ID: 1096464278

View in Genome Browser
Species Human (GRCh38)
Location 12:51839632-51839654
Sequence GCTGATGTGACTGGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096464278_1096464281 -8 Left 1096464278 12:51839632-51839654 CCAGCTCCTCCAGTCACATCAGC No data
Right 1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG No data
1096464278_1096464284 14 Left 1096464278 12:51839632-51839654 CCAGCTCCTCCAGTCACATCAGC No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096464278 Original CRISPR GCTGATGTGACTGGAGGAGC TGG (reversed) Intergenic