ID: 1096464281

View in Genome Browser
Species Human (GRCh38)
Location 12:51839647-51839669
Sequence ACATCAGCCCATTCTCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096464273_1096464281 17 Left 1096464273 12:51839607-51839629 CCTTCCTTCCAGCTTCGGGCCCT No data
Right 1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG No data
1096464274_1096464281 13 Left 1096464274 12:51839611-51839633 CCTTCCAGCTTCGGGCCCTTTCC No data
Right 1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG No data
1096464276_1096464281 -2 Left 1096464276 12:51839626-51839648 CCCTTTCCAGCTCCTCCAGTCAC No data
Right 1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG No data
1096464275_1096464281 9 Left 1096464275 12:51839615-51839637 CCAGCTTCGGGCCCTTTCCAGCT No data
Right 1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG No data
1096464278_1096464281 -8 Left 1096464278 12:51839632-51839654 CCAGCTCCTCCAGTCACATCAGC No data
Right 1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG No data
1096464277_1096464281 -3 Left 1096464277 12:51839627-51839649 CCTTTCCAGCTCCTCCAGTCACA No data
Right 1096464281 12:51839647-51839669 ACATCAGCCCATTCTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096464281 Original CRISPR ACATCAGCCCATTCTCTCTG AGG Intergenic