ID: 1096472900

View in Genome Browser
Species Human (GRCh38)
Location 12:51890089-51890111
Sequence CACTGGGTTTGGAGTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 366}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096472884_1096472900 11 Left 1096472884 12:51890055-51890077 CCCCTGCCTCCATTTTTCCCTTC 0: 1
1: 1
2: 11
3: 136
4: 1204
Right 1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 366
1096472887_1096472900 5 Left 1096472887 12:51890061-51890083 CCTCCATTTTTCCCTTCCCCACA 0: 1
1: 0
2: 4
3: 66
4: 653
Right 1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 366
1096472889_1096472900 -6 Left 1096472889 12:51890072-51890094 CCCTTCCCCACACACCCCACTGG 0: 1
1: 0
2: 5
3: 59
4: 537
Right 1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 366
1096472885_1096472900 10 Left 1096472885 12:51890056-51890078 CCCTGCCTCCATTTTTCCCTTCC 0: 1
1: 0
2: 24
3: 362
4: 3617
Right 1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 366
1096472886_1096472900 9 Left 1096472886 12:51890057-51890079 CCTGCCTCCATTTTTCCCTTCCC 0: 1
1: 0
2: 8
3: 158
4: 1563
Right 1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 366
1096472891_1096472900 -7 Left 1096472891 12:51890073-51890095 CCTTCCCCACACACCCCACTGGG 0: 1
1: 0
2: 7
3: 78
4: 611
Right 1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 366
1096472888_1096472900 2 Left 1096472888 12:51890064-51890086 CCATTTTTCCCTTCCCCACACAC 0: 1
1: 1
2: 10
3: 101
4: 802
Right 1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096472900 Original CRISPR CACTGGGTTTGGAGTGAAAA AGG Intronic
900685409 1:3944968-3944990 CCCTGCATGTGGAGTGAAAAGGG - Intergenic
902284391 1:15397380-15397402 CACTGGGCTTAGAATGCAAAAGG - Exonic
902459768 1:16565300-16565322 CACTGAAATTAGAGTGAAAAAGG + Intronic
904124070 1:28223792-28223814 CTGTGGGGTTGGACTGAAAATGG + Intronic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
907256600 1:53183799-53183821 CACAGGGTTTTGAGTAAAGAAGG + Intergenic
907272399 1:53298677-53298699 CACTGGGGTAGGAGTGGAAGGGG - Intronic
907734235 1:57096210-57096232 CACCGGCTCTGGAGTGAGAAAGG - Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
907948615 1:59158941-59158963 CTTAGGGATTGGAGTGAAAAGGG + Intergenic
909836402 1:80260580-80260602 GCCTGGGTGTGGAGTGGAAAGGG - Intergenic
910269186 1:85374511-85374533 CCCTGGACTTGAAGTGAAAAAGG + Intronic
910752058 1:90642121-90642143 CACTGTATTTGGAATAAAAATGG + Intergenic
912627221 1:111215441-111215463 TACTTGGTTTGGTCTGAAAAGGG - Intronic
913122229 1:115752972-115752994 CCTTGGTTTTGGAGAGAAAAGGG + Intronic
913605825 1:120464859-120464881 CACTGAAATTAGAGTGAAAAAGG - Intergenic
913643243 1:120832471-120832493 CACTGAAATTAGAGTGAAAAAGG - Intronic
913643544 1:120835113-120835135 CACTGAAATTAGAGTGAAAAAGG - Intronic
913644010 1:120839228-120839250 CACTGAAATTAGAGTGAAAAAGG - Intronic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
914082728 1:144424357-144424379 CACTGAAATTAGAGTGAAAAAGG + Intronic
914177635 1:145292871-145292893 CACTGAAATTAGAGTGAAAAAGG + Intronic
914178180 1:145297629-145297651 CACTGAAATTAGAGTGAAAAAGG + Intronic
914178725 1:145302391-145302413 CACTGAAATTAGAGTGAAAAAGG + Intronic
914179103 1:145305560-145305582 CACTGAAATTAGAGTGAAAAAGG + Intronic
914179479 1:145308743-145308765 CACTGAAATTAGAGTGAAAAAGG + Intronic
914180023 1:145313499-145313521 CACTGAAATTAGAGTGAAAAAGG + Intronic
914180568 1:145318271-145318293 CACTGAAATTAGAGTGAAAAAGG + Intronic
914181111 1:145323033-145323055 CACTGAAATTAGAGTGAAAAAGG + Intronic
914181654 1:145327781-145327803 CACTGAAATTAGAGTGAAAAAGG + Intronic
914182199 1:145332548-145332570 CACTGAAATTAGAGTGAAAAAGG + Intronic
914182744 1:145337304-145337326 CACTGAAATTAGAGTGAAAAAGG + Intronic
914183289 1:145342054-145342076 CACTGAAATTAGAGTGAAAAAGG + Intronic
914183833 1:145346812-145346834 CACTGAAATTAGAGTGAAAAAGG + Intronic
914184377 1:145351584-145351606 CACTGAAATTAGAGTGAAAAAGG + Intronic
914184921 1:145356346-145356368 CACTGAAATTAGAGTGAAAAAGG + Intronic
914185466 1:145361093-145361115 CACTGAAATTAGAGTGAAAAAGG + Intronic
914186012 1:145365847-145365869 CACTGAAATTAGAGTGAAAAAGG + Intronic
914186558 1:145370607-145370629 CACTGAAATTAGAGTGAAAAAGG + Intronic
914187102 1:145375355-145375377 CACTGAAATTAGAGTGAAAAAGG + Intronic
914187645 1:145380107-145380129 CACTGAAATTAGAGTGAAAAAGG + Intronic
914188190 1:145384861-145384883 CACTGAAATTAGAGTGAAAAAGG + Intronic
914188733 1:145389611-145389633 CACTGAAATTAGAGTGAAAAAGG + Intronic
914210602 1:145575314-145575336 CACTGAAATTAGAGTGAAAAAGG + Intergenic
914269533 1:146067669-146067691 CACTGAAATTAGAGTGAAAAAGG + Intronic
914269887 1:146070814-146070836 CACTGAAATTAGAGTGAAAAAGG + Intronic
914270427 1:146075536-146075558 CACTGAAATTAGAGTGAAAAAGG + Intronic
914270964 1:146080272-146080294 CACTGAAATTAGAGTGAAAAAGG + Intronic
914271502 1:146085008-146085030 CACTGAAATTAGAGTGAAAAAGG + Intronic
914272037 1:146089729-146089751 CACTGAAATTAGAGTGAAAAAGG + Intronic
914272573 1:146094447-146094469 CACTGAAATTAGAGTGAAAAAGG + Intronic
914273111 1:146099169-146099191 CACTGAAATTAGAGTGAAAAAGG + Intronic
914273650 1:146103891-146103913 CACTGAAATTAGAGTGAAAAAGG + Intronic
914274188 1:146108609-146108631 CACTGAAATTAGAGTGAAAAAGG + Intronic
914274724 1:146113319-146113341 CACTGAAATTAGAGTGAAAAAGG + Intronic
914275257 1:146118037-146118059 CACTGAAATTAGAGTGAAAAAGG + Intronic
914275794 1:146122773-146122795 CACTGAAATTAGAGTGAAAAAGG + Intronic
914367030 1:146988437-146988459 CACTGAAATTAGAGTGAAAAAGG - Intronic
914367566 1:146993195-146993217 CACTGAAATTAGAGTGAAAAAGG - Intronic
914485417 1:148105027-148105049 CACTGAAATTAGAGTGAAAAAGG + Intronic
914532366 1:148534350-148534372 CACTGAAATTAGAGTGAAAAAGG + Intronic
914532725 1:148537501-148537523 CACTGAAATTAGAGTGAAAAAGG + Intronic
914533260 1:148542221-148542243 CACTGAAATTAGAGTGAAAAAGG + Intronic
914533795 1:148546935-148546957 CACTGAAATTAGAGTGAAAAAGG + Intronic
914534331 1:148551643-148551665 CACTGAAATTAGAGTGAAAAAGG + Intronic
914534867 1:148556357-148556379 CACTGAAATTAGAGTGAAAAAGG + Intronic
914535402 1:148561074-148561096 CACTGAAATTAGAGTGAAAAAGG + Intronic
914535939 1:148565810-148565832 CACTGAAATTAGAGTGAAAAAGG + Intronic
914536474 1:148570532-148570554 CACTGAAATTAGAGTGAAAAAGG + Intronic
914536833 1:148573720-148573742 CACTGAAATTAGAGTGAAAAAGG + Intronic
914585379 1:149057002-149057024 CACTGAAATTAGAGTGAAAAAGG + Intronic
914585742 1:149060190-149060212 CACTGAAATTAGAGTGAAAAAGG + Intronic
914629086 1:149491622-149491644 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914629619 1:149496385-149496407 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914630154 1:149501140-149501162 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914630688 1:149505901-149505923 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914631219 1:149510662-149510684 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914631751 1:149515418-149515440 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914632287 1:149520171-149520193 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914632822 1:149524928-149524950 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914633358 1:149529657-149529679 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914633894 1:149534408-149534430 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914634428 1:149539159-149539181 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914634961 1:149543896-149543918 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914635496 1:149548633-149548655 CACTGAAATTAGAGTGAAAAAGG - Intergenic
914636031 1:149553370-149553392 CACTGAAATTAGAGTGAAAAAGG - Intergenic
916125743 1:161569378-161569400 CCCTGGGCTTAGAGTAAAAAAGG + Intergenic
916135659 1:161651209-161651231 CCCTGGGCTTAGAGTAAAAAAGG + Intronic
918908607 1:190533326-190533348 CACTTGATTTGGACTGACAAAGG + Intergenic
919931679 1:202225282-202225304 GACTGGCTTTGGAGTCAGAATGG + Intronic
920693521 1:208164535-208164557 CACAGAATTTGGAGGGAAAAGGG + Intronic
921743261 1:218710070-218710092 CACTGGGCTTGAAATGAAAGAGG - Intergenic
921983836 1:221286781-221286803 AACTGGGGTTGGAATGACAAGGG + Intergenic
922487640 1:225988006-225988028 CACTGGGGCTGGACTGAATAAGG - Exonic
1064078180 10:12287022-12287044 TACTTGGTTTGGAGGGAAAAAGG - Intergenic
1064200119 10:13277222-13277244 CCCTGGATTTGGAGTGAGCATGG - Intergenic
1064776585 10:18785276-18785298 CTCTGTGTTTGGAGTGGGAATGG - Intergenic
1065963470 10:30752800-30752822 AGCTGTGTTTGGAGTGATAAGGG - Intergenic
1067245380 10:44537041-44537063 CACTGGTTATGGAGTGAGAGTGG + Intergenic
1068619685 10:59167705-59167727 AACTGGGTATGGAAAGAAAATGG - Intergenic
1069346579 10:67477100-67477122 GCCTGGGTGTGGAGTGTAAAGGG - Intronic
1070080701 10:73183857-73183879 CAGTAGGTTTGGAGTGAACCTGG + Intronic
1071456503 10:85855327-85855349 CCCTGGGCTTGGAGAGAGAAAGG - Intronic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1074003228 10:109393181-109393203 CACTGGGGGTGGAGCCAAAATGG + Intergenic
1074466821 10:113691114-113691136 CACTGGGTCAGGAGTGTGAATGG - Intronic
1075086484 10:119417474-119417496 CAATGGGTTTAGAGTGAATGGGG - Intronic
1075975481 10:126690386-126690408 CACTGGCTTCTGAGAGAAAATGG - Intergenic
1076081951 10:127590330-127590352 CACTGGGGTTGGTTTGAAGATGG + Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1079865566 11:25729414-25729436 CATTGGGTTTGGTGTGGAAATGG - Intergenic
1080842814 11:36000399-36000421 CACTGGGATTGTGGTTAAAATGG + Intronic
1080854901 11:36103668-36103690 CACTGGGATGGGCGTGGAAAAGG - Intronic
1083011856 11:59408981-59409003 CCCATGGTTTGGAGTGATAAAGG + Intergenic
1084819160 11:71672501-71672523 CACTTTGTTTGGAGGCAAAATGG + Intergenic
1085436991 11:76514545-76514567 CACAGGTTTTGGAGTCAAACTGG - Intronic
1085717886 11:78889325-78889347 CCCTGGGCTTGGAGGGAAACTGG - Intronic
1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG + Intergenic
1089218813 11:116853585-116853607 TACTGGGTTTTGAGAGAAAATGG + Intronic
1090188956 11:124756123-124756145 CACAGGGACTGGGGTGAAAAGGG - Intronic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1091613750 12:2033404-2033426 GCCTGGGTTTGGAGAGAAAATGG - Intronic
1093347345 12:18054919-18054941 CACTGGATGTGGAGAGGAAATGG - Intergenic
1093787207 12:23206542-23206564 CACTGTATTTGGAGTGCAATGGG + Intergenic
1093847317 12:23988740-23988762 AAATGGGTTTGGATTCAAAAGGG + Intergenic
1094190961 12:27698134-27698156 CACTGGCTTTTAAGTAAAAATGG - Intergenic
1094359133 12:29610802-29610824 CACTGAGTTGGGACAGAAAATGG + Intronic
1094568189 12:31618689-31618711 CACTGTATTTGGTGTTAAAATGG - Intergenic
1095071045 12:37847593-37847615 CACTGGGCCTGTGGTGAAAAAGG - Intergenic
1095640010 12:44476803-44476825 CCCTTGGTTTGGAGAGAACATGG + Intergenic
1096357403 12:50952837-50952859 CACTGGGCTTGGAGGGGAAGGGG - Intergenic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1096529727 12:52234993-52235015 CACTTGATTTGGAGTCCAAAGGG + Intronic
1096849197 12:54424705-54424727 GTCTGGGTTTGGAGTGCAATCGG - Intergenic
1097707262 12:62881031-62881053 CACTGAGATTGGAGTTACAAGGG - Intronic
1097834944 12:64263628-64263650 CACTGGTTTTGGAGCCGAAATGG - Intergenic
1099669896 12:85676922-85676944 CAGTGGTTTTTGAGTGAATAAGG - Intergenic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1101099079 12:101373746-101373768 CACTTGGTTTGGAGCAAAAAAGG + Exonic
1101527691 12:105546729-105546751 CACTGGGATTGACATGAAAAGGG + Intergenic
1101560045 12:105848399-105848421 CACTTGGTTTTGTTTGAAAAAGG + Intergenic
1104841835 12:131829294-131829316 TACTGGGTGTGGAGTGAGGAAGG - Intronic
1105727667 13:23181595-23181617 CACTATTTTTGGAGTGAAAAGGG + Intronic
1106542992 13:30706521-30706543 GACTGGGCTTGGGGTGTAAAAGG + Intergenic
1109059949 13:57603233-57603255 CAGTGGATTTAGAATGAAAAGGG - Intergenic
1109459816 13:62641823-62641845 CACTGGAACTGGATTGAAAATGG - Intergenic
1109779855 13:67094829-67094851 CACTGCCTTTAGAATGAAAAGGG + Intronic
1110256106 13:73435652-73435674 CACTGGGCTTATAGTGAAGAGGG - Intergenic
1110290732 13:73803988-73804010 CAGTGGGTTTTAAGTGGAAATGG - Intronic
1110638280 13:77791334-77791356 GCCTGGGTTTGGAGTAAAGAGGG - Intergenic
1111041455 13:82754821-82754843 CATTGGAGTTGGAGTTAAAATGG + Intergenic
1112156103 13:96818670-96818692 CACTTGGTTGGGAGTGAGAGAGG + Intronic
1113351136 13:109530420-109530442 TACTGGATCTGGAGTCAAAAGGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113574683 13:111386690-111386712 CACTGGGCTTCAAGTGAAACAGG - Intergenic
1114386632 14:22261886-22261908 GACTGGGTTTTGAGTAAGAAAGG - Intergenic
1115294712 14:31812642-31812664 CACTGGGACTGGTGTGAAAGTGG - Intronic
1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG + Intronic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1118480460 14:66159686-66159708 CCCTGGGGTTGGAGAGAACATGG + Intergenic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1119892816 14:78195781-78195803 CCATGGGTTTGGACTGAGAAAGG - Intergenic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1123539337 15:21272427-21272449 CCCTGACTATGGAGTGAAAAAGG - Intergenic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1126009574 15:44289367-44289389 CATGGGGTTTGAAGAGAAAAGGG - Intronic
1128317278 15:66668990-66669012 CACTGGCTTTGGAGTCTCAAGGG + Intronic
1128818199 15:70629607-70629629 CACTGGTTTTGAAGGGGAAAGGG - Intergenic
1129113134 15:73349888-73349910 CACAGGATTTGGAGTGGAACGGG - Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132164020 15:99566625-99566647 CCCCGGGCTTGGAGGGAAAAGGG - Intronic
1133362288 16:5183999-5184021 CAGTGGGTGTGGTGTGACAATGG + Intergenic
1133832845 16:9340099-9340121 CATGGGATTTGGAGTGAGAAGGG - Intergenic
1134300219 16:12984146-12984168 CACTGGCCATGGAGTGACAAGGG - Intronic
1137638790 16:50010361-50010383 CACTGTGTTTGGAGGGAGGATGG + Intergenic
1138255872 16:55559694-55559716 AACTGGGATTGGAATCAAAATGG - Intronic
1139342600 16:66278250-66278272 GACTGGGTTTGGAGTATAGAGGG - Intergenic
1140132504 16:72175979-72176001 AACCGGGTTTGGATTCAAAAAGG - Intronic
1141409814 16:83825381-83825403 CACTGGGGTTGCAGTGAAGCAGG + Intergenic
1142397343 16:89839734-89839756 CTCTGGGGGTGGGGTGAAAAGGG + Intronic
1142615338 17:1131045-1131067 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615344 17:1131089-1131111 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615360 17:1131179-1131201 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615376 17:1131269-1131291 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615384 17:1131313-1131335 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615391 17:1131357-1131379 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615398 17:1131401-1131423 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615414 17:1131491-1131513 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615429 17:1131580-1131602 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615436 17:1131624-1131646 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615442 17:1131667-1131689 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615450 17:1131711-1131733 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615467 17:1131802-1131824 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142615476 17:1131847-1131869 CACTGCATTTGGTGTGCAAAGGG - Intronic
1142953408 17:3503282-3503304 CACTGAGTATGGAGTAAAACTGG - Exonic
1143282463 17:5765071-5765093 CACTTGGTTTTGAGAGAATATGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144087229 17:11821752-11821774 CCCTGGGTTTGGAGTAGACATGG + Intronic
1144227233 17:13161157-13161179 CACTGGATTTGGATAGACAAAGG + Intergenic
1149423700 17:56534610-56534632 CCCTGTCTTTGGAGGGAAAATGG + Intergenic
1150128349 17:62652993-62653015 CACTGGGTTGGGGGAGAAAGGGG + Intronic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1151560755 17:74868236-74868258 CTCTGGGCTTGGAGTCAAACAGG + Intronic
1155451090 18:25963647-25963669 CAGTGGGTTTGGGGTGGGAATGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156287354 18:35710879-35710901 ATCTGAGTATGGAGTGAAAAAGG - Exonic
1156590839 18:38486263-38486285 CACTGGATTTGCAGTCATAAGGG + Intergenic
1156802558 18:41135136-41135158 GACTGAGTATTGAGTGAAAAAGG + Intergenic
1158982787 18:62781035-62781057 CACTGGCTTTGGAATCCAAAAGG + Intronic
1159060099 18:63505715-63505737 GGGTGGGTTTAGAGTGAAAAGGG - Intergenic
1159320212 18:66838561-66838583 CACTTGCTCTGGAGTGAAACAGG + Intergenic
1160402452 18:78620810-78620832 CACTGGGCTTGGGGAGAACATGG + Intergenic
1161753981 19:6117979-6118001 ACCTGGGTTTGGAGTTAAACAGG + Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164396903 19:27873571-27873593 CACTGAGTTTGGACTTGAAAAGG - Intergenic
1164482053 19:28619347-28619369 CACTGAGTTTGGAGTGATTTGGG + Intergenic
1166039471 19:40192805-40192827 CACTGTGCCTGGAGTGAGAAGGG + Intronic
1168141891 19:54393627-54393649 CACAGGGTTTGGAGAAAAACAGG + Intergenic
1202676012 1_KI270711v1_random:7484-7506 CACTGAAATTAGAGTGAAAAAGG + Intergenic
925000860 2:401846-401868 CACAGGCTTTGGAATCAAAATGG + Intergenic
926101472 2:10121077-10121099 TAGTGTGTTTGGGGTGAAAATGG + Intergenic
928083307 2:28328702-28328724 CACTGGGGTTGGAGTGACATTGG + Intronic
928641275 2:33302482-33302504 CACTGGACTGGTAGTGAAAAAGG - Intronic
928930063 2:36615301-36615323 CACTGGGTTTGGGGAAAAACAGG - Intronic
929678679 2:43966278-43966300 GACTGGGGTGTGAGTGAAAAGGG + Intronic
931179398 2:59884493-59884515 AACTGTGCTTGGAGAGAAAATGG - Intergenic
931376598 2:61713602-61713624 CCGTGGGTTTGGAGTGAATGAGG + Intergenic
932057626 2:68462098-68462120 CACTTGGTTGGAAGTGAGAAGGG + Exonic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933246608 2:79983017-79983039 CACTGGTTTTGGAATTAAATTGG + Intronic
933695929 2:85217181-85217203 CATTTGTTGTGGAGTGAAAATGG - Intronic
934120661 2:88835878-88835900 CACTGGATATGGAGTCAGAAGGG + Intergenic
937081565 2:119143921-119143943 CACCAGGTTTTGAGAGAAAAAGG - Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
938744114 2:134260796-134260818 CACTGTTCTTGAAGTGAAAATGG + Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940861478 2:158774433-158774455 CACTGGATTTGAAAGGAAAACGG + Intergenic
941396550 2:164980993-164981015 CCCTGACTATGGAGTGAAAAAGG - Intergenic
942402587 2:175619160-175619182 TACTGAGTTTAGAGTAAAAAGGG - Intergenic
943176776 2:184486011-184486033 CACTGGCATTGGAGTGAAGAAGG + Intergenic
943561897 2:189473678-189473700 CTCTGGATGTGGGGTGAAAATGG - Intronic
944239815 2:197475496-197475518 CACTGGGTATAGAGTGATGAAGG + Intergenic
945083135 2:206106184-206106206 CACTTGGATGGGAGAGAAAATGG + Intergenic
945613706 2:212039772-212039794 CACAGGCTTTGGAGTCAGAATGG - Intronic
945935787 2:215901661-215901683 CCTTGGGTTAGGAGTGAAGAAGG + Intergenic
946604810 2:221391995-221392017 CAGTGGTTTTGGAGCGCAAAGGG - Intergenic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
948704032 2:239778386-239778408 CACCGGGTTTGGAGCGGAAGTGG - Intronic
1170905860 20:20514811-20514833 GCCTGGGCTTGGAGTGCAAAAGG - Intronic
1171437465 20:25134501-25134523 CACTGGGTCTGGAAAGAGAATGG + Intergenic
1171987437 20:31670396-31670418 CACTGGGGTTGCAGCCAAAATGG + Intronic
1172587463 20:36094584-36094606 CACAGGATTTGGAGTGCAAAGGG + Intronic
1172896000 20:38300406-38300428 CTCTGGGTTTGGACTGGATAGGG - Intronic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1178610999 21:34079851-34079873 CACTGAGTTTGCAGTGCCAAGGG - Intronic
1180860075 22:19073628-19073650 CACTGGTGTTGGAGTAAAAATGG + Intronic
1181859035 22:25804233-25804255 GGCTGGGTTTTGTGTGAAAAGGG - Intronic
1184970901 22:48019169-48019191 AGGTGGGTTTGGGGTGAAAAGGG + Intergenic
1185028466 22:48428907-48428929 CACTCGGTGTGAGGTGAAAAAGG + Intergenic
950659165 3:14456018-14456040 CACTGGTTTTGGAGTCAGACAGG + Intronic
951103467 3:18716151-18716173 CACTCACTTTGAAGTGAAAAGGG - Intergenic
951668379 3:25152306-25152328 AACTAGGTTTGCAGTGGAAAAGG - Intergenic
951856879 3:27206982-27207004 GACTAGGTTTGAAGTGCAAATGG - Intronic
952129353 3:30342433-30342455 CAAAGGCTTTGGAGTGAAACAGG - Intergenic
952636393 3:35537854-35537876 TACTGGGTTTTGAGAGGAAATGG + Intergenic
952743871 3:36760201-36760223 CACTGTGTTTGGAGAGATGATGG - Intergenic
953794701 3:45975675-45975697 CTCTGGGTTTGGAGTCAGATAGG + Intronic
954432124 3:50476359-50476381 CACTGGGTCTGGACTTCAAAGGG - Intronic
954468773 3:50674558-50674580 CACTGGGATGGGTCTGAAAATGG + Intergenic
955694885 3:61625866-61625888 CACTGGGTTTCAAGTTTAAATGG - Intronic
956284568 3:67595205-67595227 CACAGTGTTTGGAGTTTAAAGGG - Intronic
956887103 3:73571254-73571276 CACTGGATATGGAGAAAAAAGGG - Intronic
956974366 3:74563240-74563262 TACTGGGTTTCAAGTGAAAAAGG - Intergenic
957133364 3:76251486-76251508 CACTTGGTTTGGTGGTAAAATGG + Intronic
957842231 3:85686628-85686650 AACTTGGTTTGGAGTGTGAAAGG + Intronic
958189573 3:90167570-90167592 CACTGAGTTTGGGAGGAAAATGG + Intergenic
958743194 3:98099676-98099698 CAATGGGTCTGGAGAGAAACTGG + Intergenic
959738076 3:109684187-109684209 CACTGGGTTTTGACTGAGGAGGG - Intergenic
960617491 3:119609330-119609352 CACTTACTTTGGAGGGAAAAAGG - Intronic
960671564 3:120159517-120159539 AAGTGGGTTTGAATTGAAAAGGG + Intergenic
962540368 3:136375658-136375680 CACTGGATTTGGGGTTTAAATGG + Intronic
962600601 3:136988196-136988218 CACTGGTCTTGGATTGGAAAGGG - Intronic
965697088 3:171420426-171420448 CACTGGTTTTGGATTGGAACTGG - Intronic
966459924 3:180165518-180165540 GCCTGGGTGTGGAGTGGAAAGGG + Intergenic
970933393 4:21539635-21539657 CACTGAGTTTGAAGTGGAAGGGG - Intronic
971292355 4:25355767-25355789 TAGTGGGTTTGAAGTAAAAAGGG + Intronic
971406521 4:26325720-26325742 CACTGATTATGGAGAGAAAATGG - Intronic
971488103 4:27182139-27182161 TTCAGGGTTTGCAGTGAAAATGG - Intergenic
972230936 4:37072087-37072109 CTCTGGGTTTGAGGTGGAAATGG - Intergenic
973774937 4:54233676-54233698 CTCTGGGTTTGGATTGAGAATGG + Intronic
974501420 4:62709035-62709057 CTCTGAGTTTGGAGTGTAATTGG + Intergenic
974942884 4:68489924-68489946 CACAGGGTTTGGCATGAGAATGG - Intronic
975114978 4:70670373-70670395 GACTAGGTTGGTAGTGAAAACGG - Intronic
975343295 4:73265321-73265343 CACTGGGTTAGGTGAGAAAATGG + Intergenic
976054029 4:81041961-81041983 CACTAGTTTTGTAGTCAAAATGG - Intronic
978027626 4:103896916-103896938 CACTGGGTCAGGAGTGTGAATGG + Intergenic
978469823 4:109052867-109052889 CACTCACTTTGGAATGAAAATGG - Intronic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
983637558 4:169913755-169913777 CACTGGCTTTGGAGTCAGACTGG - Intergenic
984194035 4:176637108-176637130 TATTTGATTTGGAGTGAAAAAGG - Intergenic
984749410 4:183257289-183257311 CACTTAGTTTTGAGTGGAAAAGG + Intronic
985357487 4:189137055-189137077 CACTCACTTTGAAGTGAAAAGGG - Intergenic
986085991 5:4447454-4447476 TACTGGGTTTGAAGATAAAAGGG + Intergenic
986748991 5:10768719-10768741 CACAGGCTTTGAAGTGAAGAAGG + Intergenic
986969495 5:13315559-13315581 GATTGGGTTTGGAGTGTGAATGG - Intergenic
987188164 5:15446039-15446061 CCTTGAGTTTGAAGTGAAAATGG - Intergenic
987842629 5:23240216-23240238 CACTGGGTTTAGAGGGACATGGG + Intergenic
988026960 5:25707492-25707514 CACTGAGTTCAGAGTGAAAAGGG + Intergenic
988827995 5:34959310-34959332 CACTACTTTTGGAGTAAAAACGG + Intergenic
988894511 5:35657469-35657491 CACTGGGTATGGAATGGAATCGG + Intronic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989124876 5:38042758-38042780 CAGTGTGTTTGTAGGGAAAACGG - Intergenic
989447090 5:41542391-41542413 CACTTGACTTGGAGTGAGAAAGG - Intergenic
995610214 5:113901652-113901674 CACTGGTTTTGGAGTGACTTAGG - Intergenic
996635069 5:125679320-125679342 AACTTGGTGTGGAGTGGAAATGG + Intergenic
998163356 5:139826107-139826129 CACTGGGGTTGGAGTGGTCATGG + Intronic
998787946 5:145732819-145732841 CACAGGGGTAGGAGTGGAAATGG + Intronic
1000352529 5:160363099-160363121 CCCTGTGTTTGGTGTTAAAAGGG + Intronic
1000420475 5:161032935-161032957 GGCTGGGGTTGGAGTGAACAAGG - Intergenic
1000691187 5:164323309-164323331 TATTGAGTTTGGAATGAAAAAGG + Intergenic
1002365434 5:178706031-178706053 CACTGAGTTTCCAGTGAAAGAGG + Intergenic
1004920307 6:20369827-20369849 GACTGGGTTGAGAGTGAGAAAGG - Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1009409222 6:63346392-63346414 CAATGGGTTTGGAGAGCAACTGG + Intergenic
1011337317 6:86275775-86275797 CACTGCTTTTGGAGTAAAACTGG - Intergenic
1012442034 6:99269996-99270018 GAATGGGTTTGCAGGGAAAATGG - Intergenic
1012659477 6:101869665-101869687 CACTGGCTTTTGAGGAAAAAAGG + Intronic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015865325 6:137721515-137721537 AGCTGGGTATGGAGTGACAACGG + Intergenic
1016181936 6:141157254-141157276 CACTGAGGTTGGAGGGACAATGG + Intergenic
1016429440 6:143967081-143967103 CACTGGCTTTGGAGTCAGATGGG + Intronic
1018736165 6:166688548-166688570 CACTGGGTTTGGAGGATGAAAGG + Intronic
1019165692 6:170096268-170096290 CACTGGGAATGGTCTGAAAAAGG - Intergenic
1021689746 7:23220553-23220575 CAAAAGGTCTGGAGTGAAAAGGG - Intergenic
1021909460 7:25369781-25369803 CACTGGGTCTGGAATCAGAAGGG + Intergenic
1022053933 7:26709361-26709383 CAAAGGGTGTGGAGTGGAAAAGG + Intronic
1022305768 7:29145468-29145490 CACTGGGGTTGCAGTGAAGGTGG + Intronic
1023433196 7:40115562-40115584 CACTGGGTTTGGAGTCTAGCTGG + Intergenic
1024908905 7:54422059-54422081 CAGTGGATTTGGGGTGGAAAAGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1028333259 7:89622630-89622652 GACTGGGTGTGGAGTGGAAAGGG - Intergenic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1029906607 7:104099613-104099635 CACTGGGTATTAAGTGAAAGGGG - Intergenic
1031237667 7:119197302-119197324 GCCTGTGTGTGGAGTGAAAAGGG - Intergenic
1032069858 7:128797645-128797667 GATTGGGTTTGGAGAGGAAATGG + Intronic
1032556927 7:132846030-132846052 CACTGGGTTCTGAGAGAACAGGG - Intronic
1034220279 7:149439078-149439100 CCCTGAGATTGGAGAGAAAAGGG - Intronic
1036579566 8:10061406-10061428 CACTTAGGTTGGAGAGAAAAAGG - Intronic
1038311587 8:26449584-26449606 GACTGGGTGTGGAGAGAAAACGG + Intronic
1039806939 8:41008172-41008194 CAATGGGTTTGAAATGAAGAAGG + Intergenic
1044637709 8:94343002-94343024 CACAGGGTCTGGATGGAAAAAGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047733006 8:127741799-127741821 TCCTGGGTTTGGAGTGAGCAGGG - Intergenic
1048550422 8:135428244-135428266 CACTGGGGCTGGAGGGACAAGGG - Intergenic
1051375311 9:16396535-16396557 CATTGGGATTGCAGTGAAAATGG + Intergenic
1051376765 9:16410077-16410099 CAATGGGTCTGGAGTAAGAAAGG + Exonic
1051801877 9:20944006-20944028 CACTGGGTCAGAAGAGAAAATGG - Intronic
1052296391 9:26900277-26900299 CACTGGCTTTGGAGTTCAAAAGG - Intergenic
1052523964 9:29588674-29588696 CAATGACTTTGGTGTGAAAAAGG + Intergenic
1052697183 9:31892563-31892585 CACTGGCCTTGGAGTCAAACAGG + Intergenic
1057884982 9:98823185-98823207 CACTGGGGATGGAGTGACAAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060204074 9:121672017-121672039 CACTGCTGATGGAGTGAAAAGGG - Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1186102781 X:6174284-6174306 CAGTGAGTTTGCAGAGAAAAAGG + Intronic
1187614823 X:20981518-20981540 CACAGGGTTTGGTTTGAGAATGG + Intergenic
1188521866 X:31047019-31047041 CACTGGAGTTAGAGTGAGAAGGG + Intergenic
1188630647 X:32355163-32355185 CACTGTATTTGAAGTGAAATTGG + Intronic
1189545477 X:42037964-42037986 GTCTAGGTATGGAGTGAAAAGGG + Intergenic
1189753490 X:44247230-44247252 CAAGGGGGTTAGAGTGAAAAAGG - Intronic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192372516 X:70526254-70526276 CACTGGTGTTGGATTGAAAATGG + Intergenic
1192680026 X:73242509-73242531 CACAGGGCTTTGAGTGAACATGG + Intergenic
1194900445 X:99503020-99503042 CACTGGGTTTGGAGAGTGTATGG - Intergenic
1195405233 X:104505457-104505479 CACTGAGGCTGGAGTGAAATGGG + Intergenic
1197259219 X:124299188-124299210 TACTGGGGTTGCAGAGAAAAGGG + Intronic
1197371292 X:125628742-125628764 CACTGGGTTAGGAGTGTGACTGG + Intergenic
1197899988 X:131360487-131360509 CACTGGTTTTAGAGTCAAACGGG - Intronic
1199222850 X:145337611-145337633 CAATGGCTTTAGAGTAAAAATGG - Intergenic
1199691939 X:150315141-150315163 CACTGGGTTAGGTCTGAAACGGG - Intergenic
1199912994 X:152307925-152307947 CAGAGGGTTTGGCGTGAGAATGG + Intronic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic
1201505985 Y:14700872-14700894 CACTGGAATAGGAGTAAAAAGGG + Intronic
1201957170 Y:19638220-19638242 CACTGGGTTAGGAGTGTGACTGG - Intergenic