ID: 1096475862

View in Genome Browser
Species Human (GRCh38)
Location 12:51908271-51908293
Sequence CTGGCCTCCATGGAAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 469}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096475862_1096475866 -2 Left 1096475862 12:51908271-51908293 CCAGATTTTTCCATGGAGGCCAG 0: 1
1: 0
2: 1
3: 26
4: 469
Right 1096475866 12:51908292-51908314 AGTGCTGTGAAACCCATGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 141
1096475862_1096475867 -1 Left 1096475862 12:51908271-51908293 CCAGATTTTTCCATGGAGGCCAG 0: 1
1: 0
2: 1
3: 26
4: 469
Right 1096475867 12:51908293-51908315 GTGCTGTGAAACCCATGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 187
1096475862_1096475868 3 Left 1096475862 12:51908271-51908293 CCAGATTTTTCCATGGAGGCCAG 0: 1
1: 0
2: 1
3: 26
4: 469
Right 1096475868 12:51908297-51908319 TGTGAAACCCATGGCTGGGCTGG 0: 1
1: 0
2: 4
3: 26
4: 267
1096475862_1096475864 -6 Left 1096475862 12:51908271-51908293 CCAGATTTTTCCATGGAGGCCAG 0: 1
1: 0
2: 1
3: 26
4: 469
Right 1096475864 12:51908288-51908310 GGCCAGTGCTGTGAAACCCATGG 0: 1
1: 0
2: 1
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096475862 Original CRISPR CTGGCCTCCATGGAAAAATC TGG (reversed) Intronic
900851668 1:5148106-5148128 CTGGCCTGCATTGCAAAATTTGG - Intergenic
901690532 1:10970200-10970222 CTGGCTTCAATGGAATAGTCAGG + Intronic
901803307 1:11721792-11721814 CTGGCCAACATGGCAAAACCCGG + Exonic
901876760 1:12171202-12171224 CTGGCCAACATGGCAAAACCCGG - Intronic
902052640 1:13576479-13576501 CTAGACTCCATGGACAAAGCAGG - Intergenic
902128355 1:14236725-14236747 CTGGGCAACATGGAAAAACCTGG + Intergenic
902291210 1:15436484-15436506 CTGGCCAACATGGTGAAATCCGG + Intergenic
903171063 1:21554045-21554067 CTGGGCTCCAGGGATAAAGCAGG + Exonic
903592062 1:24464093-24464115 ATGGCATCCATGGAAATATAGGG - Exonic
903874022 1:26459954-26459976 CAGTCCTCCAGGGAAAAAGCAGG - Intronic
903915077 1:26757828-26757850 CTGGCCAACATGGCAAAACCCGG - Intronic
904292261 1:29495524-29495546 CTGGGGTCCTTGGAGAAATCTGG - Intergenic
904594421 1:31634161-31634183 CTGACTTCCTTGGAAAAATCCGG + Intronic
904650533 1:32002548-32002570 CTGGCCAACATGGCAAAACCTGG + Intergenic
904683262 1:32243234-32243256 CTGGCCAACATGGCTAAATCTGG + Intergenic
905150481 1:35923114-35923136 CTGGCCTCCAGGGATAAGCCTGG + Exonic
905445210 1:38024026-38024048 CTGGCCAACATGGCAAAACCTGG - Exonic
906363704 1:45186779-45186801 CTGGCCAACATGGCAAAACCCGG - Intronic
906787866 1:48631582-48631604 CTGGCCAACATGGCAAAACCCGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907227829 1:52965834-52965856 CTGGCCAACATGGTAAAATCAGG - Intronic
907634057 1:56115586-56115608 CTGGCCAACATGGCAAAATCTGG - Intergenic
908003741 1:59707477-59707499 CAGGCCTTCATGTAAAAATTTGG + Intronic
908125014 1:61022093-61022115 CTGGCCAACATGGTAAAACCCGG - Intronic
908149304 1:61283378-61283400 CTGGCCAACATGGTAAAACCCGG + Intronic
908235461 1:62143638-62143660 CTGGCCAACATGGTGAAATCTGG - Intronic
909757476 1:79244584-79244606 CTGGCCAACATGGTAAAACCTGG - Intergenic
910929251 1:92426397-92426419 CTGGCCAGATTGGAAAAATCTGG - Intergenic
911331070 1:96526357-96526379 CTGGTCTCCAAGGAAGAAACGGG - Intergenic
911397466 1:97329554-97329576 CTGGCCAACATGGCAAAACCCGG + Intronic
911618745 1:100042798-100042820 CTGGCCAACATGGTAAAATCCGG - Intronic
911647294 1:100351001-100351023 CTGGCCAACATGGCAAAACCCGG + Intergenic
911989518 1:104675191-104675213 CTGGCCAACATGGTAAAATCCGG + Intergenic
912477066 1:109945502-109945524 CTGGCCAACATGGTAAAACCTGG + Intergenic
912536214 1:110374229-110374251 CTGGCCACCATGGTGAAACCCGG - Intronic
915336427 1:155145332-155145354 CTGGCCAACATGGTAAAACCAGG + Intergenic
915750649 1:158206759-158206781 CTGGCCAACATGGAAAAACCTGG - Intergenic
916805587 1:168257162-168257184 CTGGCCTCATAGGATAAATCAGG + Intergenic
917328899 1:173861957-173861979 CTGGCCAACATGGCAAAACCCGG - Intergenic
917521019 1:175748562-175748584 CAGGGCTCCATGGGAAACTCTGG - Intergenic
918095774 1:181332993-181333015 CTTGCCCTCATGGAAACATCTGG + Intergenic
918340452 1:183564026-183564048 CTGGCCTGAATGGAAAAAGTAGG + Exonic
919760724 1:201096421-201096443 CAGTCTTCCATGGAAAAATGAGG + Intronic
921498825 1:215875049-215875071 CTGGCCACCTTGGCAACATCCGG - Intronic
923588254 1:235295317-235295339 CTGGCCAACATGGCAAAACCTGG + Intronic
924051499 1:240084175-240084197 CTGGCCAACATGGCAAAACCCGG + Intronic
924451095 1:244179841-244179863 CTGGCCAACATGGCAAAACCTGG - Intergenic
924504481 1:244668843-244668865 CTTGCCTCAATGGAAAAAACTGG - Intronic
1063431072 10:5988679-5988701 CTGGGCAACATGGCAAAATCTGG - Intergenic
1063683654 10:8214673-8214695 CTGGCCAACATGGCAAAACCCGG - Intergenic
1065582713 10:27187559-27187581 CTGGCCAACATGGCAAAACCTGG + Intergenic
1067384039 10:45802716-45802738 CTGGCCAACATGGCAAAACCTGG - Intergenic
1067769041 10:49110312-49110334 CTTGCCTCCAGGAAGAAATCTGG - Intronic
1067891729 10:50143286-50143308 CTGGCCAACATGGCAAAACCTGG - Intergenic
1068253012 10:54469285-54469307 CTGGCCAACATAGTAAAATCTGG - Intronic
1068982996 10:63081120-63081142 CTGGCCAACATGGTGAAATCCGG + Intergenic
1069547685 10:69340438-69340460 CTGGCCAACATGGTAAAACCCGG - Intronic
1070931102 10:80261091-80261113 CTGGCCTCTGTGGACAAATGAGG - Intergenic
1071543576 10:86509954-86509976 CTGGCCAACATGGTAAAACCCGG - Intronic
1071849495 10:89554215-89554237 CTGACTTCCCTAGAAAAATCTGG + Intronic
1072490934 10:95905633-95905655 CTGGCCAACATGGTGAAATCCGG + Intronic
1072749371 10:97966298-97966320 CTGGCCAACATGGCAAAACCCGG - Intronic
1074208353 10:111303940-111303962 ATGACCTCATTGGAAAAATCAGG - Intergenic
1074430772 10:113392503-113392525 TTGGCTTCCATGGAAGAATAGGG + Intergenic
1074490628 10:113936401-113936423 CTGGCCAACATGGCAAAACCCGG - Intergenic
1074873102 10:117593036-117593058 TTAGCCTCCATGGATGAATCTGG - Intergenic
1075051419 10:119185057-119185079 CTGGCCAACATGGCAAAACCTGG - Intergenic
1075380892 10:122017624-122017646 CTGGCCAACATGGCAAAACCCGG + Intronic
1075442686 10:122492522-122492544 CTGGCCAACATGGCAAAACCCGG - Intronic
1077668916 11:4139530-4139552 CTGGCCAACATGGTGAAATCTGG - Intergenic
1077991975 11:7420191-7420213 CTGGCCTCCATGTAATAAAGAGG - Intronic
1078588774 11:12619502-12619524 CAGGACTCCATGGACAAATAAGG + Intergenic
1079266774 11:18940800-18940822 CTGGCCACCATGGTGAAACCTGG + Intergenic
1080242838 11:30147047-30147069 CTGGCCAACATGGTAAAACCCGG - Intergenic
1081141244 11:39503159-39503181 CTTGCATCCATGGACCAATCTGG - Intergenic
1081755692 11:45542742-45542764 CTGGCCAACATGGTGAAATCCGG + Intergenic
1081785264 11:45742097-45742119 CTGGCCAACATGGCAAAACCCGG + Intergenic
1081834287 11:46141366-46141388 CTGGCCAACATGGCAAAACCGGG + Intergenic
1081891895 11:46550007-46550029 CTGGCCAACATGGCAAAACCTGG - Intronic
1083357940 11:62081490-62081512 CTGGGCTACATGGCAAAACCTGG - Intergenic
1084104083 11:66969385-66969407 CTGGCCAACATGGCGAAATCCGG - Intergenic
1084126212 11:67100739-67100761 CTGGCCAACATGGCAAAACCTGG - Intergenic
1085192869 11:74644055-74644077 CTCACCTCCCTGGAAAAAACTGG + Intronic
1085485041 11:76855926-76855948 CTGGCCTACATGGTGAAACCTGG + Intergenic
1085720173 11:78905586-78905608 CTGGCCTCGGAGGAAAAATGTGG - Intronic
1085876521 11:80413600-80413622 CTGTCCTTCAAGAAAAAATCTGG + Intergenic
1087108708 11:94439013-94439035 CTAACTTCAATGGAAAAATCTGG + Intronic
1087125271 11:94619440-94619462 CTTGTCTCCATGGATAATTCTGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1087687236 11:101278853-101278875 CTGGCCAACATGGTAAAACCCGG + Intergenic
1089766998 11:120775234-120775256 CTGCCCTCCATTGAAGAATCTGG + Intronic
1090825354 11:130381333-130381355 CTGGGCTCCAGGGAAATTTCTGG - Intergenic
1092039044 12:5367328-5367350 CTGGTCTCCATGGTAAACTGTGG - Intergenic
1092353058 12:7771809-7771831 CTGGCCAACATGGTGAAATCCGG - Intronic
1092450249 12:8594916-8594938 CTGGCCAACATGGCAAAACCCGG + Intergenic
1092471274 12:8784163-8784185 CTGGGCAACATGGTAAAATCCGG + Intergenic
1092937744 12:13379690-13379712 ATGGCCTCCAGCCAAAAATCTGG - Intronic
1093271151 12:17063756-17063778 CTGGCCAACATGGCAAAACCCGG + Intergenic
1095742794 12:45625268-45625290 CTGGCCAACATGGAGAAACCCGG - Intergenic
1096475862 12:51908271-51908293 CTGGCCTCCATGGAAAAATCTGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097527222 12:60752129-60752151 CTGGCCAACATTAAAAAATCTGG - Intergenic
1098006658 12:66004463-66004485 CTGGCCAACATGGCAAAACCCGG + Intergenic
1099636812 12:85224220-85224242 ATGGCCATCATTGAAAAATCAGG + Intronic
1100444148 12:94645628-94645650 TTGGCCAACATGGTAAAATCCGG - Intronic
1101613314 12:106311608-106311630 CTGGCCTTCATTGAAAGGTCAGG + Intronic
1102573986 12:113844449-113844471 CTGGCCTACATGGAAGCATCTGG - Intronic
1103874815 12:124118735-124118757 CTGGCCAACATGGCAAAACCCGG - Intronic
1103884098 12:124188110-124188132 CTGGCCACCATGGCGGAATCTGG + Intronic
1104752015 12:131245859-131245881 ATGGCCTCCATGGAAAGGTGTGG - Intergenic
1105739241 13:23304817-23304839 CTGGCCAACATGGCAAAACCCGG - Intronic
1106166249 13:27249203-27249225 CTGGCTTCCCTTGAGAAATCAGG - Intergenic
1106600029 13:31179683-31179705 GTGGCCTCCAGGGAAAAATAGGG - Intergenic
1107908454 13:45083356-45083378 CTGGCCAACATGGTAAAACCCGG + Intergenic
1107986194 13:45778382-45778404 GTGGCTTTCATGGAAAAATTGGG - Exonic
1108189531 13:47923392-47923414 CTGGCCAACATGGCAAAACCTGG + Intergenic
1109985969 13:69984916-69984938 CTGGCCAACATGGAGAAACCTGG + Intronic
1112534045 13:100232299-100232321 CTAGCTACCATGGAAAGATCAGG - Intronic
1112863316 13:103862256-103862278 CTGACCTCCATTGAGAAACCCGG - Intergenic
1113338123 13:109396198-109396220 CTGGACACCATGGAAAGTTCTGG + Intergenic
1114190577 14:20436972-20436994 CTGCCCTCCATGAATAAAGCTGG - Intergenic
1116335223 14:43648814-43648836 CTGGCCAACATGGTAAAACCTGG - Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117523368 14:56573373-56573395 CTAGCTACCATGGAACAATCTGG - Intronic
1118703667 14:68460259-68460281 CTGGCCAACATGGTGAAATCTGG + Intronic
1119344008 14:73906667-73906689 CTGGCCAACATGGCAAAACCCGG - Intronic
1119858976 14:77923201-77923223 CTGGCCTCCCAGGCAAAATGAGG - Intronic
1120024684 14:79569797-79569819 CTGGCCAACATGGCAAAACCCGG - Intronic
1120462494 14:84814925-84814947 CTGGCCAACATGGTGAAATCTGG - Intergenic
1120495948 14:85235604-85235626 CTGGCCAACATGGCAAAACCCGG + Intergenic
1120793486 14:88607304-88607326 CTGGCCTGCTTGTAAAAATGGGG + Exonic
1121851355 14:97223979-97224001 CTGGGCTCCCTGGAGAAATGGGG - Intergenic
1121864041 14:97346076-97346098 CTGGGCTCCATGGCTAAGTCAGG - Intergenic
1122351255 14:101094426-101094448 CTGGCCAACATGGTAAAACCCGG + Intergenic
1125385169 15:39129513-39129535 CTGGCCAACATGGCAAAACCTGG - Intergenic
1126329545 15:47517218-47517240 CTGATCACAATGGAAAAATCAGG - Intronic
1126511112 15:49475795-49475817 CTGGCCAACATGGCAAAACCGGG + Intronic
1126608757 15:50507090-50507112 CTGGCCAACATGGCAAAACCCGG + Exonic
1126652044 15:50933082-50933104 CTTGCCTTCATGGATAAATTTGG + Intronic
1127791629 15:62403665-62403687 CTGGCTTCCATGTCACAATCTGG + Intronic
1131159872 15:90098732-90098754 CTGGCCACCATGGTGAAACCCGG - Intronic
1132296260 15:100736918-100736940 CTGGCCTCTCTTGAAAAATTGGG - Intergenic
1132510095 16:336042-336064 CTGGCCAACATGGTAAAACCTGG + Intronic
1132948116 16:2543923-2543945 CTGGCCAACATGGCAAAACCCGG - Intronic
1134260409 16:12646835-12646857 CTGTTCTCCATGGCAGAATCTGG - Intergenic
1134488396 16:14677555-14677577 CTGGCCAACATGGTAAAACCCGG - Intronic
1135501635 16:23000909-23000931 CTGGCCAACATGGCAAAACCTGG + Intergenic
1135578419 16:23604574-23604596 CTGGCCAACATGGAGAAACCCGG + Intronic
1135696417 16:24591237-24591259 CTGGCCAACATGGTGAAATCCGG - Intergenic
1136376715 16:29870152-29870174 CTGGCCAACATGGCAAAACCCGG + Intergenic
1140352263 16:74273413-74273435 CTGGCCAACATGGCAAAACCTGG - Intergenic
1140467786 16:75196247-75196269 GTGGCCTCCATGAAACCATCTGG - Intergenic
1140950420 16:79811709-79811731 CTGGCCTCCATCCAAGACTCTGG - Intergenic
1142381504 16:89734966-89734988 CTGGCCAACATGGTAAAACCTGG + Intronic
1203140389 16_KI270728v1_random:1761212-1761234 ATGGCCAACATGGTAAAATCCGG + Intergenic
1142633875 17:1244510-1244532 CTGGCCAACATGGCAAAACCCGG - Intergenic
1142955232 17:3516953-3516975 CTGGCCAACATGGCAAAAGCCGG + Intronic
1143359833 17:6359993-6360015 CTGACCGACATGGAAAAATCCGG + Intergenic
1143478294 17:7215303-7215325 CTGGGCTCCATGGAAGAAGTAGG + Intronic
1144041199 17:11412846-11412868 CAGGCTTCCAAGGAACAATCTGG + Intronic
1144516285 17:15919436-15919458 CTGGGCTCCCTGAAAAAATGTGG + Intergenic
1144669227 17:17123122-17123144 CTTGCATAAATGGAAAAATCTGG - Intronic
1144685136 17:17221142-17221164 CTGCCCTTCATGGAAAACTTGGG + Intronic
1144992848 17:19245853-19245875 CTGGCCAACATGGTAAAACCTGG - Intronic
1145971414 17:28958597-28958619 CAGGCCAACATGGCAAAATCCGG + Intronic
1146054289 17:29573553-29573575 CTGGCCCCCAGGGAAGAAGCGGG + Exonic
1146249001 17:31321093-31321115 CTGGCCTCCAAGGCATAAACTGG - Intronic
1147956050 17:44135408-44135430 CTGGCCACCATGGTAAAACCTGG - Intergenic
1148263041 17:46200959-46200981 CTGGAGTGCATGGCAAAATCTGG + Intronic
1148690774 17:49525503-49525525 CTGGCCAACATGGCAAAACCTGG + Intergenic
1149019966 17:51951600-51951622 TTGTCCTCCATGCAAAAATTTGG + Intronic
1149267420 17:54942295-54942317 CTGGCCAACATGGTAAAACCAGG - Intronic
1149695376 17:58612161-58612183 CAGGCCTCTATAGAAAAAACTGG + Intronic
1150728107 17:67667787-67667809 CTGGCCAACATGGCAAAACCCGG + Intronic
1150742942 17:67794168-67794190 CTGGCCACCATGGTGAAACCCGG + Intergenic
1151104744 17:71599556-71599578 CTGGCCATCATGGCAAAACCTGG + Intergenic
1152607006 17:81296514-81296536 CTGGCCACCATGGTGAAACCTGG - Intergenic
1152881680 17:82820166-82820188 CTGGCCAACATGGAGAAATCTGG - Intronic
1153283947 18:3440158-3440180 CTGGCCAACATGGCAAAACCCGG + Intronic
1154488346 18:14897369-14897391 CTGGCCAACATGGCAAAACCGGG - Intergenic
1154986980 18:21562068-21562090 CTGGCCAACATGGCAAAACCCGG - Intronic
1155049394 18:22133348-22133370 CTGGCCAACATGGTGAAATCCGG + Intergenic
1155133171 18:22959783-22959805 CTAGCATTCCTGGAAAAATCTGG - Intronic
1155176237 18:23303708-23303730 CTGGCCAACATGGCAAAACCTGG + Intronic
1155311438 18:24527991-24528013 CTGGCCAACATGGCAAAAGCTGG - Intergenic
1155359841 18:24988970-24988992 CTGGCCAACATGGCAAAACCTGG + Intergenic
1155745381 18:29350731-29350753 GTGGCCAACATGGCAAAATCTGG + Intergenic
1157227758 18:45882815-45882837 CTGACCAACATGGAGAAATCCGG + Intronic
1157268235 18:46247860-46247882 CTGGCCAACATGGCAAAACCCGG - Intronic
1157582561 18:48782088-48782110 CCTGCCTCCATGGAAACTTCTGG - Intronic
1159745731 18:72232511-72232533 CTGGCCCCAAGGGAAGAATCAGG - Intergenic
1160920756 19:1519170-1519192 CTGACCAACATGGAGAAATCCGG + Intergenic
1161034314 19:2075930-2075952 CTGGCCAACATGGCAAAACCTGG + Intronic
1161053902 19:2180355-2180377 CTGACCTCCAGGGAAAAAATGGG + Intronic
1161367197 19:3886902-3886924 CTGGCCAACATGGTGAAATCCGG - Intronic
1161406055 19:4091837-4091859 CTGGGCAACATGGAAAAACCCGG - Intronic
1161718004 19:5887860-5887882 CTGGCCAACATGGCAAAACCCGG - Intronic
1162292124 19:9788047-9788069 CTGGCCAACATGGTAAAACCTGG - Intronic
1162506126 19:11086311-11086333 CTGGCCAACATGGCAAAACCCGG - Intergenic
1162775995 19:12979728-12979750 CTGGCCAACATGGCGAAATCTGG + Intergenic
1162848908 19:13415548-13415570 CTGGCCAACATGGCAAAACCCGG + Intronic
1162879848 19:13650144-13650166 CTGGCCAACATGGTAAAACCAGG - Intergenic
1162982057 19:14246830-14246852 CTGGCCAACATGGTGAAATCCGG + Intergenic
1163076085 19:14893004-14893026 CTGGCCAACATGGCAAAAACCGG + Intergenic
1163587369 19:18171393-18171415 CTGGCCAACATGGTAAAACCTGG + Intronic
1164177076 19:22784401-22784423 CTGGCCAACATGGCAAAACCCGG + Intergenic
1165532598 19:36416880-36416902 CTGGCCAACATGGTAAAACCCGG + Intronic
1165845340 19:38814684-38814706 CTGGCCAACATGGCAAAACCTGG - Intergenic
1166084995 19:40468568-40468590 CTGGCCAACATGGCAAAACCCGG - Intronic
1166115338 19:40650121-40650143 CTGGCCAACATGGTAAAACCCGG - Intergenic
1166388080 19:42393121-42393143 CTGGCCTTCAAGGAAACAGCAGG - Intergenic
1166434251 19:42754261-42754283 CTGGCCTTCAGGGAAGAGTCAGG - Exonic
1166860305 19:45806478-45806500 CTGGCCAACATGGTGAAATCTGG + Intronic
1166879506 19:45919170-45919192 CTGGCCAACATGGTGAAATCCGG + Intergenic
1167120733 19:47514927-47514949 GTGGCCGCCATGGACAATTCCGG - Exonic
925242377 2:2342920-2342942 CTGGCCTGCATGAATAAACCTGG + Intergenic
925508799 2:4601082-4601104 CTGGTCACCATGGAAAAAGCAGG + Intergenic
926112453 2:10192011-10192033 CTGGCCTCCATGAAATCCTCAGG - Intronic
926227328 2:10977371-10977393 TTTGCCTCCATGGATAAATTAGG - Intergenic
926279001 2:11429840-11429862 CTGGCCAACATGGCAAAACCTGG - Intergenic
927879530 2:26680927-26680949 CTTTCCTCCTTGGAAAAATGGGG + Intergenic
928185937 2:29110877-29110899 CTGGCCAACATGGTAAAACCTGG - Intronic
928323880 2:30304622-30304644 CTGGCCAACATGGTAAAACCCGG + Intronic
928684604 2:33735689-33735711 CTGGCCAACATGGCAAAACCCGG + Intergenic
929183738 2:39071056-39071078 CTGGCCAACATGGTAAAACCCGG - Intronic
929650140 2:43671175-43671197 CTGGCCAACATGGTAAAACCCGG - Intronic
929653142 2:43702128-43702150 TTGGCCTCCAGAGAAACATCTGG + Intronic
930475640 2:51877587-51877609 CTGGCCAACATGGTGAAATCCGG - Intergenic
930560914 2:52958765-52958787 CTGGCCAACATGGCAAAACCTGG + Intergenic
930620477 2:53638337-53638359 CTGACCAACATGGTAAAATCTGG + Intronic
930785364 2:55266958-55266980 CTGGCCAACATGGTAAAACCCGG - Intronic
931391878 2:61851523-61851545 CTGGCCAACATGGCAAAACCCGG - Intronic
933741025 2:85533954-85533976 CTGGCCAACATGGCAAAACCCGG + Intergenic
934800050 2:97146155-97146177 CTGGCCAACATGGCAAAAGCCGG - Intronic
934917120 2:98309289-98309311 CTGTGCTCCAGGGAAACATCAGG + Intronic
935190008 2:100769653-100769675 GTTTCCTCCATGGAAAAATGAGG + Intergenic
935707773 2:105871383-105871405 CTTCCCTCCATGGTAAAATGAGG - Intronic
936406207 2:112206597-112206619 CTGGCCAACATGGCAAAACCCGG - Intergenic
938012285 2:127838449-127838471 CTGGCCAACATGGCAAAACCTGG - Intergenic
938896176 2:135752909-135752931 CTGGCCAACATGGTGAAATCTGG - Intronic
940710249 2:157154310-157154332 CTGGCCTAGATGGAAAGATTTGG + Intergenic
941377324 2:164747664-164747686 CTGGCCAACATGGCAAAACCTGG - Intronic
941487774 2:166103258-166103280 CTGGCCAACATGGCAAAACCTGG + Intronic
943225617 2:185170190-185170212 CTAGCCTACATGGCAAAACCTGG - Intergenic
944238386 2:197461829-197461851 CTGGCCGACATGGTAAAACCCGG - Intronic
945298551 2:208194475-208194497 CTGCCCTTTATGCAAAAATCAGG + Intergenic
945794697 2:214347875-214347897 CTACTCTCCATGGAAAAATTAGG + Intronic
946242056 2:218362446-218362468 CTGGCCAACATGGTGAAATCCGG + Intronic
946753058 2:222912781-222912803 CTGTCCCCCAAGGAAGAATCTGG - Intronic
947090899 2:226510496-226510518 CTGGCCAACATGGCAAAACCCGG + Intergenic
947161554 2:227220371-227220393 CTGGCCAACATGGAGAAACCCGG - Intronic
947187733 2:227470398-227470420 CTGGCCTACATGGCGAAACCGGG - Intergenic
947606993 2:231492776-231492798 CTGGCCAACATGGTGAAATCCGG - Intergenic
947649220 2:231770625-231770647 CTGGGCAACATGGCAAAATCTGG + Intronic
1172540040 20:35705605-35705627 CTGGCCATGATGGAGAAATCCGG + Intronic
1172611132 20:36253265-36253287 CAGGCCACCATGGAAAATGCTGG - Intronic
1172741807 20:37174575-37174597 CTGGCCAACATGGCAAAACCTGG + Intronic
1172885915 20:38230696-38230718 CTGACCAACATGGAAAAATGCGG + Intronic
1172985236 20:38981750-38981772 CTGGCCAACATGGCAAAACCTGG + Intronic
1174018885 20:47512964-47512986 CTGGCCAACATGGCAAAACCTGG + Intronic
1174018947 20:47513533-47513555 CTGGCCAACATGGCAAAATGCGG + Intronic
1174119716 20:48254176-48254198 CTGGCCAACATGGTAAAACCCGG + Intergenic
1174160993 20:48550401-48550423 GTTGCCTCCATGGAGAACTCAGG + Intergenic
1174466678 20:50723161-50723183 CTGGCCTACAAGATAAAATCTGG + Intergenic
1174750838 20:53110050-53110072 CTGGCTTCTTTTGAAAAATCAGG + Intronic
1175924148 20:62463740-62463762 CTGGCATTGCTGGAAAAATCAGG + Exonic
1176408796 21:6436658-6436680 CTGGGCTCCATGCAAAATGCAGG - Intergenic
1176975490 21:15316114-15316136 CTGGCCAACATGGTGAAATCTGG + Intergenic
1177028772 21:15955508-15955530 CTGGCCAACATGGCAAAACCTGG - Intergenic
1177626873 21:23673502-23673524 CTGGCCAACACGGTAAAATCTGG + Intergenic
1179612216 21:42559683-42559705 CTGGCCAACATGGCAAAAACCGG + Intronic
1179684289 21:43044980-43045002 CTGGGCTCCATGCAAAATGCAGG - Intergenic
1180251993 21:46596209-46596231 CTGGTCTCCAAGGCAAAATGGGG - Intergenic
1182030950 22:27159078-27159100 CTGGCCTCCATGTGGAAATGTGG - Intergenic
1182080363 22:27524462-27524484 CTGGCCTGCATGGAAGGAGCCGG + Intergenic
1182504064 22:30769456-30769478 CTGGCCAACATGGCAAAACCCGG + Intronic
1182673106 22:32014502-32014524 CTGACCAACATGGAGAAATCTGG + Intergenic
1183433659 22:37781283-37781305 CTGGCCAACATGGAGAAACCCGG - Intergenic
1183908808 22:41063120-41063142 CTGGCCAACATGGAGAAACCCGG + Intergenic
1184072430 22:42154376-42154398 CTGGCCAACATGGCAAAAACCGG - Intergenic
1184379296 22:44135046-44135068 TTGACCTCCATGGAATACTCAGG - Intronic
1185299841 22:50073538-50073560 CTGGCCAACATGGCAAAACCCGG + Intronic
949545895 3:5072042-5072064 TCGGCCTCCATGACAAAATCGGG + Intergenic
949903619 3:8839907-8839929 CTTGCCTCCAAGAAAAAATATGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950520042 3:13492732-13492754 CTGGCCAACATGGTGAAATCTGG - Intronic
950591305 3:13937316-13937338 CAGGCCTCCAGGGCAGAATCTGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950900171 3:16490433-16490455 CTGTCCTCCAGGGAACAATAGGG + Intronic
952261450 3:31744348-31744370 CTGGGCAACATGGAGAAATCCGG + Intronic
952860075 3:37805861-37805883 CTGGCCAACATGGCAAAACCTGG - Intronic
953885729 3:46713435-46713457 CTGGCCTCCATGGAGGGGTCTGG - Intronic
954021212 3:47743620-47743642 CTGGCCAACATGGAGAAACCTGG + Intronic
954394147 3:50284013-50284035 CTGGCCAACATGGCAAAACCTGG + Intronic
955295412 3:57730275-57730297 CTGGCCAACATGGCAAAACCCGG - Intergenic
958066400 3:88549380-88549402 CTGGCCAACATGGTGAAATCCGG - Intergenic
958514764 3:95100042-95100064 CTGGCCAACATGGTAAAACCCGG - Intergenic
958634542 3:96726691-96726713 CTGGCCTCTATAGTAGAATCAGG - Intergenic
958757048 3:98261512-98261534 CTGGACTCCCTGAACAAATCTGG + Intergenic
958997337 3:100919850-100919872 GTGGCCTCCAAAGAAAAATATGG - Intronic
959447712 3:106460533-106460555 CTGGCCAACATGGCAAAACCTGG + Intergenic
960317320 3:116194168-116194190 CTAGTTTACATGGAAAAATCTGG - Intronic
960387637 3:117039003-117039025 CTGGCCAACATGGCAAAACCTGG + Intronic
960578815 3:119255972-119255994 CTGGCCAACATGGCAAAACCCGG + Intergenic
960880525 3:122340492-122340514 CTGGCCAACATGGTGAAATCTGG - Intronic
960906651 3:122608404-122608426 CTGGCCAACATGGCAAAACCCGG - Intronic
960929156 3:122826796-122826818 CTGTCCTCCATGAATTAATCTGG - Exonic
962975830 3:140445150-140445172 CTGGCCGCCAGGGAGAAATCAGG - Intronic
963479456 3:145852081-145852103 CTGGCCAACATGGAAAAATCTGG + Intergenic
964785947 3:160396713-160396735 CTGGCCTACCTGGAAAAGACTGG - Intronic
964974486 3:162602536-162602558 CTGGCCAACATGGCAAAACCTGG + Intergenic
965572327 3:170184605-170184627 CTGGCCAGCATGGTAAAACCCGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968132759 3:196201530-196201552 CTGGCCAACATGGAAGAACCCGG + Intronic
968168575 3:196489515-196489537 CTGGCCAACATGGCAAAAACCGG - Intronic
968768960 4:2491424-2491446 CTGGCCAACATGGCAAAAACTGG - Intronic
969182595 4:5453711-5453733 CTGGCCAACATGGTAAAACCCGG + Intronic
969185911 4:5474160-5474182 GTGGCCTCCCTGGAGAACTCTGG + Intronic
970734611 4:19151483-19151505 GTGGTCTCCAAAGAAAAATCAGG - Intergenic
971214114 4:24647942-24647964 CTGGCCAACATGGTGAAATCCGG - Intergenic
972000848 4:34030551-34030573 CTGGCTTCCAGGGAAATAACTGG - Intergenic
972118452 4:35668842-35668864 CTGGCCAACATGGTGAAATCCGG - Intergenic
972357875 4:38298234-38298256 CTAGAGTCCATGGAAAAATTGGG - Intergenic
972504565 4:39708084-39708106 CTGACCACCATGGAGAAACCCGG - Intronic
973839612 4:54847786-54847808 GTGGACTCCATGAAAAACTCTGG - Intergenic
973882652 4:55289467-55289489 CTGGCCAACATGGCAAAACCTGG - Intergenic
974040686 4:56854775-56854797 CTGGCCAACATGGCAAAAACAGG + Intergenic
975542163 4:75524946-75524968 CTGGGCAACATGGAGAAATCTGG - Intronic
975558889 4:75691268-75691290 CTGGCCAACATGGCAAAATGCGG - Intronic
975581142 4:75907861-75907883 CTGGCCAACATGGCAAAACCCGG + Intergenic
976182638 4:82413453-82413475 CTGGGCGACATGGCAAAATCCGG - Intergenic
976906427 4:90242114-90242136 CTGGCCAACATGGTGAAATCCGG + Intronic
978502122 4:109420691-109420713 CTGGCCAACATGGCAAAACCCGG - Intergenic
979824073 4:125211195-125211217 CTGGCCATCATGGAGAAACCTGG - Intergenic
980713542 4:136601654-136601676 ATGACCTCAATGGAAATATCTGG - Intergenic
982006684 4:151070291-151070313 CTGACCTCCATGGTAAACTCAGG - Intergenic
982478053 4:155877073-155877095 CTGGCCAACATGGTGAAATCCGG + Intronic
982924343 4:161317397-161317419 CTGGCCAACATGGTGAAATCTGG + Intergenic
983144723 4:164199449-164199471 CTGGCCAACATGGTAAAACCTGG + Intronic
983244830 4:165275928-165275950 CTGGCCAACATGGTAAAACCAGG + Intronic
984370880 4:178863180-178863202 CTGGGCAACATGGCAAAATCTGG - Intergenic
984668712 4:182456990-182457012 CTGGCCAACATGGAGAAACCTGG + Intronic
984764543 4:183389727-183389749 CTGGCCCACATGGTAAAACCTGG + Intergenic
984776722 4:183487545-183487567 CTGACCTCCATGTTAGAATCTGG + Intergenic
985131868 4:186746582-186746604 CTGGCCCCCATGGTGAAACCTGG - Intergenic
986747686 5:10758994-10759016 CTGGCCAACATGGCAAAATCCGG + Intronic
987243887 5:16028936-16028958 CTGCCCCCCATGGAAAACGCAGG + Intergenic
987310965 5:16680801-16680823 CTGGCCCACATGGCAAAACCTGG + Intronic
987495829 5:18643384-18643406 CTGGCCTCCATGGAGAGAAATGG + Intergenic
987750625 5:22034223-22034245 CTGGCCAACATGGCAAAACCTGG - Intronic
988403694 5:30796559-30796581 GAGGACTCCATGGAAAAATGTGG + Intergenic
989483081 5:41955262-41955284 CTGGCCTAAAGGGAAACATCAGG + Intergenic
990016832 5:51073453-51073475 CTGGGGTCCATGGTAAAGTCTGG + Intergenic
990378172 5:55193927-55193949 CTGGCCTACATGGAGAAACCCGG + Intergenic
990581092 5:57168241-57168263 CTGGCCAACATGGTAAAACCCGG + Intergenic
990751784 5:59024090-59024112 CTGGCCAACATGGCAAAACCTGG - Intronic
991529113 5:67595842-67595864 TTGGCCTCCAGGGAAACAGCTGG - Intergenic
993980955 5:94543251-94543273 CTGGCCAACATGGCAAAACCTGG + Intronic
994301786 5:98156315-98156337 CTGGCCTTCAAGGAGATATCAGG + Intergenic
994320813 5:98392528-98392550 GTGGCCTCCAGGGAAACTTCTGG + Intergenic
994665224 5:102696973-102696995 CTGGCCCCCATTGAATAGTCTGG - Intergenic
994816149 5:104591070-104591092 CTGGGCACCATGAAAAAACCAGG - Intergenic
995721509 5:115139311-115139333 CTGGCCAACATGGTAAAACCCGG - Intronic
997369887 5:133352598-133352620 CTGGGCAACATGGTAAAATCTGG - Intronic
997981991 5:138473530-138473552 CTGGCCAACATGGTGAAATCTGG + Intergenic
998392248 5:141794916-141794938 CCGGCCTTCATGGAATAAGCAGG - Intergenic
998792854 5:145784089-145784111 CTGGCCAACATGGCAAAACCTGG + Intronic
999644854 5:153707572-153707594 TTGGCCTCCATGGACAGATCTGG + Intronic
1000093494 5:157950585-157950607 CTGGCCAACATGGCAAAACCTGG + Intergenic
1001480723 5:172087463-172087485 CTGGCCAACATGGCAAAACCTGG - Intronic
1002035666 5:176467520-176467542 CTGGCCAACATGGCAAAACCCGG - Intronic
1002902138 6:1418144-1418166 CTGGCCAACATGGCAAAACCCGG - Intergenic
1003141002 6:3471273-3471295 CTGGCCAACATGGAGAAACCCGG - Intergenic
1004074194 6:12330070-12330092 CTGGCCAACATGGTGAAATCCGG + Intergenic
1004383115 6:15149336-15149358 CTGGCCAACATGGGAAAAGCTGG - Intergenic
1005436856 6:25821316-25821338 AGGACTTCCATGGAAAAATCTGG + Intronic
1005627485 6:27677059-27677081 CTGGCCAACATGGCAAAACCTGG - Intergenic
1005806452 6:29478159-29478181 TTGGTGTCCATGGAAACATCAGG + Intergenic
1005887562 6:30108366-30108388 CTGGCCAACATGGTAAAACCTGG + Intronic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007524556 6:42480479-42480501 CTGGCCAACATGGTGAAATCTGG - Intergenic
1007652325 6:43430912-43430934 CTGGCCAACATGGTAAAACCCGG - Intronic
1009246449 6:61244352-61244374 CTGGCCAACATGGCAAAACCCGG + Intergenic
1009378470 6:63000922-63000944 CTGGTATACTTGGAAAAATCAGG - Intergenic
1010545481 6:77150230-77150252 CTGGCCTCCCTGAAAGAAACAGG + Intergenic
1011239668 6:85257505-85257527 CTGGCATCAATGGACACATCTGG - Intergenic
1013034929 6:106372440-106372462 CTGGCCAACATGGCCAAATCTGG - Intergenic
1013505487 6:110796144-110796166 CTGGCCAACATGGAGAAACCCGG + Intronic
1013524664 6:110963106-110963128 CTGGCCAACACGGTAAAATCCGG - Intronic
1015173807 6:130284041-130284063 CTGGCCAACATGGTAAAACCGGG - Intronic
1016122416 6:140360147-140360169 CTGGGCAACATGGCAAAATCCGG - Intergenic
1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017401869 6:154073810-154073832 CTGGCCAGCATGGCAAAAACTGG + Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017678405 6:156839017-156839039 CTGGGCTTCATGGAGAAATAGGG + Intronic
1017979411 6:159386439-159386461 TTGGCCTCCATGGGGATATCAGG + Intergenic
1018309171 6:162490941-162490963 CTGGCCAACATGGCAAAACCTGG + Intronic
1018993151 6:168689933-168689955 CTGGCCAACATGGTAAAACCCGG - Intergenic
1021445950 7:20733828-20733850 CTGGCCAACATGGTGAAATCTGG - Intronic
1022329682 7:29365848-29365870 CTAGCCACCAGGGAAAAAACAGG + Intronic
1023248596 7:38233394-38233416 CTGGCCTCTATAGAGAAATCTGG - Intergenic
1023817566 7:43962162-43962184 CTGGCCCCAAGGGAAAAAACTGG - Intergenic
1024933688 7:54690704-54690726 CTGGCCAACATGGAGAAACCCGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025827787 7:65024562-65024584 CTGGCCAACATGGCAAAACCTGG + Intergenic
1025915319 7:65861015-65861037 CTGGCCAACATGGCAAAACCTGG + Intergenic
1025955644 7:66180838-66180860 CTGGCCAACCTGGCAAAATCTGG - Intergenic
1025982496 7:66418363-66418385 CTGGCCGACATGGCAAAACCCGG - Intronic
1026354420 7:69544895-69544917 CTGGCCAACATGGCAAAACCTGG - Intergenic
1026898613 7:74024944-74024966 CTGGCCAACATGGTGAAATCCGG + Intergenic
1029177993 7:98678562-98678584 CTGGCCAACATGGTGAAATCCGG + Intergenic
1029259437 7:99291766-99291788 CTGGCCAACATGGCAAAACCTGG + Intergenic
1029586684 7:101477032-101477054 CTGGCCAACATGGTGAAATCTGG - Intronic
1031105887 7:117542354-117542376 CTGGCCAACATGGTAAAACCCGG + Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032893893 7:136229229-136229251 CTGACCAACATGGAAAAACCTGG + Intergenic
1033257251 7:139812864-139812886 CTGGCCATCATGGCAAAACCCGG + Intronic
1033422442 7:141216019-141216041 CTGGCCAACATGGTGAAATCCGG - Intronic
1034038873 7:147855594-147855616 CTGGCCAACATGGTAAAACCCGG + Intronic
1034109270 7:148520703-148520725 CTGGCCAACATGGCAAAACCCGG + Intergenic
1034868099 7:154657871-154657893 CTCTCCTCCATGGAAAAACTTGG + Intronic
1036004289 8:4644301-4644323 GAGGCCTCAATGAAAAAATCTGG - Intronic
1036155823 8:6340967-6340989 CTGACCTCCATGGCAGATTCTGG + Intergenic
1036476450 8:9097476-9097498 CTGGCCAACATGGTAAAAACCGG + Intronic
1036631814 8:10521210-10521232 CTGGCCAACATGGTAAAACCCGG + Intergenic
1038818604 8:30931775-30931797 CTGGCCAACATGGTAAAACCAGG - Intergenic
1039012189 8:33105960-33105982 CTGGCCAACATGGCAAAACCTGG - Intergenic
1039671005 8:39598575-39598597 CTGGCCAACATGGCAAAACCTGG + Intronic
1040057785 8:43075623-43075645 CTGGCCAACATGGTAAAACCTGG + Intronic
1040997085 8:53413184-53413206 CTGGCTGCCATGGTAAAATGGGG + Intergenic
1042536184 8:69860868-69860890 CTGGCCAACATGGTGAAATCCGG + Intergenic
1042606250 8:70549759-70549781 GTGGCATCTCTGGAAAAATCAGG + Intergenic
1043861321 8:85320403-85320425 CTGGCCAACATGGAGAAACCAGG + Intergenic
1044479239 8:92666117-92666139 TTGGCCAACATGGCAAAATCTGG - Intergenic
1045464310 8:102455562-102455584 CTGGCCAACATGGCAAAATCTGG - Intergenic
1046067228 8:109211400-109211422 CTGGCCTCCCTGGAAAAGAGAGG - Intergenic
1046271297 8:111901066-111901088 CTGGCCAACATGGTGAAATCCGG - Intergenic
1046325463 8:112638760-112638782 CTGGTCTCTATGGAAATTTCAGG - Exonic
1046447252 8:114339043-114339065 CTGGCCAACATGGCAAAACCTGG - Intergenic
1047375258 8:124289674-124289696 CTGGCCAACATGGCAAAAACCGG - Intergenic
1047993244 8:130308849-130308871 CTGGCCAACATGGTAAAACCTGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049570060 8:143365478-143365500 CTGGCATGCATGGAAGAAGCTGG + Intergenic
1050180207 9:2914391-2914413 CTGGCCTAGATGGAGAAATGTGG + Intergenic
1050655492 9:7823830-7823852 CTGGCCTCCAGGGAAACAGCTGG - Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1051163341 9:14233618-14233640 CTGGCCAACATGGCAAAACCCGG - Intronic
1051522638 9:18006969-18006991 TTGGATTTCATGGAAAAATCGGG + Intergenic
1052107215 9:24533726-24533748 CTGGCCAACATGGTAAAACCCGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052906452 9:33838889-33838911 CTGGCCAACATGGAGAAACCTGG + Intronic
1053238453 9:36476716-36476738 CTGGCCAACATGGTGAAATCCGG - Intronic
1054149946 9:61593937-61593959 CTGGCCAACATGGCAAAACCCGG - Intergenic
1055062482 9:72084280-72084302 CTGGCCTACATGGTGAAACCCGG + Intergenic
1055802302 9:80051963-80051985 CTGGGGTCCATGGTAAAGTCAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056365004 9:85895669-85895691 CTGGCCTTTTTGGAACAATCTGG + Intergenic
1056936790 9:90921214-90921236 CTGGGCTCCGTGGAAGAACCAGG - Intergenic
1059703883 9:116801894-116801916 CTCCCCTCCATGGGCAAATCAGG + Intronic
1060203468 9:121667200-121667222 CTGGCCAACATGGCAAAACCTGG - Intronic
1060213616 9:121725285-121725307 CAGGCGTCCATGGAAAGATTGGG + Intronic
1060245016 9:121938095-121938117 CTGGCCAACATGGTGAAATCCGG + Intronic
1060288258 9:122274464-122274486 CTGGCCAACATGGCAAAACCCGG + Intronic
1060626256 9:125114961-125114983 CTGGCCATCATGGCAAAACCCGG - Intronic
1061236679 9:129347229-129347251 CTGGCCAACATGGCAAAATCCGG - Intergenic
1061586531 9:131573106-131573128 CTGGCCAACATGGTAAAACCTGG + Intergenic
1203488108 Un_GL000224v1:77081-77103 TTTGCCTACATGGTAAAATCTGG + Intergenic
1203500729 Un_KI270741v1:18977-18999 TTTGCCTACATGGTAAAATCTGG + Intergenic
1185599953 X:1331989-1332011 CTGGCCAACATGGCAAAACCCGG + Intergenic
1185710484 X:2299662-2299684 CTGGCCAACATGGTGAAATCCGG + Intronic
1185879753 X:3730617-3730639 CTGGCCAACATGGCAAAACCCGG + Intergenic
1186394766 X:9196440-9196462 CCTGGCTCCATGGAAAAACCTGG + Intergenic
1186480103 X:9890174-9890196 CTGGCCAACATGGTAAAACCTGG + Intronic
1186820093 X:13279301-13279323 CTGGCCAACATGGTGAAATCTGG + Intergenic
1186920558 X:14274615-14274637 CTGGTCTTCATGCAAATATCAGG - Intergenic
1187434257 X:19252676-19252698 CTGGCCTGAATGGAAAGAACAGG + Intergenic
1187495113 X:19788931-19788953 CTGGCCAACATGGCAAAATCAGG + Intronic
1187798664 X:23034552-23034574 CTGGCCAACATGGCAAAACCTGG + Intergenic
1187835898 X:23432233-23432255 CTGGCCAACATGGTGAAATCCGG + Intergenic
1189735293 X:44063972-44063994 CTGGCCTTCATTGAATAGTCTGG - Intergenic
1189968046 X:46394175-46394197 CTGGCCAACATGGTGAAATCCGG + Intergenic
1190728014 X:53204194-53204216 CTGGCCTGCAAGGAAAGACCTGG - Intronic
1190983849 X:55483011-55483033 CTGTCTTCCATAGCAAAATCAGG + Intergenic
1191041205 X:56081956-56081978 CTGGCCTCATAGGATAAATCAGG + Intergenic
1192325686 X:70130028-70130050 CTCGCCTACAGGGGAAAATCAGG + Intergenic
1192581594 X:72287280-72287302 CTGGCCAACATGGCAAAACCCGG - Intronic
1193111552 X:77735269-77735291 CTGGCCAACATGGTGAAATCCGG + Intronic
1194792677 X:98170159-98170181 CTGGCCTCCAGGGAAGACTCTGG - Intergenic
1194944366 X:100050128-100050150 CTGGCCAACATGGCAAAACCTGG + Intergenic
1195118048 X:101719460-101719482 CTGGGCAACATGGCAAAATCCGG + Intergenic
1195650371 X:107277173-107277195 CTGGCCAACATGGCAAAACCCGG - Intergenic
1196099694 X:111834632-111834654 CTTGCCTCAGTGGAAAACTCAGG - Intronic
1197730791 X:129807627-129807649 CTGGCCAACATGGCAAAACCCGG + Intronic
1198744250 X:139873515-139873537 CTGGCCAACATGGCAAAAACAGG + Intronic
1200072922 X:153537878-153537900 CTGAGCTCCATGGCAGAATCGGG - Intronic