ID: 1096464059

View in Genome Browser
Species Human (GRCh38)
Location 12:51838507-51838529
Sequence CTGAGTCATGGGAGGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096464059_1096464070 0 Left 1096464059 12:51838507-51838529 CCCTTCCCCCTCCCATGACTCAG No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464059_1096464073 27 Left 1096464059 12:51838507-51838529 CCCTTCCCCCTCCCATGACTCAG No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data
1096464059_1096464072 26 Left 1096464059 12:51838507-51838529 CCCTTCCCCCTCCCATGACTCAG No data
Right 1096464072 12:51838556-51838578 CAGAGTCAGCCTCTGAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096464059 Original CRISPR CTGAGTCATGGGAGGGGGAA GGG (reversed) Intergenic
No off target data available for this crispr