ID: 1096465902

View in Genome Browser
Species Human (GRCh38)
Location 12:51847782-51847804
Sequence TGCGAATCTCTGTGTAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096465900_1096465902 7 Left 1096465900 12:51847752-51847774 CCCTCTGCAGCGGCGGGGGGGTT No data
Right 1096465902 12:51847782-51847804 TGCGAATCTCTGTGTAGAACAGG No data
1096465901_1096465902 6 Left 1096465901 12:51847753-51847775 CCTCTGCAGCGGCGGGGGGGTTG No data
Right 1096465902 12:51847782-51847804 TGCGAATCTCTGTGTAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096465902 Original CRISPR TGCGAATCTCTGTGTAGAAC AGG Intergenic
No off target data available for this crispr