ID: 1096464073

View in Genome Browser
Species Human (GRCh38)
Location 12:51838557-51838579
Sequence AGAGTCAGCCTCTGAGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096464069_1096464073 15 Left 1096464069 12:51838519-51838541 CCATGACTCAGGTATTGCAGGGA No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data
1096464064_1096464073 20 Left 1096464064 12:51838514-51838536 CCCTCCCATGACTCAGGTATTGC No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data
1096464063_1096464073 21 Left 1096464063 12:51838513-51838535 CCCCTCCCATGACTCAGGTATTG No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data
1096464062_1096464073 22 Left 1096464062 12:51838512-51838534 CCCCCTCCCATGACTCAGGTATT No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data
1096464067_1096464073 16 Left 1096464067 12:51838518-51838540 CCCATGACTCAGGTATTGCAGGG No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data
1096464065_1096464073 19 Left 1096464065 12:51838515-51838537 CCTCCCATGACTCAGGTATTGCA No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data
1096464059_1096464073 27 Left 1096464059 12:51838507-51838529 CCCTTCCCCCTCCCATGACTCAG No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data
1096464060_1096464073 26 Left 1096464060 12:51838508-51838530 CCTTCCCCCTCCCATGACTCAGG No data
Right 1096464073 12:51838557-51838579 AGAGTCAGCCTCTGAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096464073 Original CRISPR AGAGTCAGCCTCTGAGATGT GGG Intergenic
No off target data available for this crispr