ID: 1096464283

View in Genome Browser
Species Human (GRCh38)
Location 12:51839655-51839677
Sequence AGGAACAGCCTCAGAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096464283_1096464288 12 Left 1096464283 12:51839655-51839677 CCATTCTCTCTGAGGCTGTTCCT No data
Right 1096464288 12:51839690-51839712 GGTGCCCCGAAGCATGTTCCAGG No data
1096464283_1096464284 -9 Left 1096464283 12:51839655-51839677 CCATTCTCTCTGAGGCTGTTCCT No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096464283 Original CRISPR AGGAACAGCCTCAGAGAGAA TGG (reversed) Intergenic