ID: 1096466424

View in Genome Browser
Species Human (GRCh38)
Location 12:51849314-51849336
Sequence GGTCTGGGGCGGCCCGCGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096466424_1096466433 -1 Left 1096466424 12:51849314-51849336 CCGTCCGCGGGCCGCCCCAGACC No data
Right 1096466433 12:51849336-51849358 CCCCTTTCCCAGGACTGCCTTGG No data
1096466424_1096466438 7 Left 1096466424 12:51849314-51849336 CCGTCCGCGGGCCGCCCCAGACC No data
Right 1096466438 12:51849344-51849366 CCAGGACTGCCTTGGCCCCCTGG No data
1096466424_1096466441 21 Left 1096466424 12:51849314-51849336 CCGTCCGCGGGCCGCCCCAGACC No data
Right 1096466441 12:51849358-51849380 GCCCCCTGGCCCCAGTCTGGAGG No data
1096466424_1096466440 18 Left 1096466424 12:51849314-51849336 CCGTCCGCGGGCCGCCCCAGACC No data
Right 1096466440 12:51849355-51849377 TTGGCCCCCTGGCCCCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096466424 Original CRISPR GGTCTGGGGCGGCCCGCGGA CGG (reversed) Intergenic