ID: 1096462267

View in Genome Browser
Species Human (GRCh38)
Location 12:51828628-51828650
Sequence CCACAGGACCCGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096462267_1096462275 6 Left 1096462267 12:51828628-51828650 CCTGCTGCCCTCGGGTCCTGTGG No data
Right 1096462275 12:51828657-51828679 CTCCCATCCCTGAGGACCACAGG No data
1096462267_1096462273 -2 Left 1096462267 12:51828628-51828650 CCTGCTGCCCTCGGGTCCTGTGG No data
Right 1096462273 12:51828649-51828671 GGGTGCCTCTCCCATCCCTGAGG No data
1096462267_1096462282 22 Left 1096462267 12:51828628-51828650 CCTGCTGCCCTCGGGTCCTGTGG No data
Right 1096462282 12:51828673-51828695 CCACAGGCTCTCCATGCACAGGG No data
1096462267_1096462280 21 Left 1096462267 12:51828628-51828650 CCTGCTGCCCTCGGGTCCTGTGG No data
Right 1096462280 12:51828672-51828694 ACCACAGGCTCTCCATGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096462267 Original CRISPR CCACAGGACCCGAGGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr