ID: 1096457342

View in Genome Browser
Species Human (GRCh38)
Location 12:51798618-51798640
Sequence ACAAAGTGACTATAGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 27, 3: 266, 4: 436}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096457342_1096457355 13 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457355 12:51798654-51798676 GGGCAATGACAGGGGTGCCTGGG 0: 2
1: 50
2: 123
3: 162
4: 351
1096457342_1096457348 -7 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457348 12:51798634-51798656 ACTTTGTTCATGGGCCCATTGGG 0: 129
1: 186
2: 185
3: 114
4: 204
1096457342_1096457347 -8 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457347 12:51798633-51798655 CACTTTGTTCATGGGCCCATTGG 0: 136
1: 194
2: 187
3: 136
4: 258
1096457342_1096457358 29 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457358 12:51798670-51798692 GCCTGGGGAAAGAGGCTGAGTGG 0: 2
1: 175
2: 227
3: 177
4: 634
1096457342_1096457356 14 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457356 12:51798655-51798677 GGCAATGACAGGGGTGCCTGGGG 0: 2
1: 55
2: 135
3: 179
4: 407
1096457342_1096457350 4 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457350 12:51798645-51798667 GGGCCCATTGGGCAATGACAGGG 0: 32
1: 98
2: 139
3: 148
4: 266
1096457342_1096457354 12 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457354 12:51798653-51798675 TGGGCAATGACAGGGGTGCCTGG 0: 3
1: 52
2: 121
3: 167
4: 393
1096457342_1096457349 3 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457349 12:51798644-51798666 TGGGCCCATTGGGCAATGACAGG 0: 40
1: 111
2: 163
3: 170
4: 341
1096457342_1096457351 5 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457351 12:51798646-51798668 GGCCCATTGGGCAATGACAGGGG 0: 28
1: 100
2: 129
3: 129
4: 183
1096457342_1096457357 21 Left 1096457342 12:51798618-51798640 CCCTGCCACTATAGTCACTTTGT 0: 1
1: 0
2: 27
3: 266
4: 436
Right 1096457357 12:51798662-51798684 ACAGGGGTGCCTGGGGAAAGAGG 0: 1
1: 132
2: 220
3: 190
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096457342 Original CRISPR ACAAAGTGACTATAGTGGCA GGG (reversed) Intronic
901587037 1:10304555-10304577 ACAAACTGGCTACAGTGGCTGGG - Intronic
901844610 1:11973987-11974009 GCAAAGTGTCTATAGTGGTGAGG + Intronic
901903799 1:12390822-12390844 ACAAAGTGGCCATGGTGGCAGGG - Intronic
904179323 1:28654803-28654825 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
904269056 1:29337204-29337226 GTAAAGTGGCTGTAGTGGCAGGG + Intergenic
904336060 1:29798842-29798864 ACGAAGTGACCACGGTGGCAGGG + Intergenic
905354194 1:37369636-37369658 ACAAAGTAGCCATGGTGGCAGGG + Intergenic
906050607 1:42868264-42868286 ACAAAGTGGCCATGGTGGTAGGG + Intergenic
906054819 1:42907297-42907319 ACAAAGTGGCTATAGTGACAGGG - Intergenic
906879777 1:49577308-49577330 ATAAAGTGGCCATGGTGGCAAGG + Intronic
906930803 1:50167671-50167693 ACAAAGTGGCCACGGTGGCAGGG - Intronic
907597470 1:55732974-55732996 ACAAAGTGGCCATGGTGGTAGGG + Intergenic
907780460 1:57561689-57561711 ACAAAGTGGCCATGGTGGCTGGG + Intronic
908074512 1:60500570-60500592 ACAAATTGAATAAAGTTGCAGGG + Intergenic
908737507 1:67291667-67291689 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
908875363 1:68668359-68668381 ACATAGGGAATATAGCGGCAGGG + Intergenic
909032765 1:70561442-70561464 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
909172484 1:72314611-72314633 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
909237392 1:73171075-73171097 AAAGAGTAACTATACTGGCAAGG - Intergenic
909548832 1:76876344-76876366 ACAAAATGGCCATGGTGGCAGGG - Intronic
909577050 1:77186707-77186729 ACAAAGTGGCTATGGTGGCAGGG + Intronic
909811065 1:79932184-79932206 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
909858800 1:80576193-80576215 ACGAAGTGGCCATGGTGGCAGGG - Intergenic
910370757 1:86512985-86513007 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
910565574 1:88639212-88639234 ATAAATTGACTATGGTGGCAAGG - Intergenic
910569178 1:88681627-88681649 TTAAAGTTATTATAGTGGCATGG + Intergenic
910630335 1:89347118-89347140 ACAAAGTGGATATGGTGTCAGGG + Intergenic
910638866 1:89439120-89439142 ACAAAGTGGCCATAGTGGCAGGG - Intergenic
910790452 1:91044597-91044619 ACAAAGTGACCATGGTGGCAGGG + Intergenic
910830979 1:91462567-91462589 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
910948332 1:92617562-92617584 ACAAAGTGGCCATGGTGGCAGGG + Intronic
911109050 1:94163850-94163872 ACAAAGTGGCCATGGTGGCAGGG - Intronic
911257217 1:95646508-95646530 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
911400966 1:97374745-97374767 AAAAAGTTATTATAGTGGCCGGG + Intronic
911498004 1:98654132-98654154 ACTAAGTGGCTATAGTGGCATGG - Intergenic
911820076 1:102407054-102407076 ACAAAGAGACAATAGGGCCAGGG + Intergenic
911883691 1:103271316-103271338 ACACAGTGGCCATGGTGGCAGGG + Intergenic
911980538 1:104560277-104560299 ACACAGTGTCCATGGTGGCAGGG + Intergenic
912050579 1:105524096-105524118 ACAAAGTGGTCATAGTGGCAGGG - Intergenic
912129793 1:106587203-106587225 ACACAGTGTCCATGGTGGCAGGG - Intergenic
912212368 1:107569710-107569732 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
912730721 1:112100652-112100674 ACAAAGTGAACATGGTGGCAGGG + Intergenic
912733208 1:112127979-112128001 ACAAAGTGACCATGGTGACGGGG - Intergenic
912943688 1:114067352-114067374 ACAAAGTGGCCATGGTGACAGGG - Intergenic
913039326 1:115007544-115007566 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
914965392 1:152253052-152253074 ACAAAGTGTCCATGGTGGCAAGG - Intergenic
915667559 1:157458819-157458841 ACAAAGTGATCATGGTGGCAGGG - Intergenic
915709781 1:157884496-157884518 ACAAAGTGGCCATGGTGGAAAGG + Intronic
916106076 1:161433444-161433466 ACAAAGTGGCCATCGTGGCAGGG - Intergenic
916461282 1:165027487-165027509 ACAAAGTGGCCATGGAGGCATGG + Intergenic
917217098 1:172690053-172690075 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
917247882 1:173024274-173024296 ACAAAGTGGCTGTGGTGGCAGGG - Intergenic
917764656 1:178202865-178202887 ACAAAGTGGTCATGGTGGCAGGG + Intronic
918774616 1:188611601-188611623 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
918815177 1:189172076-189172098 ACAAAGTGGCCATGGTTGCAGGG + Intergenic
918958354 1:191238787-191238809 ACAAAGTAGCCATGGTGGCAGGG + Intergenic
919162042 1:193842388-193842410 AAAAGGTGAATATAATGGCAGGG + Intergenic
919330321 1:196162781-196162803 ACAAAATGTCCATGGTGGCAGGG + Intergenic
920197551 1:204239210-204239232 AAAAAGTGGCCATGGTGGCAGGG + Intronic
923253455 1:232198597-232198619 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
923426575 1:233876095-233876117 GCAAAGTAACCATGGTGGCAGGG + Intergenic
923926080 1:238628964-238628986 ACAAAGTGGCCATGGTGACAGGG - Intergenic
924840653 1:247706976-247706998 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
924847022 1:247784290-247784312 ACAAGGTGGCCATGGTGGCAGGG - Intergenic
924880785 1:248159888-248159910 ACAAAATGACCGTAGTGGCATGG - Intergenic
924885960 1:248216921-248216943 ACAAAATGACCACAGTGGCATGG - Intergenic
1063904301 10:10766671-10766693 ACAGAGTGGCCATGGTGGCAGGG - Intergenic
1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG + Intronic
1066166905 10:32798374-32798396 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1066169555 10:32827175-32827197 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1066971537 10:42316076-42316098 ACAAAGTGAGTAGAATGGAATGG - Intergenic
1067026140 10:42845801-42845823 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1067333262 10:45341073-45341095 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1067451189 10:46383061-46383083 ACAAAATGACTATAGTTACTGGG - Intronic
1067519059 10:46981325-46981347 ACAAAGTGGCCATAATGGCAGGG + Intronic
1067586053 10:47476690-47476712 ACAAAATGACTATAGTTACTGGG + Intronic
1067643186 10:48070509-48070531 ACAAAGTGGCCATAATGGCAGGG - Intergenic
1067679202 10:48416987-48417009 CCAAAATGTCAATAGTGGCAAGG - Intronic
1067754233 10:48992864-48992886 ACAAAGTGGCCATGGTGGCCAGG - Intergenic
1068007551 10:51408726-51408748 ACAAAGTGGCCATGGTGGCGGGG - Intronic
1068424591 10:56843489-56843511 ATAAAGTAATTATAGTGGCCAGG + Intergenic
1068837095 10:61567527-61567549 ACAAAGTGGCTATGGTGGCAGGG - Intergenic
1068908961 10:62358110-62358132 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1069145872 10:64891280-64891302 CCAAAGTGGCCATAGTGGCAGGG + Intergenic
1069192188 10:65505516-65505538 ACAAAGTGGCCACGGTGGCAGGG - Intergenic
1070912837 10:80133166-80133188 AAAAAGTGATTAAAATGGCAAGG + Intronic
1071013803 10:80970820-80970842 ACAAAGTGGCCATGGTGTCAGGG - Intergenic
1071266958 10:83973150-83973172 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1071378498 10:85034213-85034235 ACAAAGCGGCCATGGTGGCAGGG + Intergenic
1071920132 10:90340448-90340470 ACAAAGTAGCTATGGTGGCAGGG + Intergenic
1071937809 10:90550132-90550154 ACAAAGTGGCCATTGTGGCGGGG + Intergenic
1071942665 10:90606920-90606942 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1071950710 10:90700222-90700244 ACAAAGTGGCCATGGTGGCTGGG - Intergenic
1072209144 10:93230853-93230875 ACAAAGTGGCTGTCGTGGCAAGG - Intergenic
1072360586 10:94654998-94655020 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1072361965 10:94668414-94668436 AGAAAGTAGCTACAGTGGCAGGG - Intergenic
1073557471 10:104466747-104466769 ACAAAGTGGCCATGGTGGCAAGG + Intergenic
1073656562 10:105423638-105423660 GCAAAGTGGCCATGGTGGCAGGG - Intergenic
1073995756 10:109313882-109313904 AGAAAGTGGCCATGGTGGCAGGG - Intergenic
1074632411 10:115273216-115273238 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1076927284 10:133498362-133498384 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1078450360 11:11436370-11436392 ACATAGTCACGATGGTGGCAAGG - Intronic
1080020046 11:27550828-27550850 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1080076715 11:28158345-28158367 ACAAAATGGCCATAGTGGCAGGG + Intronic
1081072908 11:38632025-38632047 ACAAAGTGGCCACGGTGGCAGGG + Intergenic
1081110643 11:39129565-39129587 ACAAAGTGGCCATGGCGGCAGGG + Intergenic
1081609180 11:44548708-44548730 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1082640552 11:55654777-55654799 ACAGAGTGTCTATACTGGCAAGG - Intergenic
1082920343 11:58485754-58485776 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1082999777 11:59280693-59280715 ACAAAGTGTCCATGGTGGTAGGG + Intergenic
1083020610 11:59503275-59503297 AGAAAGAGACTATTGTGGCATGG - Intergenic
1083093255 11:60221956-60221978 ACGAAGTGGCCATGGTGGCAGGG + Intronic
1085686075 11:78623016-78623038 ACAACGTGGCCATGGTGGCAGGG + Intergenic
1085748454 11:79136407-79136429 ACAATGTGGCCATGGTGGCAGGG + Intronic
1086141514 11:83505373-83505395 ACAACGTGGCCATGGTGGCAGGG - Intronic
1086278724 11:85161278-85161300 ACAAAGTGGCCATGGTGGTAGGG + Intronic
1086963019 11:92999197-92999219 AAAATGTGAATATAGGGGCAGGG - Intergenic
1087216634 11:95502127-95502149 TAAAGGTGACTATAGGGGCATGG - Intergenic
1087323910 11:96697966-96697988 ACAAAGTGTCCCTGGTGGCAGGG - Intergenic
1088027035 11:105198348-105198370 ACAAAGTGACTGAAGTCACATGG + Intergenic
1088038402 11:105347021-105347043 ACAAAATGGCCATGGTGGCAGGG + Intergenic
1088097332 11:106115984-106116006 ACAAAGTGGCCTTGGTGGCAGGG + Intergenic
1088449467 11:109966182-109966204 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1089903735 11:122014442-122014464 ACAAAGTGGCCATTATGGCAGGG + Intergenic
1090119078 11:124005565-124005587 AAAAAGTGGCCATGGTGGCAGGG - Intergenic
1090209372 11:124907227-124907249 ACAAAGTAGCCATGGTGGCAGGG - Intergenic
1090221491 11:125030772-125030794 ACAAAGTAGCCATGGTGGCAGGG - Intronic
1090888608 11:130901939-130901961 AAAAAGGCACTCTAGTGGCAGGG + Intronic
1091103585 11:132898045-132898067 ACAAAGTGGCTATGGTGGTAGGG + Intronic
1092093400 12:5822464-5822486 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1092381666 12:8001753-8001775 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1093031747 12:14295105-14295127 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1093036462 12:14336505-14336527 ACGAAGTGGCCATGGTGGCAGGG + Intergenic
1093645833 12:21584500-21584522 ACAAAGTGGCCACAGTTGCAGGG + Intronic
1093964657 12:25311781-25311803 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1094102651 12:26780092-26780114 ACAAAGTGGCTATGGTGGCAGGG + Intronic
1094389675 12:29935393-29935415 ACAAAGTGTCCATGGTGCCAGGG - Intergenic
1095121393 12:38424009-38424031 ACAAAGTGGCCATTGTGGCAGGG - Intergenic
1095416404 12:41982050-41982072 ATAAAGTGACTATAGGGCCCAGG + Intergenic
1095535596 12:43242932-43242954 AAAAATTGTCTATAGTGGCTGGG + Intergenic
1095603970 12:44045165-44045187 ACAAAGTGGCCATGATGGCAGGG + Intronic
1095805699 12:46317959-46317981 ATAAAGTTACTATAGTGGAATGG + Intergenic
1095856135 12:46862846-46862868 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1096457342 12:51798618-51798640 ACAAAGTGACTATAGTGGCAGGG - Intronic
1097059569 12:56272518-56272540 ACCAAGTGACCATAAAGGCATGG - Exonic
1097305770 12:58067422-58067444 ACAAAGTGGCCATGGTAGCAGGG + Intergenic
1097821233 12:64131078-64131100 ACAAAGTGGCCATAGTGGCAGGG - Intronic
1097843229 12:64341922-64341944 ACAAAGTGGTCATAGTGGCAGGG - Intronic
1098589295 12:72190756-72190778 ACAAAGTGACCGTGGTGGCAGGG + Intronic
1098716216 12:73830634-73830656 ACAAAGTGGCCACGGTGGCAGGG + Intergenic
1098733408 12:74066461-74066483 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1098749956 12:74280426-74280448 ACAAAGTGGCCATGGTAGCAGGG + Intergenic
1098807287 12:75035760-75035782 ACAAAGTGGCTATGGTGGTGAGG + Intergenic
1099273339 12:80542477-80542499 ACAAAGTAAATATAATGGTAAGG - Intronic
1099375763 12:81894779-81894801 ACAAAGTGGCCCTCGTGGCAGGG + Intergenic
1099379273 12:81935722-81935744 ACAAAATGGCCATGGTGGCAGGG - Intergenic
1099490558 12:83283422-83283444 ACAAAATGGCCATGGTGGCAGGG - Intergenic
1099508685 12:83508014-83508036 ACAAAGTGGCAATGTTGGCAGGG + Intergenic
1099526479 12:83723923-83723945 ACAAAGTGGCAATGATGGCAAGG + Intergenic
1099526541 12:83724448-83724470 ACTAAGTGACAATATTTGCAGGG + Intergenic
1099578182 12:84406229-84406251 ACAAAGTGATCATGGTGGCAGGG + Intergenic
1099700770 12:86078720-86078742 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1099735901 12:86565865-86565887 ACAAAGTGGCCATGGGGGCAGGG + Intronic
1100083420 12:90879036-90879058 ACAAAGTAGCCATGGTGGCAGGG + Intergenic
1100895377 12:99176392-99176414 AAAAAGTGCCTATAATGACATGG - Intronic
1101264256 12:103066946-103066968 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1101534545 12:105605276-105605298 ATAAAGTGGCCATGGTGGCAGGG - Intergenic
1101543185 12:105683465-105683487 ACAAAGTGGCCATGGTGGTAGGG + Intergenic
1101713525 12:107290291-107290313 AAAAAGTGGCTATTGTGTCAGGG - Intergenic
1103035742 12:117654902-117654924 ACAAAGTGGCCACGGTGGCAGGG + Intronic
1104147913 12:126053492-126053514 ACAAGGTGGCCATGGTGGCAGGG + Intergenic
1104468606 12:129009976-129009998 ACAAAATGAGTGCAGTGGCAAGG + Intergenic
1105740234 13:23316011-23316033 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1105852645 13:24349475-24349497 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1106046166 13:26144211-26144233 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1108598414 13:51969912-51969934 AGAAAGTGATTCTGGTGGCAAGG + Intronic
1109062336 13:57633859-57633881 ACAACGTGACCATCGTGGCGCGG + Exonic
1109293339 13:60500945-60500967 ACAAAGTGGCCATGGTGGGAGGG + Intronic
1109583158 13:64366997-64367019 ATAAAGTGGCTGTGGTGGCAGGG + Intergenic
1109712571 13:66180002-66180024 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1109950906 13:69501381-69501403 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1109959934 13:69616705-69616727 AGAAAGTCACTAGACTGGCAGGG - Intergenic
1110248362 13:73353574-73353596 ACAAAGTGGCCACAGTGGCAGGG - Intergenic
1110377281 13:74807341-74807363 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1110812815 13:79829257-79829279 ACAGAGTAGCCATAGTGGCAGGG + Intergenic
1110834024 13:80063800-80063822 ACAAAGTCACCATGGTGGCAGGG - Intergenic
1111057677 13:82972195-82972217 ACAAAGTGACCATGGTGGCAGGG - Intergenic
1111198647 13:84905716-84905738 ACAAAGTGGCCCTGGTGGCAAGG + Intergenic
1111317614 13:86582629-86582651 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1111432154 13:88158941-88158963 ACAAAGTGACCAAAGTTGCAGGG - Intergenic
1111535312 13:89596001-89596023 ACAAAGTGACCATGGTGGTAGGG + Intergenic
1112057605 13:95705187-95705209 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1112231006 13:97589341-97589363 ACAAAGTGGCCATGGTGGCCAGG - Intergenic
1113319581 13:109220844-109220866 ACAAAGTGGCTATGGTGGCAAGG - Intergenic
1114205981 14:20571597-20571619 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1114758134 14:25283049-25283071 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1114905277 14:27119729-27119751 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1115059825 14:29174712-29174734 ACAAAGTGACGATGGTGGCAGGG + Intergenic
1116059019 14:39897756-39897778 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1116068207 14:40009998-40010020 ACAAAGTGGCCATGGTGACAGGG + Intergenic
1116096964 14:40382475-40382497 AAATAGTGACTATAGGGGCCGGG + Intergenic
1116158265 14:41235829-41235851 ACAAAGTGGCTGTAGTGGCAGGG - Intergenic
1116415180 14:44670124-44670146 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1116546257 14:46168577-46168599 ACCAGGTGACTAAAGTGGCCAGG - Intergenic
1116861910 14:50001990-50002012 ACAAAGAAACCATTGTGGCAGGG - Intronic
1117596156 14:57329054-57329076 ACAAAGTGACCATGGTGGCGGGG - Intergenic
1117634255 14:57725205-57725227 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1117780007 14:59222578-59222600 ACAAAGTGGCTATGGTGGCAGGG - Intronic
1118122321 14:62859349-62859371 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1118501943 14:66370217-66370239 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1118880656 14:69823186-69823208 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1118950637 14:70433744-70433766 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1119107440 14:71938013-71938035 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1120081900 14:80226703-80226725 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1120231326 14:81844422-81844444 AAAAAGTGGCCATGGTGGCAGGG - Intergenic
1120498290 14:85262754-85262776 ACAAAGTGGCCGTGGTGGCAGGG - Intergenic
1120710370 14:87787319-87787341 ACACAGCGGCCATAGTGGCAGGG - Intergenic
1120919804 14:89744545-89744567 ACAAAGTTGCCATGGTGGCAGGG + Intergenic
1120973819 14:90231627-90231649 ACAAAGTGGCTATTGTGGCAGGG + Intergenic
1123765294 15:23471834-23471856 ACAAAGTGTTTATGGTGACAGGG - Intergenic
1123876846 15:24631925-24631947 ATAAAGTGACCATGGTGTCAGGG - Intergenic
1124571329 15:30866869-30866891 AAAAAGTGGCCATGGTGGCAGGG - Intergenic
1124647555 15:31449703-31449725 AAAAAGTGGCCATGGTGGCAGGG - Intergenic
1126283717 15:46987084-46987106 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1128642917 15:69353055-69353077 ATAAAGTGGCCATGGTGGCAGGG + Intronic
1129770190 15:78198334-78198356 AAAAAGAGATTATAGTGGCTGGG - Intronic
1130016970 15:80195143-80195165 ACAGAGTGACCATAGTGGAAGGG + Intergenic
1131202319 15:90409668-90409690 AGGAAGTGAATATAGGGGCAGGG - Intronic
1131302571 15:91212401-91212423 ACACAGGGACTTTAGTGGGAAGG - Intronic
1131642966 15:94312523-94312545 ATATAGTGGCTATAGTGCCAGGG + Intronic
1133968178 16:10546820-10546842 CCAAAATGACAATAGTGGCAAGG + Intronic
1135061517 16:19275139-19275161 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1135626119 16:23996328-23996350 ACAAAGTGGCCGTGGTGGCAGGG + Intronic
1136251055 16:29005399-29005421 ACAAAATGACCATGGTGGCAGGG + Intergenic
1138700176 16:58854423-58854445 ACAAACTGACTTCAGAGGCAAGG - Intergenic
1138719132 16:59058822-59058844 ACAAGGTGACCATGGTGGCAGGG + Intergenic
1138868490 16:60851613-60851635 ACAAAGTGGCCACAGTTGCAGGG + Intergenic
1138893718 16:61177260-61177282 ACAAATTAACTTTAGTGGTATGG + Intergenic
1141488940 16:84359085-84359107 ACAAAGGGAACACAGTGGCAGGG + Intergenic
1144369936 17:14580492-14580514 ATAAAGTGATTATTGTGGTATGG + Intergenic
1144374532 17:14626254-14626276 ACCAGGTGCCTACAGTGGCAAGG - Intergenic
1146207891 17:30920604-30920626 ACAAGCTGACCATAGGGGCAGGG + Intronic
1146238102 17:31186777-31186799 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1146836472 17:36114804-36114826 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1146851053 17:36221863-36221885 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1148915194 17:50970818-50970840 ACAAAGTAGCAGTAGTGGCACGG - Exonic
1149125089 17:53219930-53219952 ACAAATTTAGTATAGTTGCAAGG - Intergenic
1150297797 17:64023108-64023130 ATAAAATGACTATGGTGGGAAGG + Intergenic
1151037685 17:70820769-70820791 ACCAAGTGTCCATGGTGGCAGGG - Intergenic
1151652157 17:75476739-75476761 ACAAAGTGAGTATGCTGGCAGGG + Intronic
1152784134 17:82239286-82239308 ACAACGTGACTTTAATGGGAGGG + Exonic
1203195844 17_KI270729v1_random:230651-230673 ACAAATGGAATATAATGGCATGG + Intergenic
1203205315 17_KI270730v1_random:31009-31031 ACAAATGGAATATAATGGCATGG + Intergenic
1153028901 18:695135-695157 AAAAAGAGACTAAAGAGGCATGG - Intronic
1153089829 18:1330989-1331011 ACAAAGTGTCCGTGGTGGCAGGG + Intergenic
1153131157 18:1856896-1856918 ACAGAGTGGCTGTGGTGGCAGGG - Intergenic
1153184510 18:2471553-2471575 ACAAAGGGACCATGGTGGTAGGG + Intergenic
1153217569 18:2834776-2834798 ACAATGTGGCCATGGTGGCAGGG - Intergenic
1154068585 18:11131909-11131931 ACAAAGGGGCCATGGTGGCAGGG + Intronic
1154252447 18:12755858-12755880 ACAAAGGGGCCATGGTGGCAGGG - Intergenic
1154300569 18:13187692-13187714 ACAAAGGGACCACAGTGGCCCGG - Intergenic
1155336872 18:24773923-24773945 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1155632721 18:27913132-27913154 ACAAAGCGACTTGGGTGGCATGG - Intergenic
1156167777 18:34443834-34443856 ACAAGGAGACAAAAGTGGCAAGG + Intergenic
1156255060 18:35387074-35387096 ACAAAGTAGCCACAGTGGCAAGG + Intergenic
1156303973 18:35859521-35859543 ACAAAGTGGCCATGGTGGGAGGG + Intergenic
1156546339 18:37967372-37967394 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1156690885 18:39705544-39705566 ACTAAGTGACTGAAGTGCCATGG - Intergenic
1156901979 18:42310623-42310645 ACAACCTGACAATAATGGCAAGG + Intergenic
1156990189 18:43399949-43399971 ACCAAGTGGCCATGGTGGCAGGG - Intergenic
1157341325 18:46780838-46780860 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1158203895 18:54969727-54969749 ACAAACTGACCATTGTAGCAAGG - Intergenic
1158402130 18:57130774-57130796 TAAAAATGACTATAGTGACATGG - Intergenic
1159558989 18:69974537-69974559 ACAAAGTGGCCATGGTGTCAGGG - Intergenic
1160092561 18:75840841-75840863 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1163278152 19:16298775-16298797 AGAAAGTGACAATGGTGGCCAGG + Intergenic
1164898652 19:31899256-31899278 GCAAAGTAGCTATGGTGGCAGGG - Intergenic
1165353928 19:35292200-35292222 TCCAAGTGAGTATGGTGGCAGGG + Exonic
1166573321 19:43813541-43813563 ACAGAGTGGCCATGGTGGCAAGG - Intronic
1167951738 19:53033067-53033089 ACAAAGTGGCCATGGTAGCAGGG + Intergenic
1168539214 19:57196579-57196601 ACAAAATGGTCATAGTGGCAGGG - Intronic
925460841 2:4061268-4061290 ACAAAGTGGCCACGGTGGCAGGG + Intergenic
925499294 2:4486103-4486125 ACAAAGTGGCCATGGTGGGAAGG - Intergenic
926565144 2:14460558-14460580 ACTAAGTGGTTATAGAGGCAAGG - Intergenic
926826884 2:16914495-16914517 ACAAAGTGGCCAAGGTGGCAGGG + Intergenic
927008830 2:18880551-18880573 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
927482830 2:23467983-23468005 ACAAAATACCTATAGTGCCATGG - Intronic
927926605 2:27018136-27018158 ACAAAGTCCCTAAAGTGGCTCGG + Intronic
929625645 2:43403875-43403897 ACAAACAGACCATAATGGCATGG - Intronic
929717052 2:44322902-44322924 TCATAGTCTCTATAGTGGCAAGG - Intronic
930295093 2:49544548-49544570 ACAAAGTGGCCATGGTGGTAGGG - Intergenic
930481053 2:51948426-51948448 ACAAAGTGGCCATCATGGCAGGG - Intergenic
930953652 2:57176701-57176723 CCAAAGTGTCAATAGTGGCCGGG - Intergenic
931376988 2:61716808-61716830 AGAAAGTGCCTGTAGTGGCTGGG - Intergenic
932101169 2:68900561-68900583 ACCAACTGACTAAAGTGGCCTGG + Intergenic
932450151 2:71804522-71804544 ACAAAGTGATTTGAGTGGGAGGG + Intergenic
932546998 2:72722994-72723016 AAAATGTGACTATACTGGGAAGG - Intronic
932633625 2:73368819-73368841 ACAAAGTGGCCCTGGTGGCAGGG + Intergenic
932975787 2:76598027-76598049 ACAAAGTGGCCATCATGGCAGGG + Intergenic
933209003 2:79544346-79544368 ACAAAATGACTATTTTGGCTTGG + Intronic
933348614 2:81124323-81124345 ACAGAGTGACTATAGTCGATAGG - Intergenic
933394354 2:81712531-81712553 ACGAAGTGGCTATGGTGGCAGGG - Intergenic
933504666 2:83161942-83161964 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
933938403 2:87225553-87225575 AGAAAGAGAATATAGTGGCCGGG - Intergenic
934088175 2:88527552-88527574 AAAAAGTGACAATTGTGGAAGGG - Intronic
934305856 2:91821421-91821443 ACATAGTGGCCATGGTGGCAGGG + Intergenic
934327400 2:92031321-92031343 ACATAGTGGCCATGGTGGCAGGG - Intergenic
934465784 2:94261901-94261923 ACATAGTGGCCATGGTGGCAGGG - Intergenic
935184062 2:100715724-100715746 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
935424992 2:102910499-102910521 ACAAAGTGGCCATGGTGCCAGGG - Intergenic
935564183 2:104589422-104589444 ACAAAGTGACCATGGTAGCAGGG - Intergenic
935823321 2:106916015-106916037 AAAAAGTGGCCATGGTGGCAGGG + Intergenic
936354733 2:111740221-111740243 AGAAAGAGAATATAGTGGCCGGG + Intergenic
936818408 2:116488127-116488149 ACAAAGTGATCATGGTAGCAGGG + Intergenic
936859336 2:116997785-116997807 AGAGAGTGACTATATTGGCAGGG - Intergenic
937581952 2:123498321-123498343 ACAAAGTGACCATGGTGGCAGGG - Intergenic
937852453 2:126647909-126647931 ACAAACTGGCCATGGTGGCAGGG - Intergenic
938266818 2:129933822-129933844 AAAGAGTGACTAAAATGGCAAGG - Intergenic
938967936 2:136404947-136404969 TCAAAGTGACTATTGTCTCAGGG + Intergenic
939213986 2:139213064-139213086 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
939806350 2:146779298-146779320 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
941274243 2:163470701-163470723 AGAAAGGGACTTCAGTGGCAAGG + Intergenic
941668140 2:168261956-168261978 ACAAAGTGGCCGTGGTGGCAGGG + Intergenic
942155342 2:173121902-173121924 ACAAAGTGGCCATGATGGCAAGG - Intronic
942987989 2:182164605-182164627 ACAAAGTGACCATGGTGGTAGGG + Intronic
943224349 2:185149865-185149887 AAATAGTCACAATAGTGGCATGG - Intergenic
943317807 2:186411491-186411513 ACAAATTGGCCATGGTGGCAGGG - Intergenic
943383953 2:187180264-187180286 ACAAAGTGGGCATGGTGGCAGGG - Intergenic
943480491 2:188411445-188411467 ACAAAGTGGCCATGATGGCAGGG - Intronic
943517479 2:188906429-188906451 ACAAAGTGTCCATGGTAGCAGGG - Intergenic
943588257 2:189765761-189765783 ACAATGTGACTCAAGTGGAAAGG - Intergenic
943833498 2:192490318-192490340 ACAAAGTGGCCATGGTGTCAGGG - Intergenic
944343583 2:198633560-198633582 AAATAGTGGCTATAGTGGCAAGG + Intergenic
944883607 2:204040827-204040849 CCAAAGTGACAATAGTGCCAGGG - Intergenic
945642296 2:212444664-212444686 ACAAAGTGGCCACGGTGGCAGGG + Intronic
945679728 2:212899202-212899224 ATAAAGTGCCTATAGAGACAAGG - Intergenic
945717725 2:213379843-213379865 ATAAAGTGGCCATGGTGGCAGGG - Intronic
946527757 2:220539209-220539231 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
946791030 2:223300580-223300602 ACAAAGTGGCCATGATGGCAGGG + Intergenic
947440963 2:230121080-230121102 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
948224864 2:236300948-236300970 AGAAAGTAACTATACTGGCCGGG - Intergenic
948340330 2:237245535-237245557 ACAAACTGGCCATGGTGGCAGGG - Intergenic
948465378 2:238149470-238149492 ACAAGGTGACAATAGTGCCCTGG + Intronic
1169256148 20:4100839-4100861 ACAAAGTCAATGTAGTGTCATGG + Intergenic
1169977579 20:11347477-11347499 TCCAAGTGTCAATAGTGGCAAGG - Intergenic
1170223823 20:13969051-13969073 ACACAGTGACTTTAGTTGAAAGG + Intronic
1171315973 20:24195039-24195061 ATAAAGTGGCTATGGTGGCAGGG + Intergenic
1171329950 20:24328816-24328838 ACAAGGTGGCCATGGTGGCAGGG - Intergenic
1171409694 20:24937807-24937829 ACAAGGTGGCCATGGTGGCAGGG - Intergenic
1171436243 20:25126772-25126794 ACAAGGTGGCCATGGTGGCAGGG + Intergenic
1174133652 20:48363599-48363621 AAAAAGTGACTCTGGTGGCCAGG + Intergenic
1176998285 21:15581094-15581116 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1177314436 21:19438203-19438225 ACAAAATGTCAATAGTGACAAGG + Intergenic
1177780862 21:25621292-25621314 ATAAAGTGGCCATGGTGGCAGGG - Intergenic
1177913293 21:27057037-27057059 ACAAAGTTGCCATGGTGGCAGGG + Intergenic
1178005926 21:28219606-28219628 ACAAAGTGGCCATGGTGGCAAGG - Intergenic
1178012775 21:28306006-28306028 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1178385808 21:32149405-32149427 ACAAAGTGAACATTGTAGCAGGG + Intergenic
1179415027 21:41191710-41191732 ACAAAGTGGCCATGGTAGCAGGG - Intronic
1180591033 22:16937539-16937561 ACATAGTGGCCATGGTGGCAGGG - Intergenic
1182965825 22:34520125-34520147 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1183859888 22:40662225-40662247 ACAAAGTGACCATGGTGACAGGG + Intergenic
1184447126 22:44555126-44555148 ACCAAGTGCCTATAGAGGCAAGG - Intergenic
1184603447 22:45557539-45557561 ACAAAGTGGCCATGGTGGCAGGG - Intronic
949169920 3:985774-985796 ACAAAGCGGCCATGGTGGCAAGG - Intergenic
949245991 3:1925751-1925773 ACAAAATGGCTGTAGTGGCAGGG + Intergenic
949417461 3:3830062-3830084 ACAAAGTGGCCATGGTGGCAGGG - Intronic
949433312 3:4001993-4002015 AAATAGGGAATATAGTGGCAAGG + Intronic
949445728 3:4131885-4131907 ACAAAGTGGCCATGGTGGCAAGG + Intronic
949639023 3:6014341-6014363 ACGAAGTGGCCATGGTGGCAGGG + Intergenic
951003683 3:17593313-17593335 ACAAAGTGGTCATGGTGGCAGGG + Intronic
951129395 3:19023897-19023919 ACAAAATTACTATGCTGGCAGGG - Intergenic
951291407 3:20875916-20875938 ACAAAGTGGCCATAGTGGTAGGG - Intergenic
951384630 3:22028345-22028367 AAAAAGTGGCCATGGTGGCAGGG + Intronic
951970649 3:28441060-28441082 ACAAAGTGGCCATGGTGGCAGGG - Intronic
953371247 3:42390352-42390374 ACGAAGTGGCTATGGTGACAAGG + Intergenic
954054278 3:48008766-48008788 ACAAAGTGGCCATGGTGGCAGGG + Intronic
955096804 3:55806706-55806728 CCAAAATGCCAATAGTGGCAAGG + Intronic
955607591 3:60722496-60722518 CCAAAGTGTCTACAGTGCCAAGG - Intronic
955740903 3:62090921-62090943 ACAAAGGGATTGAAGTGGCATGG - Intronic
956263148 3:67367563-67367585 CCAAAGTGTCAATAGTGCCAAGG - Intronic
956306981 3:67836457-67836479 ACAAAGTGACCATGTTGGCAGGG + Intergenic
956509783 3:69981192-69981214 ACAAAGAGGCCATGGTGGCAGGG + Intergenic
956703783 3:71982062-71982084 ACAAAGTGGCCATGGTGGTAGGG - Intergenic
957754705 3:84470254-84470276 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
957875047 3:86133714-86133736 ACAAAGTGACTATGATGGCAAGG + Intergenic
958258896 3:91355905-91355927 ACAAAGTGGCAATGGTGGCAGGG - Intergenic
958487501 3:94731134-94731156 ACTAAGTGACAATATTTGCAGGG - Intergenic
958795907 3:98705979-98706001 CCAAAGTGTCAATAGTGCCAAGG + Intergenic
958910318 3:99986859-99986881 CCAAAATGTCTATAGTGCCAAGG + Intronic
958934423 3:100241438-100241460 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
959226663 3:103596454-103596476 ACAAAGTGGCCGTGGTGGCAGGG - Intergenic
959483994 3:106907349-106907371 CCAAAATGTCTATAGTGCCAAGG - Intergenic
959521495 3:107327267-107327289 ACCAAGTGACCATAAAGGCATGG - Intergenic
959728411 3:109572233-109572255 ACATAGTGAGTATAGTTACAAGG - Intergenic
959745900 3:109776448-109776470 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
959997984 3:112699146-112699168 ACAAAGTGGCCATAGTGGCAGGG + Intergenic
960494623 3:118359930-118359952 ACAATGTGGCCATAGTGGCAGGG - Intergenic
960501801 3:118446766-118446788 CCACAGTGACTGTAGTGCCAGGG - Intergenic
961262965 3:125617214-125617236 ACAAAGTGGCCATGGTAGCAGGG + Intergenic
961710862 3:128827192-128827214 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
962021613 3:131508109-131508131 ATAATGTGACTATTGTGGCTGGG - Intergenic
962214783 3:133511899-133511921 ACAAAATGGCCATGGTGGCAGGG + Intergenic
963012036 3:140779280-140779302 ACATAGTGGGCATAGTGGCAGGG + Intergenic
963355545 3:144206041-144206063 ACAAAGTGGCTATGGTGGCAGGG - Intergenic
963379128 3:144506457-144506479 ACAAAGTGGCCATGGTGGCAAGG - Intergenic
963548661 3:146694152-146694174 ACAAAGTGTCCATGGTGGGAGGG - Intergenic
963970199 3:151421127-151421149 ACAAAGTGGCCATGGTGGCAGGG - Intronic
964679119 3:159318087-159318109 ACAAAGTGGCCATGGTGGCAGGG - Intronic
965226645 3:165999944-165999966 ACAAAGTGTCTACGGTGGCAGGG - Intergenic
965291634 3:166888764-166888786 ACAAAGTGAACATTGTAGCAGGG - Intergenic
966342054 3:178936394-178936416 ACAAAGTCAGTAAAGTTGCAGGG - Intergenic
966661419 3:182418823-182418845 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
966896565 3:184449418-184449440 AGAAAGTGACTGTTGTGGCAGGG - Intronic
967027287 3:185576015-185576037 AAAAAGTGAATATAGAGACATGG + Intergenic
967385010 3:188902523-188902545 AGAAAGGGACCGTAGTGGCAAGG + Intergenic
967423825 3:189303503-189303525 AGAAAGTGACTATAAATGCAAGG + Intronic
967831907 3:193926815-193926837 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
968800309 4:2738956-2738978 ACAGAGTGGCCATGGTGGCAGGG + Intergenic
968907130 4:3459238-3459260 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
970224086 4:13839110-13839132 ACAAAGTGACTACAGAGGAATGG - Intergenic
970524099 4:16913892-16913914 ACAAAGTGACCATGGTGTCAGGG + Intergenic
970629398 4:17924329-17924351 ACAAAGTGACCATGGTGGCAGGG + Intronic
971100899 4:23465594-23465616 GCAAAGTGGCCATGGTGGCAGGG - Intergenic
971687272 4:29786261-29786283 ACACAGTGGCCATGGTGGCATGG - Intergenic
971817341 4:31505899-31505921 ACAAAGTGGCCATTGTGGCAGGG + Intergenic
971857543 4:32062028-32062050 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
971897621 4:32617931-32617953 ACAAAATGGCCATACTGGCAGGG + Intergenic
972085332 4:35207912-35207934 ACAAAGTGGCCATGGTGGCATGG + Intergenic
972093326 4:35316706-35316728 ACAAAGTGGCCATAGTGGCAGGG + Intergenic
972201192 4:36716356-36716378 GCAAAGTGGCCATGGTGGCAGGG - Intergenic
972240743 4:37189094-37189116 ACAAAGTGGCCACGGTGGCAGGG + Intergenic
972806036 4:42530155-42530177 ACAAAGTGGCCATGGTGGCAAGG + Intronic
972882858 4:43447346-43447368 ACAAAGTCGCCATGGTGGCAGGG - Intergenic
973103032 4:46295569-46295591 ACAATGTGGCCATGGTGGCAGGG + Intronic
973118546 4:46489871-46489893 ACAAAGTGGCCATGATGGCAGGG + Intergenic
974137337 4:57835130-57835152 ACAAAGTGGCCATAGTGACAGGG - Intergenic
974564898 4:63569137-63569159 ACAAAGTGGACATGGTGGCAGGG + Intergenic
974727336 4:65813364-65813386 ACAATGTGGCCATGGTGGCAGGG + Intergenic
975109644 4:70609182-70609204 TTGAAGTGACAATAGTGGCAGGG - Intergenic
975386602 4:73766686-73766708 GCAAAGTGGCCATGGTGGCAGGG - Intergenic
975569155 4:75794812-75794834 AAAAAGTAACTATAGTGAAAAGG + Intronic
975742303 4:77441541-77441563 ACAAAGTGACCATGGTGGCAGGG + Intergenic
976034091 4:80794996-80795018 ACAAAGTGGCCATGGTGGCAGGG - Intronic
976080261 4:81347077-81347099 ACCAAGAGAATATAGTGGAAGGG - Intergenic
977204826 4:94156462-94156484 ACAAAGTGGCCATGGAGGCATGG + Intergenic
977430882 4:96929037-96929059 ACAAAGTGGCCATGGTGGCCGGG + Intergenic
977466124 4:97384202-97384224 ACAAAGTGGCCATGGTGGCAGGG + Intronic
977833115 4:101617013-101617035 ACAAAGTGGCCATGGTGGCAGGG - Intronic
977898825 4:102395412-102395434 ACAAAGTGGCCATGGTGGTAGGG + Intronic
977930289 4:102742992-102743014 ACAAAGTGGCCATGGTGGCAGGG - Intronic
978050919 4:104198935-104198957 GCAAAGTGACCATAATGCCAGGG - Intergenic
978341461 4:107724721-107724743 ACAAAGTGGCCATGATGGCAGGG - Intergenic
978656356 4:111070168-111070190 ACAAAGTGACAAGTGTGGCCGGG - Intergenic
978898951 4:113925986-113926008 ACAAAGTGGCCATGGTGGCAGGG - Intronic
979048285 4:115897316-115897338 ACAAATTGGCCATGGTGGCAGGG + Intergenic
979051795 4:115944400-115944422 ACAAAGTGGCCATTGTGGCATGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979595578 4:122530787-122530809 ACAAAGTGCTCATGGTGGCAGGG - Intergenic
979767124 4:124475422-124475444 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
979855256 4:125624234-125624256 ACACAGTTACTGTATTGGCAGGG + Intergenic
980385679 4:132086233-132086255 AAAAAGTGGCCATGGTGGCAGGG - Intergenic
980405773 4:132352963-132352985 ACAAAGTGGCCATAGTGGCAGGG - Intergenic
980957843 4:139446741-139446763 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
981166902 4:141570567-141570589 ACAAAATGTCAATAGTGCCAAGG + Intergenic
981478047 4:145208249-145208271 ACAAAGTGACCATAGCAGTAGGG - Intergenic
981572553 4:146168196-146168218 ACAAAGTTACTATAGAGAAAGGG - Intergenic
981835117 4:149044767-149044789 ACAAAGTGGCTCTGGTGGCAGGG + Intergenic
981979268 4:150771793-150771815 ACAAGGTGGCCATGGTGGCAGGG - Intronic
982420015 4:155183794-155183816 ACAAAATGACAATAGTGGTAGGG + Intergenic
982597662 4:157406217-157406239 ACAAAGTGGCCATAGTAGCAGGG - Intergenic
982847895 4:160275127-160275149 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
982850950 4:160315830-160315852 ACAAAGTGGCCATGGTGGCAAGG - Intergenic
983027518 4:162756115-162756137 ACAAAGTGGCCATGGTGACAGGG + Intergenic
983185187 4:164692401-164692423 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
983481495 4:168279956-168279978 AAAAAGTGACAACAGTGGCTGGG + Intronic
983582798 4:169325640-169325662 ACAAAGTGCCCATGGTGACAGGG + Intergenic
986036927 5:3949624-3949646 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
986143521 5:5054322-5054344 GCAAAGTGCCTATGGAGGCATGG + Intergenic
986531285 5:8739496-8739518 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
986743069 5:10720585-10720607 ACAAAGTGGCCATGGTGGCAGGG + Intronic
986766274 5:10931131-10931153 ACAAAATGGCCATGGTGGCAGGG + Intergenic
986938221 5:12917925-12917947 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
986959945 5:13200010-13200032 GCAAAGTGGCCATGGTGGCAGGG + Intergenic
987153302 5:15062494-15062516 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
987490703 5:18577484-18577506 AGGAAGTGACTTTGGTGGCAGGG - Intergenic
987578227 5:19757484-19757506 ACAAAGTGGCCATGTTGGCAGGG - Intronic
987885563 5:23807327-23807349 AGAAAGTAGCCATAGTGGCAGGG + Intergenic
988079714 5:26400601-26400623 ACAAAGTGGCCATGGTGACAGGG - Intergenic
988160711 5:27516043-27516065 ATAAAGTGACCATGGTGACAGGG - Intergenic
988205184 5:28124526-28124548 ACAAAGTGGCAATGGTGCCAGGG - Intergenic
988258274 5:28849368-28849390 ACAATGTGGCCACAGTGGCAGGG + Intergenic
988358629 5:30207718-30207740 ACAAAGTGGCCATGATGGCAGGG - Intergenic
989045038 5:37266459-37266481 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
989097958 5:37798152-37798174 ACAAAATGGCCATAGTGGCAGGG + Intergenic
989307387 5:39973796-39973818 ACAAAGTGGCCATGGTGACAGGG - Intergenic
989457532 5:41660941-41660963 ACAAAGTGGCCACAGTGGCAGGG - Intergenic
989486266 5:41995533-41995555 ACAAAGTGGCCATGGTGACAGGG - Intergenic
990748216 5:58982763-58982785 ACAAAGTGGCCATGGTGGCAGGG - Intronic
991013676 5:61910061-61910083 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
991033668 5:62106751-62106773 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
991234268 5:64376002-64376024 ACAAAGTGGCCGTGGTGGCAGGG + Intergenic
991330623 5:65488859-65488881 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
991426957 5:66502175-66502197 ACAGAGTGTCTATAGAGGGATGG - Intergenic
991946262 5:71900952-71900974 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
992099768 5:73395839-73395861 ACAAAGTGGCCATGGTAGCAGGG + Intergenic
992109776 5:73482046-73482068 ACAAGGTGACCGTAATGGCAGGG - Intergenic
992243072 5:74790679-74790701 ACAAAGTGGCCATGGTGACAGGG + Intronic
993231802 5:85246712-85246734 ACAAAGTAACAGTGGTGGCAGGG - Intergenic
993319934 5:86459406-86459428 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
994291251 5:98031127-98031149 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
994917058 5:105994304-105994326 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
994984296 5:106914900-106914922 ACAAAGTGGCCGTGGTGGCAGGG - Intergenic
995427618 5:112042923-112042945 TCAAAGTGGCCATGGTGGCAGGG - Intergenic
995776165 5:115726873-115726895 ACAAAGTGGCCATGGTGGTAGGG - Intergenic
996018676 5:118568694-118568716 ACAAAGTGGCCATGATGGCAGGG + Intergenic
996042522 5:118831807-118831829 ACAAAGTGACCATAAAGACAAGG + Intergenic
996164850 5:120211689-120211711 ACAAAGTGGCCATGGTGTCAGGG - Intergenic
996392089 5:122972963-122972985 ACAAAGTGGCCATGGTGTCAGGG - Intronic
996488585 5:124065846-124065868 ACAAAGTGGCCATGATGGCAAGG - Intergenic
996825681 5:127678654-127678676 ACAAAGTCGCCATGGTGGCAGGG + Intergenic
996944283 5:129047956-129047978 ACAAAGTGGCCATGGTTGCAGGG - Intergenic
998049108 5:139016618-139016640 ACCAAGGGACTATAATGACATGG + Intronic
998290215 5:140907726-140907748 ACAAAGTGGCCATGGTGGCAGGG - Intronic
999351491 5:150875659-150875681 ACAAAGTGGCCATGGTGGCAGGG + Intronic
999657179 5:153822053-153822075 AAAAAGCGACTATAGTTGCCTGG - Intergenic
1000201407 5:159014568-159014590 CCAAAGTCACTATGGTGACAAGG + Intronic
1000417086 5:160994728-160994750 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1000542346 5:162555660-162555682 ACAGAGTGACTGCAGAGGCATGG - Intergenic
1002998088 6:2305587-2305609 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1003758729 6:9150912-9150934 ACAAAGTGGCCTTAGTGGCAGGG + Intergenic
1003771986 6:9315623-9315645 ACAAAGTAACTATTGTTGGAAGG - Intergenic
1003791345 6:9550874-9550896 ACAAAGTGGCCATAGTGGCAGGG + Intergenic
1004824172 6:19402406-19402428 ACAAAATGGCCATGGTGGCAGGG - Intergenic
1004945164 6:20604216-20604238 AAAAGGTGGCTATATTGGCAGGG + Intronic
1005185294 6:23157892-23157914 ACAAAGTGGCCACAGTGGCAGGG + Intergenic
1005379287 6:25217329-25217351 GCAAAGTGGCCATACTGGCAGGG + Intergenic
1006146895 6:31964822-31964844 ACAAAATAACTATATTGGCCGGG + Intronic
1008340379 6:50357106-50357128 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1008400402 6:51056293-51056315 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1008996358 6:57664668-57664690 ACAAAGTGGTAATGGTGGCAGGG + Intergenic
1009389993 6:63134247-63134269 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1009580304 6:65525024-65525046 AAAAAGTGGCCATGGTGGCAAGG - Intronic
1009661222 6:66613606-66613628 ACAATGTGATTATCATGGCAGGG - Intergenic
1009770232 6:68136030-68136052 ATAAAGTGGCCATGGTGGCAGGG - Intergenic
1010818744 6:80389236-80389258 ACAAAATGCCCATGGTGGCAGGG + Intergenic
1010938129 6:81885596-81885618 ACAAAGTGGCCATCGTGGCAGGG - Intergenic
1010993919 6:82511724-82511746 ACAAAGTTCAGATAGTGGCATGG - Intergenic
1011001201 6:82590415-82590437 ACAATGTGGCTGTAGTGTCAAGG + Intergenic
1011039235 6:83012473-83012495 AGAAAGTGCCCATGGTGGCAGGG - Intronic
1011069222 6:83362481-83362503 ACAAAGTACCCATGGTGGCAGGG + Intronic
1011072562 6:83401681-83401703 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1011560132 6:88605793-88605815 ACCAAGAGACTACAGTGGCCTGG + Intergenic
1012288697 6:97424105-97424127 ACACAGTGACCATAGTGGAAGGG - Intergenic
1012344702 6:98171149-98171171 ATAAAGTGGCCATGGTGGCAGGG + Intergenic
1013184259 6:107744453-107744475 ACAAAGTGTCTATTATTGCAGGG - Intronic
1013406789 6:109850628-109850650 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1014363285 6:120507525-120507547 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1014417107 6:121196216-121196238 ACAAAGTGGCCACTGTGGCAGGG + Intronic
1014534070 6:122595776-122595798 ACAAAGTGGCCATAGTGGCAGGG - Intronic
1014631758 6:123797620-123797642 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1015443171 6:133271735-133271757 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1015502372 6:133947758-133947780 ACAAAGTGGCCACAGTGGTAGGG - Intergenic
1015527570 6:134188049-134188071 ACAAAGTAGCCATGGTGGCAAGG - Intronic
1016144413 6:140650232-140650254 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1016147210 6:140691887-140691909 ACAAAGTGGCCATGGTGGCTTGG - Intergenic
1016533660 6:145087030-145087052 ACTAAGTGACTATTGAGGCTAGG + Intergenic
1016576147 6:145571761-145571783 ACAAAGTGGCCATGGTGGCATGG - Intronic
1017043966 6:150330120-150330142 ACAAAGGGAACATGGTGGCAGGG - Intergenic
1017227691 6:152040260-152040282 ACAAAGTGGCTGTGGTGGCAGGG - Intronic
1017976919 6:159366320-159366342 ACAAAGGGGCCATGGTGGCAGGG - Intergenic
1018540882 6:164877946-164877968 ACAAAGTGGCCATGGTGTCAGGG + Intergenic
1018600009 6:165528364-165528386 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1020152847 7:5696837-5696859 CCATAGTGACTACATTGGCAAGG + Intronic
1020960502 7:14796975-14796997 GCAAAGAGACTATACTGACATGG + Intronic
1021380340 7:19958583-19958605 CCAAAGTGTCAATAGTGTCATGG + Intergenic
1021942505 7:25691901-25691923 ATATGGTGACTATTGTGGCAAGG - Intergenic
1021988931 7:26123748-26123770 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1022079004 7:27001157-27001179 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1024040658 7:45550973-45550995 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1024177396 7:46855125-46855147 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1024884234 7:54123819-54123841 ACAAAGTGGCTATGGTAGCAGGG - Intergenic
1024920502 7:54549179-54549201 ATAAAGTCCCTATAATGGCATGG + Intronic
1025254882 7:57377688-57377710 ACAAAATGTCAATAGTGTCAAGG - Intergenic
1026046370 7:66908276-66908298 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1026207705 7:68272549-68272571 ACAAAGTGGCCATGATGGCAGGG + Intergenic
1027406941 7:77872179-77872201 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1027504693 7:79001208-79001230 AAAAAGTGAATAAAGTGGCCGGG - Intronic
1027685913 7:81278781-81278803 GCAAAGTGGCCATGGTGGCAGGG + Intergenic
1027799859 7:82737234-82737256 ACAAAGTTGCCATGGTGGCAGGG + Intergenic
1028043960 7:86092288-86092310 ACAAAGTAGCCATGGTGGCAGGG + Intergenic
1028141850 7:87282810-87282832 ACAAAGTGGCTATGGTGGCAGGG + Intergenic
1028237943 7:88383648-88383670 ATAAAGTGGCCATGGTGGCAGGG + Intergenic
1028360644 7:89962782-89962804 ACAAAGTGGCCATGGTAGCATGG - Intergenic
1028935131 7:96455891-96455913 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1029005686 7:97206852-97206874 ACAAAGTGGCCATGGCGGCAGGG - Intergenic
1030277664 7:107737466-107737488 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1030305610 7:108016121-108016143 ACAAACTGAGTATAGTCGCAGGG + Intergenic
1030519393 7:110579221-110579243 GTAAAGTGATAATAGTGGCAAGG + Intergenic
1030582721 7:111379562-111379584 ATCAAGTGAATATAGTGGAAAGG + Intronic
1030883166 7:114905721-114905743 ACAAAGTGGCCATGATGGCAGGG - Intergenic
1030931170 7:115524855-115524877 ACAAAGTGGCCATGATGGCAGGG - Intergenic
1031682149 7:124688174-124688196 ACAAAATGACCATGGTGGCAGGG + Intergenic
1031767902 7:125804527-125804549 ACAAATTGGCCATGGTGGCATGG + Intergenic
1031833122 7:126650842-126650864 ACAAAGTGGCCATTGTGGCAGGG + Intronic
1032583937 7:133129375-133129397 ACAGAGTGCCTGTGGTGGCAGGG + Intergenic
1033135493 7:138780631-138780653 ACAAAGTGGCTATGGTGGCAGGG - Intronic
1034169924 7:149055097-149055119 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1036527149 8:9545993-9546015 ACAAAATGGCCATAGTGGCAAGG - Intergenic
1037019990 8:13958439-13958461 ACAAAGTGGCCATGGTAGCAGGG + Intergenic
1037181242 8:16007827-16007849 ACAAAGGGACCTTAGTGACAAGG - Intergenic
1037285883 8:17299900-17299922 ACCGAGTGAAGATAGTGGCAAGG - Exonic
1037364469 8:18107436-18107458 ACAAAGTGGCCACAGTGGCAGGG - Intergenic
1037953774 8:23037219-23037241 ACAAAGTGTGCATGGTGGCAGGG + Intronic
1037980554 8:23250349-23250371 ACAAAGGGACAAGAGGGGCAGGG - Intronic
1038722943 8:30054342-30054364 ACAAAGTGGCTAAGGTGGTAGGG - Intergenic
1039292223 8:36109105-36109127 ACAAAGTGGCCATCATGGCAGGG - Intergenic
1039324057 8:36465719-36465741 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1040912058 8:52529242-52529264 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1041317348 8:56578369-56578391 AGGATGTGACTATAGTGGAATGG - Intergenic
1041448104 8:57975697-57975719 AAAAAATGACCACAGTGGCAAGG - Intergenic
1041935423 8:63326830-63326852 ACAAAGTGGCAATGGTGGCAGGG + Intergenic
1041986299 8:63925296-63925318 ACAAAGTGGCCGTAGTGGCAAGG + Intergenic
1043258040 8:78159645-78159667 ACAGAGTGGCCATGGTGGCAGGG + Intergenic
1044150912 8:88773897-88773919 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1044285858 8:90411619-90411641 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1044487040 8:92766357-92766379 ACAAAGTGGCCATGGGGGCAGGG - Intergenic
1044633032 8:94297576-94297598 ACAAACTGGCCATGGTGGCAGGG - Intergenic
1046063890 8:109174407-109174429 ACAAAGTGGCCATGGTGACAGGG - Intergenic
1046128556 8:109940770-109940792 ACAAAGTGTCCATGGTGGCAGGG - Intergenic
1046197673 8:110885049-110885071 ACAAAGTGGCCATGATGGCAGGG + Intergenic
1046417531 8:113936967-113936989 ACAAAGTGGCCATGGTGGTAGGG - Intergenic
1046585671 8:116146912-116146934 ACAAAGTGGCTGTGGTGGCAGGG - Intergenic
1047453736 8:124990137-124990159 GCAAAGTGGCCATGGTGGCAGGG + Intergenic
1047803778 8:128337546-128337568 ACCAATTTACTATAGTAGCAAGG + Intergenic
1049712673 8:144073008-144073030 ACAGAGTGGCCATGGTGGCAGGG + Intergenic
1050901899 9:10960460-10960482 ACAAAGTTGCCATGGTGGCAGGG + Intergenic
1051475917 9:17509102-17509124 GCAAAGTGGCCATGGTGGCAGGG + Intergenic
1051702753 9:19841888-19841910 ATAAAGTGTCTATGGTGGCAGGG + Intergenic
1051978347 9:22982252-22982274 ACAAAGTGGCCATATTAGCAGGG - Intergenic
1052204387 9:25821277-25821299 ACAAAGTGACTGTGATGGCAGGG - Intergenic
1052227698 9:26109198-26109220 ACAAAGTGGCCATGGTGGCTGGG + Intronic
1052309899 9:27054613-27054635 ACAAAGTAACTTTAGTGAGAGGG - Intronic
1052442150 9:28511463-28511485 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1052561455 9:30089170-30089192 ACAAAGTAGCTATGGTGGAAGGG - Intergenic
1053942832 9:43269715-43269737 ACATAGTGGCCATGGTGGCAGGG - Intergenic
1054405823 9:64761887-64761909 ACATAGTGGCCATGGTGGCAGGG - Intergenic
1054439450 9:65247374-65247396 ACATAGTGGCCATGGTGGCAGGG - Intergenic
1054490957 9:65774565-65774587 ACATAGTGGCCATGGTGGCAGGG + Intergenic
1055903823 9:81270367-81270389 ACAAAGTGACCATGGTGACAGGG - Intergenic
1056156792 9:83846031-83846053 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1056314118 9:85372119-85372141 ATAAAGTGGCCATGGTGGCAGGG - Intergenic
1056353744 9:85777495-85777517 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1057059105 9:91987383-91987405 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1058020020 9:100076887-100076909 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1058124693 9:101178204-101178226 ACAAAGTGGCCATGGTGGCAAGG + Intronic
1058259147 9:102808860-102808882 ACAAAGTGCCCATGGTGGCAGGG - Intergenic
1059047752 9:110888873-110888895 AAAAAATGAATTTAGTGGCAAGG + Intronic
1059069791 9:111123417-111123439 ACAAAGTGACCATGTTGGCAGGG - Intergenic
1059196387 9:112375036-112375058 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1059786694 9:117593996-117594018 ACAAATTGACTTTAGAGTCATGG - Intergenic
1061455676 9:130695812-130695834 GCAAAGTGAGTATAATAGCATGG + Intronic
1062135595 9:134925834-134925856 ACAAAGTGGCCATTATGGCAGGG + Intergenic
1186469651 X:9811310-9811332 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1187524036 X:20037952-20037974 ACAAAGTGGCCACGGTGGCAGGG + Intronic
1189075778 X:37912805-37912827 ATCAAATGACTATTGTGGCAGGG + Intronic
1191009204 X:55743506-55743528 ATAAAGTGGCCATGGTGGCAGGG - Intronic
1191629911 X:63311759-63311781 AAAAAGTGGCCATGGTGGCAGGG - Intergenic
1191658681 X:63628983-63629005 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1191933022 X:66394969-66394991 ACAAATTGGCCATGGTGGCAGGG + Intergenic
1191941149 X:66483053-66483075 ACAAAGTGGCCGTAGTGGCAGGG - Intergenic
1192297598 X:69867203-69867225 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1192661462 X:73046958-73046980 ACAAAGTGGCTATGGTGACAGGG - Intergenic
1192896398 X:75447045-75447067 ACAAAGTGGCCATGGTGGCAGGG + Intronic
1192898823 X:75472731-75472753 ACAAAGTGGCTGTGGTGGCAAGG + Intronic
1193115530 X:77771931-77771953 ACAAAATGTCTATAGTGCCAAGG + Intronic
1193231386 X:79050863-79050885 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1193297889 X:79853481-79853503 ACAAAGTGGCCATGGTGGCAAGG + Intergenic
1193447274 X:81619587-81619609 ACAAAGCGGCCATGGTGGCATGG + Intergenic
1193543539 X:82799789-82799811 ACAAAGTGGCCATGGTAGCAGGG + Intergenic
1193833065 X:86310931-86310953 ACAAAGAGGCCATGGTGGCAGGG + Intronic
1193904592 X:87226643-87226665 ACAAAGTGGCCATGGTGGCGGGG + Intergenic
1193914697 X:87351109-87351131 GCAAAGTGATTATGGTGGCAGGG - Intergenic
1193957406 X:87879042-87879064 ATAAAGCGGCTATGGTGGCAGGG + Intergenic
1194123185 X:89985612-89985634 ACAAAGTGGCCGTGGTGGCAGGG + Intergenic
1194174733 X:90631659-90631681 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1194210386 X:91063175-91063197 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1194343425 X:92731910-92731932 ACAAAGGGGCCATGGTGGCAGGG + Intergenic
1194453998 X:94080016-94080038 ATAAAGTGGCCATGGTGGCAGGG - Intergenic
1194469625 X:94276841-94276863 TCAAAGTGTCAATAGTGCCAAGG + Intergenic
1194485220 X:94478150-94478172 ACAAAGTGGCCATTGTGGCAGGG + Intergenic
1194604263 X:95961028-95961050 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1194626695 X:96233828-96233850 ACAAAGTAGCCATGGTGGCAAGG + Intergenic
1194834063 X:98659624-98659646 ACAAAGTGGCCATGGTGGCAGGG + Intergenic
1194849131 X:98851342-98851364 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1195262766 X:103149806-103149828 ACAAAGTGCCCATGGTAGCAGGG + Intergenic
1195748405 X:108141246-108141268 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1195748815 X:108144537-108144559 ACAAAGTGGCCATGGTGGCAGGG - Intronic
1195809676 X:108816024-108816046 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1196135851 X:112209017-112209039 ACAAAGTGGCCACGGTGGCAGGG - Intergenic
1197084093 X:122452678-122452700 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1197182211 X:123548606-123548628 ACAAAGTGGCCATGGTGACAGGG + Intergenic
1197244933 X:124158177-124158199 ACAAAGTGGCCATGGTAGCAGGG - Intronic
1197371940 X:125637041-125637063 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1197386664 X:125811418-125811440 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1197405159 X:126039766-126039788 AGAAAGTGGCCATGGTGGCAGGG + Intergenic
1197419994 X:126227156-126227178 AAAAAGTGGCCATAGTGGCAGGG + Intergenic
1197477250 X:126940607-126940629 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1197534790 X:127674248-127674270 ACAAAACGGCTACAGTGGCAGGG + Intergenic
1197591989 X:128420210-128420232 ACAAAGTAGCCATGGTGGCAGGG + Intergenic
1197707162 X:129642310-129642332 ACAAAGTGATTCCAGTGGAAGGG - Intergenic
1198701417 X:139401122-139401144 ACCAAGTGGCCATGGTGGCAGGG + Intergenic
1198782923 X:140256986-140257008 GCAAAGTGGCCATGGTGGCAGGG - Intergenic
1198934154 X:141888681-141888703 ACAAAGTGGCCATAGTGGCATGG + Intronic
1199008609 X:142731778-142731800 ATAAAGTGGCCATAGTGGCATGG + Intergenic
1199013200 X:142781096-142781118 ACAAAGTGGCCATGGTGTCAGGG + Intergenic
1199116461 X:143998434-143998456 AAAAAGTGGCCATGGTGGCAGGG - Intergenic
1199144346 X:144348152-144348174 ACAAAGCGACCATGGTGGCAAGG - Intergenic
1199310312 X:146313577-146313599 ACAAAGTGGCCATGGTGGCAGGG - Intergenic
1199553978 X:149086655-149086677 ACAAAGTGGCCACAGTGGCATGG + Intergenic
1199580450 X:149354995-149355017 ACAAAGTGGCCATGGTGGTAGGG + Intergenic
1199875649 X:151925834-151925856 ACAAAATGAAAATAGTGGTATGG + Intergenic
1199889947 X:152068841-152068863 ACAGAGTGGCTGTAGTGGCAGGG + Intergenic
1200289503 X:154858228-154858250 ACAAAGTAGCCATGGTGGCAGGG + Intronic
1200340365 X:155389817-155389839 ACAAAGTGGCCATGGTGCCAGGG - Intergenic
1200521379 Y:4212848-4212870 ATAAAGTGGCCATGGTGGCAGGG + Intergenic
1200651779 Y:5848575-5848597 ACAAAGGGGCCATGGTGGCAGGG + Intergenic
1200976716 Y:9219260-9219282 ACAAAGCGTCTATGATGGCAGGG + Intergenic
1201193605 Y:11470594-11470616 ACATAGTGGCCATGGTGGCAGGG - Intergenic
1201529549 Y:14977084-14977106 AGAAAGTGGCCATGGTGGCAGGG - Intergenic