7:155876036-155876058 CATTTAAAACTTATAGATCAGGG - Intergenic
1035972499 8:4265622-4265644 GATTAAAAACAAATATATTAGGG + Intronic
1037416252 8:18653105-18653127 GATATAAAACAAAGGGATTATGG - Intronic
1038068909 8:23992106-23992128 GGTTTAAAATAAATGCAGCAGGG + Intergenic
1038348480 8:26754594-26754616 TATTTTAAACAAATGTAACAAGG + Intronic
1038463047 8:27732721-27732743 GAGTTAAAACCAATGGATGCAGG + Intergenic
1038879508 8:31592205-31592227 GATTTAAAACAAGTGTATATGGG - Intergenic
1041440730 8:57893670-57893692 TAAATAAAACAAATGGATGAGGG - Intergenic
1042211444 8:66385092-66385114 AATTTAGAACAAATGTATTATGG + Intergenic
1043065489 8:75565558-75565580 ATTTTAAAACAAATGAAGCATGG + Exonic
1043752136 8:83951041-83951063 GTTTAAAACCAATTGGATCAGGG - Intergenic
1043816210 8:84805151-84805173 GATTGAAAAGAAATGGAGAATGG - Intronic
1044050139 8:87491835-87491857 GATTTAAAAGAACTGTACCAAGG - Intronic
1044082183 8:87898860-87898882 GATTCAAAACCTATGGAACATGG - Intergenic
1044331883 8:90930078-90930100 GAATTAAAACAAATGCAAAATGG + Intronic
1044688585 8:94853698-94853720 CATTTAAAACAAATAACTCACGG - Intronic
1044698204 8:94944066-94944088 AATTTAAAATAAATGGAGGAAGG - Intronic
1045791168 8:105986618-105986640 TATTTAAAAGAAATGGCTTATGG - Intergenic
1046786320 8:118270981-118271003 AGTTTAAACCAAATGGAGCATGG + Intronic
1046975424 8:120270566-120270588 CATTTAAAAAATATGTATCAAGG + Intronic
1047085038 8:121506675-121506697 ATTTTAAAACAATTGGAACAGGG + Intergenic
1047321745 8:123792374-123792396 TATTTAAAACCAAGGGATTAAGG - Intronic
1048079374 8:131108548-131108570 TATTTACAACCCATGGATCAAGG - Intergenic
1048154093 8:131925973-131925995 GTTTTAAAATAAATGCAACAAGG + Intronic
1050021201 9:1286326-1286348 GGTATAGGACAAATGGATCATGG - Intergenic
1050196650 9:3091320-3091342 GATTTAAGACAAATTGGCCAGGG - Intergenic
1050759647 9:9051810-9051832 CATTTAAATCAAATTGTTCAGGG + Intronic
1051096211 9:13468420-13468442 GAATTAAAATATTTGGATCAGGG - Intergenic
1052232485 9:26170926-26170948 GATTTAAAAAAAATGTAAGAGGG - Intergenic
1052232566 9:26171947-26171969 GAGTTAAAAGGAATGGAGCAAGG + Intergenic
1052237621 9:26231434-26231456 GGAGTGAAACAAATGGATCATGG + Intergenic
1052454142 9:28672705-28672727 CATTTCAAACAAATAGATCATGG - Intergenic
1052613351 9:30804843-30804865 TATTTTAAACAATTGGAGCATGG + Intergenic
1054842754 9:69760694-69760716 GAATTTAAAAAAAAGGATCAAGG + Intergenic
1054971155 9:71088797-71088819 CATCCAAAACCAATGGATCATGG - Intronic
1055046321 9:71928960-71928982 GCTTTAAACCAAATGAATCATGG + Intronic
1056171538 9:83990112-83990134 GATTTAAAAAAAGTTGATCTCGG + Intronic
1056851671 9:90089899-90089921 GATTTAAAACAATTGGAGGTTGG - Intergenic
1057454484 9:95195296-95195318 AAATTAACTCAAATGGATCAGGG - Intronic
1058220398 9:102292696-102292718 CATTTATCACATATGGATCAGGG + Intergenic
1058241303 9:102564627-102564649 GATTTAAAACAAATAGAACTGGG - Intergenic
1059216020 9:112562959-112562981 GATTTAAAACACATTCATAAAGG - Intronic
1060896476 9:127221369-127221391 TTTTTTAAGCAAATGGATCATGG + Exonic
1185977792 X:4740870-4740892 GACTTAATCCAAATGGATCCAGG + Intergenic
1186001981 X:5022671-5022693 CATTTAAAACAATGGCATCATGG + Intergenic
1186658021 X:11636961-11636983 TATTTTAAACAAATTGATCATGG - Intronic
1186735613 X:12460524-12460546 GATTTTAAACAAAGGTGTCATGG - Intronic
1186875578 X:13813747-13813769 GAATCAAAAGAAATAGATCATGG - Intronic
1189284711 X:39843470-39843492 GATTTAAAGGAAATGCTTCAAGG + Intergenic
1189973814 X:46443143-46443165 CATTTACAAAAAAAGGATCAGGG - Intergenic
1190467548 X:50741067-50741089 GATTTTCAACAAAGGCATCAAGG - Intronic
1190562085 X:51696018-51696040 GATGTTAAACAAAAGGAACAGGG + Intergenic
1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG + Intronic
1192102821 X:68283135-68283157 AATGTAAAACAAATTAATCATGG + Intronic
1192856371 X:75017055-75017077 GATTTAAAACAAAAAATTCATGG - Intergenic
1193245052 X:79218415-79218437 GGTTCAAAACAAAGGGATGAAGG - Intergenic
1194076126 X:89396450-89396472 GGTTTAAAACCACTTGATCATGG + Intergenic
1195023633 X:100853840-100853862 ATTTTAAAACAAATGTTTCAAGG + Intronic
1195781902 X:108476234-108476256 AATTTAAAATAAATAAATCAAGG - Intronic
1196142329 X:112277471-112277493 GATGGAAAGCAAATAGATCAAGG + Intergenic
1196710978 X:118762466-118762488 GAGCTAAAACAACTGGACCAAGG - Intronic
1197655227 X:129109420-129109442 GTTTTAAAAGATAGGGATCAAGG + Intergenic
1198140238 X:133795395-133795417 GATATTAAATAAATGGATAAGGG + Intronic
1198663470 X:138996423-138996445 GATTTCACACCAATGGATCTTGG - Intronic
1200428765 Y:3051972-3051994 GGTTTAAAACCACTTGATCATGG + Intergenic
1201565400 Y:15360264-15360286 GTTTAAAAAAAAAGGGATCAGGG - Intergenic