ID: 1096474736

View in Genome Browser
Species Human (GRCh38)
Location 12:51901402-51901424
Sequence CTGGACAGGGCAGCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096474736_1096474743 9 Left 1096474736 12:51901402-51901424 CCAACAAAAGCTGCCCTGTCCAG No data
Right 1096474743 12:51901434-51901456 CAGGAAAGAGCAGCCCAGTGAGG No data
1096474736_1096474738 -10 Left 1096474736 12:51901402-51901424 CCAACAAAAGCTGCCCTGTCCAG No data
Right 1096474738 12:51901415-51901437 CCCTGTCCAGCCAGAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096474736 Original CRISPR CTGGACAGGGCAGCTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr