ID: 1096464284

View in Genome Browser
Species Human (GRCh38)
Location 12:51839669-51839691
Sequence GCTGTTCCTGTCTCCCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096464280_1096464284 5 Left 1096464280 12:51839641-51839663 CCAGTCACATCAGCCCATTCTCT No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data
1096464277_1096464284 19 Left 1096464277 12:51839627-51839649 CCTTTCCAGCTCCTCCAGTCACA No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data
1096464279_1096464284 8 Left 1096464279 12:51839638-51839660 CCTCCAGTCACATCAGCCCATTC No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data
1096464283_1096464284 -9 Left 1096464283 12:51839655-51839677 CCATTCTCTCTGAGGCTGTTCCT No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data
1096464278_1096464284 14 Left 1096464278 12:51839632-51839654 CCAGCTCCTCCAGTCACATCAGC No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data
1096464276_1096464284 20 Left 1096464276 12:51839626-51839648 CCCTTTCCAGCTCCTCCAGTCAC No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data
1096464282_1096464284 -8 Left 1096464282 12:51839654-51839676 CCCATTCTCTCTGAGGCTGTTCC No data
Right 1096464284 12:51839669-51839691 GCTGTTCCTGTCTCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096464284 Original CRISPR GCTGTTCCTGTCTCCCTCTT TGG Intergenic