ID: 1096459780

View in Genome Browser
Species Human (GRCh38)
Location 12:51815641-51815663
Sequence GGTAGGCAGGGCCCCAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096459780_1096459785 2 Left 1096459780 12:51815641-51815663 CCAACACTGGGGCCCTGCCTACC 0: 1
1: 1
2: 1
3: 25
4: 232
Right 1096459785 12:51815666-51815688 CACTTATTCCATTTCCCCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 184
1096459780_1096459787 10 Left 1096459780 12:51815641-51815663 CCAACACTGGGGCCCTGCCTACC 0: 1
1: 1
2: 1
3: 25
4: 232
Right 1096459787 12:51815674-51815696 CCATTTCCCCCAAGGAAGCTTGG 0: 1
1: 0
2: 3
3: 18
4: 190
1096459780_1096459789 16 Left 1096459780 12:51815641-51815663 CCAACACTGGGGCCCTGCCTACC 0: 1
1: 1
2: 1
3: 25
4: 232
Right 1096459789 12:51815680-51815702 CCCCCAAGGAAGCTTGGCTCTGG 0: 1
1: 0
2: 2
3: 23
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096459780 Original CRISPR GGTAGGCAGGGCCCCAGTGT TGG (reversed) Intergenic
901202722 1:7475829-7475851 GGTAGGCAGGGCCCTGGTCCAGG + Intronic
901840354 1:11950297-11950319 GGTGAGCAGGGGCCCAGTGAGGG - Intronic
902592934 1:17487960-17487982 GGTGGGCAGGGAGCCAGGGTAGG + Intergenic
902802575 1:18839554-18839576 GGGAGGGAGGGCCACAGAGTTGG - Intergenic
904762531 1:32816328-32816350 GGTAGGCAGGGACCAAGTCACGG - Intronic
905793033 1:40800237-40800259 GGGAGGGATGGGCCCAGTGTGGG + Intronic
906480659 1:46197286-46197308 GGTAGGGAGGGCCCTAATGGAGG - Intronic
906779940 1:48564340-48564362 GGTAGTCAGGGCCTCTGTCTAGG + Intronic
907316384 1:53575350-53575372 GGCAGGCAGGGGCCCGGTGATGG - Intronic
910137885 1:83994437-83994459 GAAGGGCAGGGGCCCAGTGTTGG - Intronic
912903452 1:113677987-113678009 GGTAGACAGGCCCTCAGAGTGGG - Intronic
913264032 1:117026943-117026965 GGTAGTCAGGGAGGCAGTGTGGG + Intronic
915511606 1:156389829-156389851 GGAAGGCAGGGCCCCACCGCTGG + Intergenic
915591888 1:156875463-156875485 GGTGGGCAGGGCCAAGGTGTGGG + Intronic
917184720 1:172340430-172340452 GCTAGGCAGGGGACCAGTATGGG - Intronic
919785999 1:201259179-201259201 GGGAGGCAGGGCTGCAGTGGGGG + Intergenic
921164458 1:212496559-212496581 GGAAGGCAGGGCCCCAGAGCAGG - Intergenic
922665436 1:227464943-227464965 GGTTGGCAGGGCCCTACTGTGGG + Intergenic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923622629 1:235590720-235590742 GGTGTGCAGGGCCACAGTGCTGG - Intronic
1062907527 10:1188951-1188973 GGAGGGCTGGGCCCCAGCGTGGG - Intronic
1064297193 10:14089324-14089346 GGTGGGCTGGGCCCCAGCGGGGG - Intronic
1067684387 10:48457989-48458011 GGTGGGGAGGGCCCCTCTGTGGG + Intronic
1068599546 10:58942052-58942074 AATAGGCAGGGCACCACTGTAGG + Intergenic
1069107807 10:64405382-64405404 GGTAGGTGGTGGCCCAGTGTAGG + Intergenic
1069787218 10:70996614-70996636 GGGAGGCAGGACTCAAGTGTGGG + Intergenic
1069857586 10:71450156-71450178 GATAGGCAGGGCCAAGGTGTGGG - Intronic
1070701101 10:78602313-78602335 GCCAGGCTGGGCCCCAGTGCGGG + Intergenic
1074243368 10:111662191-111662213 GGAAGGCAGGGAGTCAGTGTGGG + Intergenic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1074831756 10:117254497-117254519 GGTGGGTAAGGCCCCCGTGTAGG + Exonic
1075737008 10:124670220-124670242 CTTAGGCAGGGCCCCAGTGTCGG - Intronic
1076704459 10:132293666-132293688 GGCAGGCAGGGCCAGAGTGGGGG + Intronic
1077021738 11:420048-420070 GTTAGGGAGGCCCCCAGTCTCGG - Intronic
1077407311 11:2388450-2388472 GGGAAGCAGGGCCCCAGGGTGGG - Intronic
1081716525 11:45254435-45254457 GGAAAGCAGAACCCCAGTGTGGG - Intronic
1084447185 11:69210416-69210438 GATAGGCAGGGCCACACTGTGGG + Intergenic
1084959180 11:72707296-72707318 GGTAGACAGGGCCTCAGCGATGG + Exonic
1085054265 11:73394796-73394818 GGGAGGCAGGGCCCCAGCTTGGG + Intronic
1086286217 11:85254120-85254142 AGTGGGCAGGTCCCCAGTGAGGG - Intronic
1086988832 11:93280206-93280228 GGTAGGCATTCCCTCAGTGTGGG - Intergenic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1090134009 11:124176865-124176887 ACTAGGCAGGGTCCCAGTGCAGG - Intergenic
1090293917 11:125569646-125569668 GGCAGGCAGGGCCCGAGCGTGGG + Intronic
1091217132 11:133909001-133909023 GGCAGGGAGGGCCACTGTGTGGG - Exonic
1091405698 12:208018-208040 GGGAGGCAGGGCCGCGGTGTCGG - Intronic
1096421728 12:51464482-51464504 GGGAAGCAGGTCCCCAGAGTAGG + Intronic
1096459780 12:51815641-51815663 GGTAGGCAGGGCCCCAGTGTTGG - Intergenic
1097245481 12:57605305-57605327 GGGAGGCGGGGCCCCAGTTTAGG - Intronic
1102047555 12:109839526-109839548 AGGAGGCGGGGCCCCATTGTGGG - Intergenic
1103201458 12:119091356-119091378 GGAAGCCAAGGCCTCAGTGTAGG + Intronic
1104720542 12:131042977-131042999 GGTTGGCAGGGCCGCAGGGCGGG - Intronic
1104742031 12:131184718-131184740 ACTAGGCAGTGCCCCAATGTGGG + Intergenic
1104858710 12:131913836-131913858 GGTAAGCAGGGCCCCAGGCTGGG + Exonic
1105910707 13:24863470-24863492 GGTAGGGAGAGCCTCAGTGGAGG + Intronic
1111685599 13:91497689-91497711 GGAAGGCAGGGCAGCAGTTTTGG + Intronic
1112210536 13:97373001-97373023 GTTCAGCAAGGCCCCAGTGTGGG + Intronic
1113029359 13:105976561-105976583 AGTAGGCAGTGCCCCAATGCGGG + Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1116485543 14:45444197-45444219 ATTAGGCAGTGCCCCAGTGTGGG - Intergenic
1121668886 14:95692957-95692979 GGGAGGAAGGGCCCATGTGTGGG + Intergenic
1122968670 14:105143701-105143723 TGTGGCCAGGGCCTCAGTGTTGG - Intronic
1124619293 15:31264868-31264890 GGGAGGAAAGGCCCCACTGTGGG + Intergenic
1126670823 15:51113669-51113691 GGAAGGCAGGGACTCTGTGTGGG - Intergenic
1126850624 15:52794931-52794953 GGAATGCAGGGCCCCAGCGGGGG - Intergenic
1127375088 15:58376887-58376909 GGAAGGAAGGGCGCCAGTTTTGG + Intronic
1130112460 15:80977081-80977103 GGGAGGCTGGGGCCCAGTGCAGG - Exonic
1132760750 16:1507500-1507522 GCCAGGCAGGGCCGCAGCGTGGG + Intronic
1132844183 16:1992415-1992437 GGTAGGCGGGGCCCGGGTCTGGG + Intronic
1134844322 16:17427051-17427073 GGTAGGCAGAGCCCATGTGATGG + Intronic
1136340807 16:29641920-29641942 GGTGGCCAGGGCCCCAGCTTTGG + Intergenic
1137000173 16:35222254-35222276 CCTGGGCAGGGGCCCAGTGTGGG - Intergenic
1139180775 16:64745841-64745863 AGGAGGCAGAGCTCCAGTGTTGG + Intergenic
1139333917 16:66217461-66217483 GGAAGGCAGGGCCCTGGTGTTGG - Intergenic
1139580024 16:67867534-67867556 GGTAGGGAGGGTCCCAGACTAGG + Intronic
1139922567 16:70469214-70469236 GGTGGGGAGGCCCCCAGAGTTGG + Exonic
1141524879 16:84604697-84604719 GTTAGGCAGGGGCCCAGAGGGGG + Intronic
1142226629 16:88880837-88880859 GGTGGGGAGGGCCCCAGCGTGGG - Intronic
1143204241 17:5131631-5131653 GATGGGCAGGGCCCCATTCTGGG + Intronic
1143544413 17:7588048-7588070 CTCAGGCAGGGCCCCAGGGTGGG + Exonic
1143697245 17:8630097-8630119 GGCAGGAAGGGCCCCTGCGTGGG - Intronic
1143762652 17:9116251-9116273 GGTAGGCAGAGCCCCCGGGAGGG + Intronic
1144772700 17:17768835-17768857 GGTGGGCAGGGCCCCATTAGGGG + Intronic
1145746691 17:27325225-27325247 GGCAGCCAGTTCCCCAGTGTAGG - Intergenic
1146169372 17:30621263-30621285 GGGAGGCAGGGCCCTAGAGGAGG + Intergenic
1146170190 17:30626186-30626208 GGGAGGCAGGGCCCTAGAGGAGG - Intergenic
1146176641 17:30669368-30669390 GGGAGGCAGGGCCACATTGGGGG + Intergenic
1146343642 17:32042215-32042237 GGGAGGCAGGGCCCTAGAGGAGG - Intronic
1146350102 17:32085483-32085505 GGGAGGCAGGGCCACATTGGGGG + Intergenic
1147185470 17:38711076-38711098 AGTGGGCAGCTCCCCAGTGTTGG - Intronic
1147678151 17:42221288-42221310 GGAAGGCTGGGCCCAGGTGTTGG - Intronic
1147687798 17:42297650-42297672 GGAAGGCTGGGCCCAGGTGTTGG + Intronic
1147786260 17:42980687-42980709 GGTGCGCTGGGCCCCAGTGGGGG + Exonic
1148090352 17:45019443-45019465 GGGAGGCAGCGCCCGAGGGTGGG + Intergenic
1148158499 17:45436871-45436893 GATAGGCAGGACCCCAGAGAGGG - Exonic
1150005921 17:61468957-61468979 GGTAGGGAGGGTCTCTGTGTGGG + Intronic
1151294044 17:73170490-73170512 GGGAGGCAGGAAGCCAGTGTGGG - Exonic
1152554261 17:81045289-81045311 GGGAAGCAGGGCCCCAGGCTGGG + Intronic
1152743812 17:82030238-82030260 GGTAGGCGGGGCTCCGGTGGGGG + Exonic
1156154680 18:34287693-34287715 GCTAGGCAGTACCCCAGTGGGGG + Intergenic
1156986990 18:43360486-43360508 GGTAGGAAGGGACCCAATGATGG - Intergenic
1160740503 19:683344-683366 GTGAGGCAGGGCCCCAGGGTGGG - Exonic
1160865231 19:1253239-1253261 GGCAGGCTGGGCCGCAGGGTGGG + Intronic
1161209502 19:3058814-3058836 GGTCCGCAGGGCCCCTGTGCTGG - Intronic
1161226463 19:3148788-3148810 GGCAGGCAGGGGCCCAGGGCAGG + Intronic
1161226471 19:3148805-3148827 GGCAGGCAGGGGCCCAGGGCAGG + Intronic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1162126147 19:8500413-8500435 GGTAGGCAGAGGCCCAGGGAAGG - Intronic
1162530318 19:11232171-11232193 GGTAGGAAGGGCACCTGTCTGGG + Intronic
1162922751 19:13913140-13913162 GGAGGGCAGGGGCACAGTGTGGG - Intronic
1162982179 19:14247519-14247541 GGGAGGCAGGGCCACATTGGGGG - Intergenic
1163110925 19:15160761-15160783 GGCAGGCAGTGCCCCAGTGGTGG + Exonic
1163553922 19:17982205-17982227 GGTCGGGAGGGGCCCAGGGTCGG - Intronic
1166398534 19:42460742-42460764 GGTGGGCAGGGCCCCAGTCCCGG + Intergenic
1166719018 19:44986971-44986993 GGCAGGCAGGTCCCCACTGAAGG - Intronic
1167377208 19:49118652-49118674 CGGAGGCAGGGACCCAGTCTGGG + Exonic
1167384360 19:49155434-49155456 GGGAGGGAGGGCCCCAGAGGGGG - Intergenic
1168432365 19:56291414-56291436 GATAGGCTGGGGCCCAGGGTGGG - Intronic
925391044 2:3494352-3494374 CTTAGCCAGGGCCCCAGTGATGG - Intergenic
926670704 2:15574651-15574673 GGAAGGCCAGGCCCCTGTGTGGG + Intergenic
926696090 2:15771015-15771037 GGAAGCCAGGGCCCGTGTGTGGG - Intergenic
926891642 2:17644085-17644107 GGATGGAAGGGCCTCAGTGTAGG + Intronic
929547307 2:42863952-42863974 GGGAGGCAGAGCCCCTCTGTTGG - Intergenic
933605005 2:84373550-84373572 GGGAGGGATGGCTCCAGTGTGGG - Intergenic
935703777 2:105838660-105838682 GCAAGGTAGGGCCTCAGTGTAGG + Intronic
935706207 2:105859813-105859835 GGGAGGCAGAGCCTCAGTGAAGG + Intronic
936500078 2:113059809-113059831 GGGAGGCAGGGGCACAGAGTGGG - Intronic
936598949 2:113876785-113876807 GCTAGGCAGGCCCCAAGCGTTGG + Intergenic
936626926 2:114158263-114158285 AGGAGGCAGGGCCCTAGAGTGGG - Intergenic
937324726 2:120983634-120983656 GGTAGGCAGAGCCCCTATCTGGG + Intronic
937381696 2:121383215-121383237 GGCAGGCAGGGCTGCTGTGTAGG - Intronic
937465734 2:122131597-122131619 GGAAGGCAGGGCCCCTCTGCTGG + Intergenic
938789778 2:134666323-134666345 GATGGGCAGGGGCCCAGTGTTGG - Intronic
938882547 2:135606159-135606181 GGTAGGCAAGGCTGCAGTGCTGG + Intronic
942678261 2:178450932-178450954 GGCAGTCAGGGCCCCAGGGCCGG - Intronic
943861605 2:192872002-192872024 GGTAGACTGGGCCCCTCTGTGGG + Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
944848193 2:203690181-203690203 GGGAGGCAGGTCCCCAAGGTGGG - Intergenic
946149565 2:217755164-217755186 GGTGGGCAGGACCTCAGAGTGGG - Intronic
947744492 2:232500620-232500642 GCTAGGGAGTGGCCCAGTGTGGG + Intergenic
947826128 2:233107213-233107235 GGTAGGCAGGGACCCAGCCTGGG + Intronic
948515818 2:238503402-238503424 GGTAGGCCGGGCTCCTGTGTGGG - Intergenic
1170749928 20:19136539-19136561 GGTCTGCAAGGCCCTAGTGTAGG - Intergenic
1170927031 20:20734136-20734158 GATTGGCAGGGGCCCAGTGAAGG - Intergenic
1172073758 20:32278013-32278035 GGTGGTCAGGGCCCCAGTTTGGG + Intronic
1173150420 20:40562232-40562254 GGTAGGTAGGTCCCCTGTCTGGG - Intergenic
1173547392 20:43909309-43909331 GGTAGACAGGGCCTCACTGGAGG + Intergenic
1173820822 20:46019250-46019272 GCTAAGGAAGGCCCCAGTGTGGG + Intergenic
1176053839 20:63134545-63134567 GGGAGGCGGGGCCCCAGGGGAGG + Intergenic
1176053939 20:63134775-63134797 GGGAGGCAGGGCCACAGGGGAGG + Intergenic
1176053978 20:63134863-63134885 GGGAGGCAGGGCCACAGGGGAGG + Intergenic
1176054001 20:63134916-63134938 GGGAGGCAGGGCCACAGGGGAGG + Intergenic
1176054089 20:63135110-63135132 GGGAGGCGGGGCCCCAGGGGAGG + Intergenic
1176054234 20:63135446-63135468 GGGAGGCAGGGCCACAGGGGAGG + Intergenic
1176106453 20:63391820-63391842 GGAAGGCAAGGTCCCACTGTGGG + Intergenic
1176218346 20:63958599-63958621 GGAAGGCAGGACCCCAGGGAGGG + Exonic
1179007944 21:37531186-37531208 GGTAGGCTGGGCCCCTGTCCAGG - Intergenic
1179020767 21:37638691-37638713 GGTAGCCAGGACCCCAGATTTGG - Intronic
1179249658 21:39662265-39662287 GCTAGGCAGGTCAGCAGTGTGGG - Exonic
1179788789 21:43743807-43743829 GGTAGGCAGGGGCCCACCCTCGG + Exonic
1181422937 22:22814331-22814353 GGTAGGCAGGGGCCAAGTAGTGG - Intronic
1181422944 22:22814348-22814370 GGTTGACAGGACCCCAGGGTAGG - Intronic
1181494748 22:23281569-23281591 GGCAGGCAGGGGCCGAGTGACGG + Intronic
1181689643 22:24551455-24551477 GTTAGGCAGGGCCCCGGTAAGGG - Intronic
1182877456 22:33704619-33704641 GGTAGGTAGGGACCATGTGTAGG - Intronic
1183325208 22:37187810-37187832 GCCAGGCAGGGACCAAGTGTGGG + Intronic
1185205496 22:49535743-49535765 GGTAGGCAGGGGCTGAGGGTAGG + Intronic
950213443 3:11140623-11140645 GGTAGGCAGGGCTCCTCTGAGGG - Intronic
950497048 3:13340100-13340122 GAGAGCCAGGGCCCCAGTGCAGG + Intronic
950530159 3:13548690-13548712 TGCAGGCAGGCCCCCAGGGTAGG + Intergenic
950714353 3:14837161-14837183 GGCACGCAGGGCCCCAGGCTGGG - Intronic
953627728 3:44584817-44584839 GGGAGGCAGGGCCAGAGCGTCGG + Intronic
955194415 3:56791719-56791741 AGGAGGCAGGGCCCAAATGTTGG - Intronic
961695816 3:128703756-128703778 GGTAGGCTGGGCCCCAGTGTTGG - Intergenic
961963242 3:130874633-130874655 GGTAGGGCAGGCCCCAGAGTTGG + Intronic
962270687 3:133975861-133975883 GGTATACGGGGCCTCAGTGTTGG - Intronic
962536580 3:136334566-136334588 GATAGGCAGTGCCTCAGTCTGGG + Intronic
962722258 3:138187223-138187245 GGTGGGCGGGGCCCCAGAGGCGG - Intergenic
963406368 3:144868629-144868651 GGTTGGGAGGGCCCCAATGAAGG + Intergenic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
966780518 3:183580197-183580219 GGGTGGCAGGGCCCCCCTGTGGG - Intergenic
967582773 3:191179363-191179385 AGTAGGCAGTGCCCCAGTTGAGG - Intergenic
968449398 4:668128-668150 GGTGGACAGGGCCACAGTGCAGG + Intronic
968565589 4:1310955-1310977 GGAAGGCAGGGCTGCAGTGAGGG - Intronic
968884296 4:3319024-3319046 GGTAGGCAGGGCCGGGGAGTAGG + Intronic
969441166 4:7217598-7217620 GGAAGGCAGTTCCCCAGGGTGGG + Intronic
969758669 4:9167139-9167161 GGTGGGCAGGGCTGCAGTTTAGG - Intergenic
969797438 4:9536982-9537004 GCTCTGCAGGTCCCCAGTGTGGG - Intergenic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
971327427 4:25655726-25655748 GGTAGGCAGTGCCCCGGCGGCGG + Intronic
973540164 4:51927564-51927586 GGGAGGCAGGGGCCAAGTGGTGG - Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
979087235 4:116428498-116428520 AATAGGCAGTGCCCCAGTGGGGG - Intergenic
982337636 4:154257991-154258013 ACGATGCAGGGCCCCAGTGTGGG + Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
983469288 4:168136784-168136806 ACTAGGCAGTGTCCCAGTGTGGG + Intronic
983935130 4:173497309-173497331 GGTAGGCAGTGAGGCAGTGTGGG - Intergenic
986013955 5:3741034-3741056 GCATGGCAGGGCCACAGTGTAGG + Intergenic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
988725713 5:33924429-33924451 GGGTGGCAGGGGCCCAGTGGAGG - Intergenic
993967149 5:94372293-94372315 GCTAGGCAGTGCCCCAGTGGGGG + Intronic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
997214877 5:132102170-132102192 GGGAGGCAGGGCTGCAGTGCTGG + Intergenic
998565640 5:143213680-143213702 GGCAGGCTGGGCCCCATTTTTGG - Intronic
999262351 5:150245708-150245730 GGCAGGGTGGGCCCCAGTGGGGG - Intronic
1001663787 5:173415995-173416017 GGGAGGCAGGGCCACATGGTGGG + Intergenic
1001709246 5:173764647-173764669 GGTAGGCAGGGGGCCAGGGCAGG - Intergenic
1002454160 5:179336838-179336860 GGAAGGCAGGGGCCTATTGTGGG - Intronic
1002467726 5:179416148-179416170 GGGAGGCAGGGCGGCAGTGTGGG - Intergenic
1005128321 6:22473864-22473886 GGTTGGCTGGGGCCCAGTGTAGG + Intergenic
1005709001 6:28485547-28485569 GGTGGGCAGGGGACCAGGGTAGG + Intergenic
1006079885 6:31559046-31559068 GGTGGACAAGACCCCAGTGTAGG - Intergenic
1006457742 6:34141689-34141711 GGTGGGCAGGGCCGCGGGGTGGG + Intronic
1007775342 6:44221851-44221873 AGCTGGCAGGGCCCCAGTTTGGG + Intronic
1018001060 6:159579033-159579055 GGCAGGCAGAGCTCCAGTCTGGG + Intergenic
1018016222 6:159714670-159714692 GTTAGGCAGGACACCAGGGTAGG - Intronic
1018446175 6:163860884-163860906 GGGAGGCAGCGCCCCAGCCTGGG - Intergenic
1024977732 7:55129550-55129572 GGAAGGCAGGGGCCCTGGGTGGG + Intronic
1025719450 7:63996700-63996722 CGTAGGCAGAGCAGCAGTGTGGG + Intergenic
1025741964 7:64204938-64204960 CGTAGGCAGAGCAGCAGTGTGGG + Intronic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1028649814 7:93138857-93138879 GTGAGGCAGGGCCCCTCTGTCGG - Intronic
1029451240 7:100642743-100642765 GGTGGGCGGGGCCTCAGCGTAGG - Intronic
1031486767 7:122336208-122336230 GGCAGCCAGGTCACCAGTGTTGG - Intronic
1031535513 7:122929135-122929157 GGCAAGCAGGGCCCCTGTGCTGG + Intergenic
1032190729 7:129764068-129764090 GGGAGGCAGGACCTCGGTGTTGG - Intergenic
1038359903 8:26865826-26865848 GCTAGGCAGGTTCCCAGTGGTGG - Intronic
1039425119 8:37479216-37479238 TGTAGGCCTGGCCCCAGAGTGGG + Intergenic
1041182390 8:55262487-55262509 GGAAGGTAGAGCCCCAGTGATGG + Intronic
1043993157 8:86780825-86780847 ACTAGGCAGTGCCCCAGTTTGGG - Intergenic
1044718600 8:95124036-95124058 ACTAGGCAGAGCCCCAGTGGGGG - Intergenic
1044730416 8:95224550-95224572 GGTAGGAATGGCCCTAGTTTTGG + Intergenic
1045420519 8:102010083-102010105 GTTGGGGAGGGCCCCACTGTGGG + Intronic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1049680364 8:143915416-143915438 GGCAGGCGGCACCCCAGTGTGGG + Exonic
1049690714 8:143957734-143957756 GGTGGGCAGGGCCTCAGGGGAGG - Intronic
1049719403 8:144108636-144108658 GGTGGGCAGGGCCCCGGGTTGGG + Exonic
1052577752 9:30311996-30312018 ATTAGGCAGTGCCCCAGTGTGGG + Intergenic
1056939059 9:90939628-90939650 AGTAGCCAGGGCCCAAGGGTAGG + Intergenic
1058499024 9:105591708-105591730 AGTAGGCAGTGCCCCAGTGGGGG + Intronic
1059309014 9:113375940-113375962 GGTAGACAGAGACCCAGTGAGGG + Exonic
1060114524 9:120929457-120929479 GGCAGGCAGGGGACCAGGGTGGG - Intergenic
1060828771 9:126701049-126701071 GGTGGGCAGGGCCCGGGTGGAGG + Intergenic
1061067630 9:128288507-128288529 GTTAGGCAAGGCACAAGTGTGGG + Intronic
1061720470 9:132547897-132547919 GTTAGCCAGGGCCCCAGGGAGGG - Intronic
1062398604 9:136362740-136362762 GGGAGGCAGGGCCACAGGGCTGG + Intronic
1062497744 9:136839599-136839621 GGCCGGCAAGGCCCAAGTGTGGG - Intronic
1185700005 X:2223637-2223659 GGAAGGCAGGGGCCAAGTGAAGG + Intronic
1186356841 X:8799676-8799698 GATAGGCAGGGGCCGGGTGTGGG - Intronic
1186851065 X:13580605-13580627 GGTAGGCAGGGGCAGAGAGTGGG - Intronic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1190064152 X:47229051-47229073 GGTAGACCTGGCCTCAGTGTGGG - Exonic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1193865040 X:86720734-86720756 TCTAGGCAGTGCCCCAGTGGGGG + Intronic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG + Intergenic
1198962341 X:142195749-142195771 GGCAGGCAGAGCCCCAGACTCGG + Intergenic
1199975540 X:152893123-152893145 GCTTAGCAGGGCCCCAGAGTCGG + Intergenic