ID: 1096464280 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:51839641-51839663 |
Sequence | AGAGAATGGGCTGATGTGAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1096464280_1096464288 | 26 | Left | 1096464280 | 12:51839641-51839663 | CCAGTCACATCAGCCCATTCTCT | No data | ||
Right | 1096464288 | 12:51839690-51839712 | GGTGCCCCGAAGCATGTTCCAGG | No data | ||||
1096464280_1096464284 | 5 | Left | 1096464280 | 12:51839641-51839663 | CCAGTCACATCAGCCCATTCTCT | No data | ||
Right | 1096464284 | 12:51839669-51839691 | GCTGTTCCTGTCTCCCTCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1096464280 | Original CRISPR | AGAGAATGGGCTGATGTGAC TGG (reversed) | Intergenic | ||