ID: 1096470631

View in Genome Browser
Species Human (GRCh38)
Location 12:51873480-51873502
Sequence GGCCTGGGCACATGAGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096470631_1096470640 7 Left 1096470631 12:51873480-51873502 CCTTGAACTCATGTGCCCAGGCC No data
Right 1096470640 12:51873510-51873532 CAGTCCACTAGGAGTGCAGAAGG No data
1096470631_1096470634 -4 Left 1096470631 12:51873480-51873502 CCTTGAACTCATGTGCCCAGGCC No data
Right 1096470634 12:51873499-51873521 GGCCTCCCCTCCAGTCCACTAGG No data
1096470631_1096470642 19 Left 1096470631 12:51873480-51873502 CCTTGAACTCATGTGCCCAGGCC No data
Right 1096470642 12:51873522-51873544 AGTGCAGAAGGATTTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096470631 Original CRISPR GGCCTGGGCACATGAGTTCA AGG (reversed) Intergenic
No off target data available for this crispr