ID: 1096464276

View in Genome Browser
Species Human (GRCh38)
Location 12:51839626-51839648
Sequence GTGACTGGAGGAGCTGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096464276_1096464281 -2 Left 1096464276 12:51839626-51839648 CCCTTTCCAGCTCCTCCAGTCAC No data
Right 1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG No data
1096464276_1096464284 20 Left 1096464276 12:51839626-51839648 CCCTTTCCAGCTCCTCCAGTCAC No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096464276 Original CRISPR GTGACTGGAGGAGCTGGAAA GGG (reversed) Intergenic