ID: 1096474603

View in Genome Browser
Species Human (GRCh38)
Location 12:51900557-51900579
Sequence CTTGGTCACTGGCATCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096474603_1096474608 -10 Left 1096474603 12:51900557-51900579 CCACCAGGATGCCAGTGACCAAG 0: 1
1: 0
2: 0
3: 31
4: 187
Right 1096474608 12:51900570-51900592 AGTGACCAAGAAGGATCTGGCGG 0: 1
1: 0
2: 0
3: 14
4: 219
1096474603_1096474611 4 Left 1096474603 12:51900557-51900579 CCACCAGGATGCCAGTGACCAAG 0: 1
1: 0
2: 0
3: 31
4: 187
Right 1096474611 12:51900584-51900606 ATCTGGCGGAGGACGCGCCGTGG 0: 1
1: 2
2: 1
3: 2
4: 49
1096474603_1096474609 -7 Left 1096474603 12:51900557-51900579 CCACCAGGATGCCAGTGACCAAG 0: 1
1: 0
2: 0
3: 31
4: 187
Right 1096474609 12:51900573-51900595 GACCAAGAAGGATCTGGCGGAGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096474603 Original CRISPR CTTGGTCACTGGCATCCTGG TGG (reversed) Intergenic