ID: 1096464070

View in Genome Browser
Species Human (GRCh38)
Location 12:51838530-51838552
Sequence GTATTGCAGGGAGTGAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096464065_1096464070 -8 Left 1096464065 12:51838515-51838537 CCTCCCATGACTCAGGTATTGCA No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464063_1096464070 -6 Left 1096464063 12:51838513-51838535 CCCCTCCCATGACTCAGGTATTG No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464058_1096464070 4 Left 1096464058 12:51838503-51838525 CCAGCCCTTCCCCCTCCCATGAC No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464060_1096464070 -1 Left 1096464060 12:51838508-51838530 CCTTCCCCCTCCCATGACTCAGG No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464057_1096464070 13 Left 1096464057 12:51838494-51838516 CCACTCTAGCCAGCCCTTCCCCC No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464059_1096464070 0 Left 1096464059 12:51838507-51838529 CCCTTCCCCCTCCCATGACTCAG No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464062_1096464070 -5 Left 1096464062 12:51838512-51838534 CCCCCTCCCATGACTCAGGTATT No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464064_1096464070 -7 Left 1096464064 12:51838514-51838536 CCCTCCCATGACTCAGGTATTGC No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data
1096464056_1096464070 14 Left 1096464056 12:51838493-51838515 CCCACTCTAGCCAGCCCTTCCCC No data
Right 1096464070 12:51838530-51838552 GTATTGCAGGGAGTGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096464070 Original CRISPR GTATTGCAGGGAGTGAGCAC TGG Intergenic
No off target data available for this crispr