ID: 1096460192

View in Genome Browser
Species Human (GRCh38)
Location 12:51818151-51818173
Sequence CCCCCCAGCATTACCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096460187_1096460192 0 Left 1096460187 12:51818128-51818150 CCCCTGGATTCTTTGGTATGCCT 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460183_1096460192 10 Left 1096460183 12:51818118-51818140 CCACTCCCTGCCCCTGGATTCTT 0: 1
1: 0
2: 10
3: 76
4: 741
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460186_1096460192 4 Left 1096460186 12:51818124-51818146 CCTGCCCCTGGATTCTTTGGTAT 0: 1
1: 0
2: 3
3: 168
4: 4714
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460185_1096460192 5 Left 1096460185 12:51818123-51818145 CCCTGCCCCTGGATTCTTTGGTA 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460189_1096460192 -2 Left 1096460189 12:51818130-51818152 CCTGGATTCTTTGGTATGCCTCC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460181_1096460192 12 Left 1096460181 12:51818116-51818138 CCCCACTCCCTGCCCCTGGATTC 0: 1
1: 0
2: 6
3: 51
4: 625
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460180_1096460192 15 Left 1096460180 12:51818113-51818135 CCTCCCCACTCCCTGCCCCTGGA 0: 1
1: 3
2: 8
3: 190
4: 1320
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460188_1096460192 -1 Left 1096460188 12:51818129-51818151 CCCTGGATTCTTTGGTATGCCTC 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460182_1096460192 11 Left 1096460182 12:51818117-51818139 CCCACTCCCTGCCCCTGGATTCT 0: 1
1: 0
2: 2
3: 46
4: 502
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
1096460178_1096460192 16 Left 1096460178 12:51818112-51818134 CCCTCCCCACTCCCTGCCCCTGG 0: 1
1: 3
2: 31
3: 257
4: 1970
Right 1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096460192 Original CRISPR CCCCCCAGCATTACCAGAGC TGG Intergenic
900827269 1:4936869-4936891 CCCCACAGCCTTTCCAGAGAGGG - Intergenic
901227195 1:7620651-7620673 CCGCCCAGCACTCACAGAGCAGG + Intronic
902380733 1:16051087-16051109 CCCCCCACCACCACCAGAGCTGG - Intronic
903121931 1:21221828-21221850 CCTCCCAGGCTTACCAGAACTGG - Exonic
903299228 1:22366181-22366203 CCAAGCAGCATTCCCAGAGCAGG + Intergenic
904036837 1:27563626-27563648 CACCCCAGCACTGCCAGAGCCGG + Intronic
904400600 1:30254120-30254142 CCCCACACCATTGCCAGTGCTGG - Intergenic
904517025 1:31064716-31064738 ACACACAGCATTACCAGAGAAGG - Intronic
905922819 1:41730513-41730535 TCCCCCAGCATTGCCAGGCCTGG - Intronic
906537358 1:46558899-46558921 CCCACCAGATTTCCCAGAGCTGG + Intronic
907022839 1:51086071-51086093 CACCCCTTCTTTACCAGAGCTGG - Intergenic
912777254 1:112513528-112513550 CCCCCCTGCATTCCCACAGCCGG - Intronic
1063325346 10:5094998-5095020 CCACCCAGTATTACCGGACCTGG + Intronic
1067251117 10:44587773-44587795 CTCCCCAGCCTTGCCATAGCAGG - Intergenic
1067927587 10:50526059-50526081 TCCCACAGCACTAGCAGAGCTGG - Intronic
1070886788 10:79907195-79907217 CCCAGCAGCCTTACCAGAGTAGG + Intergenic
1071941326 10:90594735-90594757 CCCCCCAGCTTCAGGAGAGCAGG + Intergenic
1073083655 10:100874973-100874995 CCCCCCAGGATCTCCAGAGCTGG - Intergenic
1075641156 10:124065511-124065533 ACCCCCAGCAGTCCCACAGCAGG - Intronic
1080567653 11:33526428-33526450 CCTGCCACCTTTACCAGAGCAGG + Intergenic
1082780999 11:57287342-57287364 CCTCCCAGAATTACCAGAAACGG + Intergenic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1083400388 11:62419242-62419264 CCTCCCAGCAGCTCCAGAGCAGG - Intronic
1083610583 11:64002451-64002473 ACCCCCAGCAGTTCCAGAACAGG + Intronic
1083804823 11:65067408-65067430 GACCCCAGCATTACCTGAGAGGG + Intronic
1084706091 11:70816733-70816755 CCATCCAGCATCACCAGGGCTGG + Intronic
1089379227 11:118015693-118015715 CCTCCCAGCAGTACCCGCGCTGG + Intergenic
1093867617 12:24247534-24247556 TCCCCCAGCCTTACCACACCAGG - Intergenic
1095745473 12:45653678-45653700 CCCCCCAACAATTCCAGAGTAGG + Intergenic
1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG + Intergenic
1102680846 12:114689354-114689376 CTCCCCATCTTTTCCAGAGCAGG + Intergenic
1104104401 12:125645282-125645304 CCTCCCAGCACTACCAGATTAGG - Intronic
1104596038 12:130120488-130120510 CTCCCCAGCACTTCCAGACCTGG + Intergenic
1111314521 13:86535624-86535646 CCTTCCAGCATTATGAGAGCAGG + Intergenic
1115750364 14:36483340-36483362 TCCCGCAGTCTTACCAGAGCTGG + Intronic
1119652056 14:76391007-76391029 CAGCCCAGCATTTCCAGAGAGGG - Intronic
1123124915 14:105939662-105939684 GCACCCAGCACTACCAGCGCAGG - Intergenic
1126640179 15:50816472-50816494 CCCACCAGTATTACCAGATAAGG - Intergenic
1129419236 15:75410226-75410248 CACTCCAGCATTGACAGAGCAGG - Exonic
1131909106 15:97177229-97177251 CCTCTCAGCGTAACCAGAGCAGG + Intergenic
1131937562 15:97523164-97523186 GCTCCCAGCCTCACCAGAGCTGG - Intergenic
1132035802 15:98483166-98483188 CCCACCTGCAGCACCAGAGCTGG + Intronic
1136130741 16:28219358-28219380 CCCCACAGCATCACCTTAGCTGG - Intergenic
1138584852 16:57962960-57962982 AGCCCCAGCAGTACCTGAGCCGG + Exonic
1139700180 16:68703349-68703371 CCCCCCAGCAGTCCCCGGGCTGG - Intronic
1142305367 16:89281445-89281467 CCCCCAGGCCTGACCAGAGCCGG - Exonic
1144678575 17:17177431-17177453 CCCCCCAGCAATAACCGAGAGGG - Intronic
1144705778 17:17366992-17367014 CTCCCCCGCACTCCCAGAGCAGG - Intergenic
1145819237 17:27818515-27818537 TCCCCCACCATTTCCAGAGTGGG - Intronic
1148572125 17:48678551-48678573 GCCCCCAGCACTCCCGGAGCTGG + Intergenic
1160703448 19:518580-518602 CCCCCCAGCATCCCCAGCCCAGG - Intronic
1161169226 19:2804735-2804757 CCCCCCAGCATCCTCAGAGCAGG - Intronic
1161678452 19:5666782-5666804 CCCCACAGCACCACCAGAGCTGG - Intronic
1162307405 19:9883550-9883572 CCCCCCAGCTTCTCCAGGGCTGG + Intronic
1162317034 19:9945767-9945789 CTTCCCAGCCTTACCAAAGCAGG + Intergenic
1162449794 19:10747904-10747926 TCCTGCAGCATTAACAGAGCAGG - Intronic
1162957488 19:14107334-14107356 CCCGGCAGCCTTACCTGAGCGGG + Exonic
1162964155 19:14148190-14148212 CCCCCCAACCTAACCAGACCTGG - Exonic
1165111842 19:33507152-33507174 CCTCCCTGCATACCCAGAGCCGG + Intronic
1165318077 19:35068771-35068793 CCCCCCAGACTTCCCAGGGCAGG - Intergenic
1166149185 19:40858963-40858985 CCTCCCAGCATTACCGAACCGGG + Intronic
1166563462 19:43748616-43748638 CCTGCCAGCTTTGCCAGAGCAGG - Intronic
1167220776 19:48196788-48196810 TCCCCCAGCAATCCCTGAGCAGG - Intronic
925464095 2:4090482-4090504 CCCTCCAGCTGTCCCAGAGCTGG - Intergenic
927990066 2:27441700-27441722 TCCCCCAGGCTGACCAGAGCCGG + Exonic
928862577 2:35875842-35875864 CCCTCCTGCAGTACCAGAGAGGG + Intergenic
931127071 2:59289848-59289870 GCCCTCAGCATTAACAGAGCTGG + Intergenic
933300346 2:80533613-80533635 CCCTCCTGCATTGCCAGAGATGG + Intronic
936857757 2:116980629-116980651 CCTGCCAGCTTCACCAGAGCAGG + Intergenic
937875581 2:126823106-126823128 CCACCCATTATTACCAGGGCAGG + Intergenic
938660416 2:133480866-133480888 CCATCCAGCATTCCCAAAGCCGG + Intronic
940343744 2:152607909-152607931 CCTCACAGAATTACCAAAGCAGG - Intronic
943738586 2:191385984-191386006 CCCACCAGCATTTTGAGAGCAGG + Exonic
948060676 2:235041587-235041609 CCCCCGAGCAATTTCAGAGCCGG + Exonic
1169630507 20:7625856-7625878 CCCCACAGCAGACCCAGAGCAGG + Intergenic
1170073089 20:12390105-12390127 TCCCCCATCATTCCCAGAGGTGG + Intergenic
1181112791 22:20611714-20611736 CGGCCCAGCATAGCCAGAGCTGG + Intergenic
1181531887 22:23521791-23521813 CCCCCCACCACCACCCGAGCAGG + Intergenic
1182287849 22:29258806-29258828 CCCTCCGGCAGAACCAGAGCTGG + Exonic
950855078 3:16097208-16097230 CCTCCCAGCAGTACCACAGTGGG - Intergenic
952299460 3:32091706-32091728 CTCCCCAACATTGCCAGATCTGG + Intergenic
953198426 3:40755216-40755238 CCCCTCAGGATTGCCAGGGCTGG + Intergenic
957975471 3:87437946-87437968 TCCTCCACCATTACCATAGCAGG + Intergenic
960582669 3:119294327-119294349 CCTTCCAGCATTTCCTGAGCTGG + Intergenic
963023536 3:140896744-140896766 CCCACCACCTTCACCAGAGCAGG - Intergenic
968606541 4:1538230-1538252 CCCCCCAGCCTCACCAGTGCCGG + Intergenic
969072865 4:4553350-4553372 CCCTGGAGTATTACCAGAGCAGG - Intergenic
969387277 4:6862169-6862191 CCCATCAGCATCACCGGAGCTGG - Exonic
969638361 4:8382309-8382331 CCCCACAGCACAGCCAGAGCTGG + Intronic
974131263 4:57759464-57759486 CCCCCCAGCATTAACAGGCTGGG + Intergenic
975245197 4:72112459-72112481 CCCCTCTGCATTACCTGAGCTGG + Intronic
976813077 4:89117976-89117998 CCAGCCAGCATTCCCAGAGATGG - Intergenic
984564190 4:181307970-181307992 CCCACCATCAATAACAGAGCTGG - Intergenic
985792191 5:1935287-1935309 CCCCCCAGCATAGCCAAAGCAGG - Intergenic
985792205 5:1935361-1935383 CCCTCCAGCATAGCCAAAGCGGG - Intergenic
985938124 5:3112087-3112109 CCACCAAGCAGTTCCAGAGCTGG - Intergenic
988970184 5:36459029-36459051 CCCCCCAGCATTTCCCTAGTGGG - Intergenic
991096304 5:62743623-62743645 ACTCCCAGCACTACCAGACCAGG - Intergenic
993601597 5:89932789-89932811 GCCCCCAGCCTTTCAAGAGCAGG + Intergenic
994307811 5:98227697-98227719 ACCACCAGCACTACCACAGCTGG + Intergenic
994401423 5:99285145-99285167 GCCTCCAGCTTTACCAGAGAAGG - Intergenic
996927066 5:128840260-128840282 TTCCACAGCATTCCCAGAGCTGG - Intronic
997425915 5:133802532-133802554 CTGGCCAGCCTTACCAGAGCTGG + Intergenic
1001120634 5:168977169-168977191 CCCCCCATCATTATCAGAATGGG - Intronic
1002043193 5:176528899-176528921 CCTGCCTGCATTTCCAGAGCTGG - Exonic
1002896841 6:1384387-1384409 CCCCCGAGCGTTGCCACAGCCGG + Intergenic
1006804968 6:36782151-36782173 CCCCCCAGCCTTCCCAGCCCTGG + Intronic
1009042522 6:58196420-58196442 CCCATCAGCATTAGCAAAGCTGG - Intergenic
1009218361 6:60950647-60950669 CCCATCAGCATTAGCAAAGCTGG - Intergenic
1010662148 6:78583779-78583801 CCCCCAAGCTTTAACAGACCTGG + Intergenic
1019884502 7:3892380-3892402 CCCTCCAGCATGAGAAGAGCAGG - Intronic
1020450431 7:8315360-8315382 CCTCCCACCACTACCAGAGCTGG - Intergenic
1021315659 7:19144815-19144837 CACCCCAGCACTACCAGACGAGG + Exonic
1023094915 7:36650583-36650605 CTACCCAGGAATACCAGAGCAGG + Intronic
1023861235 7:44218733-44218755 TCCCCCAGAAGGACCAGAGCTGG + Exonic
1023940655 7:44766616-44766638 CCCCCCAGCATGTCTGGAGCCGG + Exonic
1024986998 7:55202714-55202736 CCCTCCAGCATCTCCAGAGGGGG + Intronic
1025739808 7:64185018-64185040 CCGCGCAGCATTACTAGGGCGGG - Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029444305 7:100604180-100604202 CCCGCCCGCTGTACCAGAGCAGG - Exonic
1032316673 7:130844490-130844512 GCCACCAGCATTACCTGATCTGG - Intergenic
1034338565 7:150338554-150338576 CCCCTCAGCATTCCCAGGGCTGG + Intronic
1036912366 8:12767835-12767857 CCCCTCAGCATAATCAGAGGAGG - Intergenic
1037892120 8:22628945-22628967 CCCCCCAGCCTCCCCAGAGTGGG - Intronic
1039783953 8:40815993-40816015 CACCCCAGCATCCCCAGTGCAGG + Intronic
1041279682 8:56197690-56197712 CCCCCCAGAATACCCAGAGCAGG - Intronic
1045952260 8:107865417-107865439 CCTCCCACCACCACCAGAGCAGG - Intergenic
1046909712 8:119612110-119612132 TCCCCCAGCATTTCCAGCTCTGG - Intronic
1048524699 8:135191426-135191448 CCCCTCAGGATTTGCAGAGCAGG + Intergenic
1049408367 8:142461629-142461651 CCCCATAGCATTCCCAGGGCGGG - Intronic
1049596412 8:143485901-143485923 CCCCCCAGCATGGCAAGAACAGG + Intronic
1049756425 8:144313107-144313129 CCCCACAGCAGCACCAGGGCAGG + Intronic
1050658355 9:7854395-7854417 GCCTCCAGCATTAACAGAGTTGG - Intronic
1052693644 9:31849079-31849101 CCCCCCATCCTTACCATGGCTGG + Intergenic
1056950051 9:91034590-91034612 CTCCCCAGCCTTGCCAGTGCTGG + Intergenic
1057305339 9:93909063-93909085 CCCCCCAGAGTGACCAGAGGTGG - Intergenic
1061727966 9:132591423-132591445 CCCCCCACCAGAGCCAGAGCTGG - Intergenic
1061821137 9:133227775-133227797 CCCTCAAGCATTGCCTGAGCAGG + Intergenic
1061822709 9:133237384-133237406 GCCCCCAGCACTGCCAGAGGGGG + Intergenic
1187298166 X:18022752-18022774 CTCCCCAGTATTATCAGAGGAGG - Intergenic
1190765624 X:53473448-53473470 TCCCCCAGCACTACCAGATTGGG - Intergenic
1192177606 X:68895593-68895615 CCCCCCAGGATGGCCAGAGAAGG + Intergenic
1192944449 X:75950050-75950072 CTCACCAGAATTTCCAGAGCTGG + Intergenic
1194262719 X:91716862-91716884 CCCCCTAGTACTACCACAGCTGG + Intergenic