ID: 1096478160

View in Genome Browser
Species Human (GRCh38)
Location 12:51921218-51921240
Sequence CCAGTCCCAGACTCAGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 411}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096478152_1096478160 30 Left 1096478152 12:51921165-51921187 CCGGGACAGGATGCAAAAGAGGC 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1096478160 12:51921218-51921240 CCAGTCCCAGACTCAGAGCCCGG 0: 1
1: 0
2: 1
3: 41
4: 411
1096478153_1096478160 6 Left 1096478153 12:51921189-51921211 CCAGAGTCAGAGTGCCAAGCCAG 0: 1
1: 0
2: 1
3: 13
4: 239
Right 1096478160 12:51921218-51921240 CCAGTCCCAGACTCAGAGCCCGG 0: 1
1: 0
2: 1
3: 41
4: 411
1096478156_1096478160 -8 Left 1096478156 12:51921203-51921225 CCAAGCCAGGGAATCCCAGTCCC 0: 1
1: 0
2: 1
3: 22
4: 248
Right 1096478160 12:51921218-51921240 CCAGTCCCAGACTCAGAGCCCGG 0: 1
1: 0
2: 1
3: 41
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096478160 Original CRISPR CCAGTCCCAGACTCAGAGCC CGG Intronic
900110464 1:1003313-1003335 CCACCCCCACACTCAGAGCAAGG - Intergenic
900161268 1:1225101-1225123 CCCGTCCCAGCTTCAGAGCTCGG + Intronic
900513964 1:3072682-3072704 CCAGTCCCCTCCCCAGAGCCAGG + Intronic
900591847 1:3463639-3463661 CCAGCCTCATACTCGGAGCCCGG + Exonic
900715699 1:4142165-4142187 CAGGGCCCAGAGTCAGAGCCTGG - Intergenic
901828548 1:11878572-11878594 ACATTCCCAGCCCCAGAGCCAGG + Intergenic
901912640 1:12472951-12472973 CCAATACCAGACTCAAAGCAGGG - Intronic
901938757 1:12645880-12645902 CCAGTCCCACTCACAGAGCCTGG + Intronic
902736101 1:18402054-18402076 CCAGTCCCAAACTCAGAATTAGG + Intergenic
903360560 1:22774327-22774349 CCAGTGCCTGGCTCAGGGCCTGG + Intronic
903549516 1:24148171-24148193 CCAGACCCAGACTCCGGACCTGG - Intergenic
903675427 1:25061743-25061765 CCAGCCTCAGCTTCAGAGCCAGG + Intergenic
903967649 1:27100341-27100363 CCAGGCCCACACCCTGAGCCTGG - Exonic
904447754 1:30588583-30588605 CTAGTCCCAGGCCCAGTGCCGGG - Intergenic
904460276 1:30673061-30673083 TCTGTCCCAAACTCAGCGCCAGG + Intergenic
904492190 1:30868033-30868055 CCAGTTCCAAGCACAGAGCCAGG + Intergenic
904802479 1:33103696-33103718 CCAGCACCAGACACAGTGCCTGG + Intronic
904926453 1:34052725-34052747 TCAGTCCCTGGCTCAGTGCCTGG + Intronic
905479486 1:38251323-38251345 CCTGTCCCTCACACAGAGCCTGG - Intergenic
905817719 1:40965048-40965070 CCTGTTCCAGACTCTGTGCCAGG - Intergenic
907042639 1:51277185-51277207 CCAACCCCAGAATTAGAGCCAGG + Intergenic
907308654 1:53527328-53527350 CGAGCCCCACACTGAGAGCCTGG + Intronic
907714698 1:56916092-56916114 CCAGTGCCAGGCTCAGTGGCAGG + Intronic
907927605 1:58969172-58969194 CCAGTGCCAATCTCAGTGCCTGG - Intergenic
912209673 1:107544517-107544539 CCAGTGCCAGAAACAGTGCCTGG - Intergenic
912522460 1:110255141-110255163 CCAGTGCCTGGCACAGAGCCTGG + Intronic
912915748 1:113812535-113812557 CCACTCCTCCACTCAGAGCCGGG - Intergenic
913537036 1:119782983-119783005 CCAGGCTCAGACTCTGAGGCAGG - Intergenic
914286978 1:146236222-146236244 TCAGTCCCTGACTCAGACCCTGG + Intergenic
915447740 1:155983677-155983699 CTAATCCCAAACCCAGAGCCAGG + Intronic
915937531 1:160098201-160098223 CCAGTCCCTGGCTTAGAGCTGGG + Intronic
916719577 1:167474193-167474215 CCACCCCCAGACTCAGAGCCAGG - Intronic
917449833 1:175138288-175138310 CCAGTGCCTATCTCAGAGCCTGG + Intronic
917980781 1:180267556-180267578 CAAATCCCAAATTCAGAGCCAGG - Intronic
919709010 1:200707758-200707780 CCTGTCCCTGACTCAGGCCCTGG - Intergenic
920200980 1:204259516-204259538 CCGGAGCCAGCCTCAGAGCCGGG - Exonic
920275305 1:204800012-204800034 CTAGTCCCAAGCCCAGAGCCAGG - Intergenic
920822499 1:209394172-209394194 CCAGTCCCAGATTCAAGGGCTGG + Intergenic
921065266 1:211618072-211618094 CAAGTGCTAGGCTCAGAGCCTGG - Intergenic
921600184 1:217098472-217098494 CCAGTCTCATACTGAGATCCGGG + Intronic
922033244 1:221824694-221824716 CCAGTCCCAGGCTGAGAAGCTGG - Intergenic
922423576 1:225475044-225475066 CCAATCCCAAACTGAGAGGCCGG + Intergenic
1063100413 10:2945317-2945339 AGGGTCCCAGAGTCAGAGCCAGG + Intergenic
1063455924 10:6182690-6182712 CCAGGCTAAGAATCAGAGCCTGG + Intronic
1064028593 10:11869186-11869208 CCTGTCCCAGCCTCAGGGGCTGG + Intronic
1064996024 10:21297287-21297309 GCAGTTCCAGACGCAGAGCTTGG - Intergenic
1065004088 10:21363583-21363605 CCAGTTCCAAGCTCAGTGCCTGG - Intergenic
1065560816 10:26962107-26962129 CCAGTCAAAGGCTCAGACCCTGG + Intergenic
1065876104 10:29998761-29998783 CCAAGCCCAGCCTCGGAGCCAGG - Intergenic
1067166350 10:43869164-43869186 CTTGTCCCAGAGTCAGAGCCTGG + Intergenic
1068514171 10:58005395-58005417 CCAGAGCCTGACACAGAGCCTGG + Intergenic
1069905104 10:71727557-71727579 CCAGTTCCTGCCTCAGAGACCGG + Intronic
1070568264 10:77620237-77620259 CCAGGCCCAGCCTCTGAGGCTGG - Intronic
1070715799 10:78720118-78720140 CCAGACCCAGGCTCAGGGCTGGG + Intergenic
1070746645 10:78937778-78937800 CCACACCCAGGCTCAGAGCCTGG - Intergenic
1071275894 10:84054721-84054743 CCAGTCCCAGGCCTAGAGCCTGG + Intergenic
1072523356 10:96249718-96249740 CCAGACCCAGCCTCAGATTCAGG - Intronic
1072640189 10:97205781-97205803 CCAGAGCCACACACAGAGCCTGG - Intronic
1072755796 10:98019891-98019913 CCACTCCCCGACTCAGATTCAGG - Intronic
1074224741 10:111473580-111473602 CTAGGCCGTGACTCAGAGCCAGG + Intergenic
1075257033 10:120933497-120933519 CAAGTCCCAAACTCATAGCCTGG + Intergenic
1076091273 10:127688286-127688308 CCAGTCCTGGACACAGAGCAGGG - Intergenic
1076534813 10:131170045-131170067 CCAGTCACAGACACACACCCCGG + Intronic
1077097178 11:803993-804015 CCAGTCCCAGCCCCAGCTCCAGG - Intronic
1077320110 11:1937263-1937285 CCAGTGCCAGACTCGGGGCGAGG - Intronic
1077336599 11:2007780-2007802 TCAGGCCCAGCCCCAGAGCCGGG + Intergenic
1077599252 11:3562199-3562221 CCAGAGCCAGAGCCAGAGCCAGG + Intergenic
1078363500 11:10688347-10688369 CCACCTCCTGACTCAGAGCCCGG + Intronic
1078408897 11:11095326-11095348 CCAGCACCAGACTCACAGCCAGG - Intergenic
1079321332 11:19454069-19454091 TAAGTTGCAGACTCAGAGCCCGG - Intronic
1080034976 11:27700767-27700789 CCAGCCCCAGCCTCAGCCCCGGG + Intronic
1080785229 11:35469369-35469391 TCAGTCCCAGATTCACAGACTGG + Intronic
1082783458 11:57303629-57303651 CCAGCACCTGACCCAGAGCCTGG + Intronic
1083431852 11:62617298-62617320 ACTGTCCCAGACACTGAGCCTGG - Exonic
1083488594 11:62998797-62998819 CCAGTCCCAGAGTCAGGGAAGGG - Intronic
1083638658 11:64133693-64133715 CCAGTCCCTGACTCTCAGACAGG + Intronic
1084264629 11:67998477-67998499 CCAGACTCAGGCACAGAGCCAGG + Intronic
1084817599 11:71658494-71658516 CCAGAGCCAGAGCCAGAGCCAGG - Intergenic
1086599412 11:88614211-88614233 CCTGTCCAAGCCACAGAGCCAGG - Intronic
1087056845 11:93945149-93945171 TCAGTCCCTGACTCAGACCCTGG - Intergenic
1087190758 11:95251864-95251886 CAAGTCCCAGACTCCCAGCAGGG + Intergenic
1088725914 11:112634559-112634581 CTAGTGTCATACTCAGAGCCTGG + Intergenic
1089647309 11:119888850-119888872 CCAGAGCCAGACCCAGACCCTGG + Intergenic
1090207641 11:124894775-124894797 CCACTCCCTGACTCACAGCCTGG + Intronic
1091077434 11:132633558-132633580 CCAGGCTCAGACCCAGGGCCTGG - Intronic
1202819583 11_KI270721v1_random:62962-62984 TCAGGCCCAGCCCCAGAGCCGGG + Intergenic
1091630677 12:2158327-2158349 CCAGTACCAGAGGCAGAGGCGGG + Intronic
1091716906 12:2784073-2784095 CCAGTGCCTGGCACAGAGCCTGG + Intergenic
1092425394 12:8371541-8371563 CCAGAGCCAGAGCCAGAGCCAGG + Intergenic
1093666442 12:21818906-21818928 AGTGTCCCAGACTCTGAGCCAGG - Intronic
1094412299 12:30179377-30179399 CTAGTTCCAGAATCAGAGCCTGG - Intergenic
1095991139 12:48035460-48035482 CCACTCCCAGACTCAGGCACAGG - Intergenic
1096478160 12:51921218-51921240 CCAGTCCCAGACTCAGAGCCCGG + Intronic
1097187025 12:57201554-57201576 CCGGTCGCAGACCCAGACCCGGG - Exonic
1099564855 12:84230277-84230299 CTAGTCCCTGACTCACAGACAGG - Intergenic
1100615090 12:96225279-96225301 CAAGTCCCAGACACAGAGGGAGG - Intronic
1101555589 12:105805896-105805918 ACAGTGCCAGACTCTGTGCCAGG - Intergenic
1102573602 12:113842515-113842537 CCAGTCTGAGACTGGGAGCCTGG + Intronic
1102629523 12:114265518-114265540 CAAGTCCCAGAGTAAGAGGCTGG - Intergenic
1102760352 12:115379801-115379823 ACAGACCCAGACTCAAATCCCGG - Intergenic
1103083894 12:118046619-118046641 CCAGTGCCAGGGCCAGAGCCAGG - Intronic
1103993495 12:124814653-124814675 CCAGCCCCAGTCCCAGAGGCGGG + Intronic
1104219393 12:126767344-126767366 CCAGTCCCAGAGTCATGGGCCGG + Intergenic
1104885065 12:132102422-132102444 CAAGTCCCAGATTCAGGGGCAGG + Intronic
1105997029 13:25682347-25682369 GAAGTCCCAGACTCAGACTCAGG - Intronic
1106035531 13:26041318-26041340 CCAGGCCCAGACCCAGACCCAGG + Intergenic
1106546570 13:30735895-30735917 CCAGTCCCATTTTTAGAGCCAGG + Intronic
1107877132 13:44800693-44800715 CCATTCTGACACTCAGAGCCTGG - Intergenic
1110617334 13:77555521-77555543 CCAGCACCAGGCTCAGTGCCAGG + Intronic
1111075111 13:83224592-83224614 CCATTCCCAGACTGAGCACCTGG - Intergenic
1111738823 13:92176365-92176387 CTTGTCCCAGTCTCAGTGCCTGG - Intronic
1112588577 13:100742699-100742721 CCAGTGCTAGATTCAAAGCCTGG - Intergenic
1113450547 13:110406328-110406350 GCAGTCCCAGGCTGAGAGCCCGG + Intronic
1114047845 14:18892651-18892673 CCAGGCCCAGACCCTCAGCCAGG + Intergenic
1114116371 14:19626755-19626777 CCAGGCCCAGACCCTCAGCCAGG - Intergenic
1118883499 14:69848556-69848578 CCAGTCCCCTTCTCTGAGCCGGG + Intergenic
1119163939 14:72476762-72476784 AGAGTCCCAGGCACAGAGCCCGG + Exonic
1120082716 14:80233941-80233963 ACTGTCCCAGACTTAGAGGCAGG + Intronic
1121040205 14:90740185-90740207 CTAGTTCCAGACCCAGAGGCGGG - Intronic
1121117319 14:91352899-91352921 CCAGGCACAGGCTCAGAGTCCGG - Intronic
1121708189 14:96016951-96016973 CCTGGCCCAGACTGAGTGCCTGG - Intergenic
1202929917 14_KI270725v1_random:27474-27496 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
1123442614 15:20302573-20302595 CCAGGGCCAGAGTCAGGGCCAGG - Intergenic
1123939340 15:25209269-25209291 CACCTCCCAAACTCAGAGCCAGG - Intergenic
1123986716 15:25652814-25652836 CCACTCCAGGCCTCAGAGCCTGG + Intergenic
1123997639 15:25729878-25729900 CCAGTGCCTACCTCAGAGCCTGG + Intronic
1124959220 15:34382396-34382418 GCAGTCCCAGCCTCAGGGACTGG - Exonic
1124975846 15:34528617-34528639 GCAGTCCCAGCCTCAGGGACTGG - Exonic
1127687011 15:61356057-61356079 TCATTCCCAAACTCACAGCCAGG - Intergenic
1129185853 15:73906006-73906028 CCAGTCCCTTGCTGAGAGCCTGG - Intergenic
1132410297 15:101572795-101572817 GCAGCCCCAGCCCCAGAGCCTGG + Intergenic
1132569404 16:637488-637510 GGGGTCCCAGCCTCAGAGCCGGG + Intronic
1132939415 16:2499527-2499549 CCAGATCCAGAGTCAGAGCGTGG + Intronic
1133164247 16:3935480-3935502 CCAGGCCCTGCCTCAGATCCAGG - Intergenic
1133372954 16:5259374-5259396 CCAGAGCCAGAGCCAGAGCCAGG - Intergenic
1134108364 16:11499498-11499520 TCAGGCACTGACTCAGAGCCAGG - Intronic
1135389690 16:22080242-22080264 CTAGTCCCTGACACAGTGCCAGG - Intronic
1137674162 16:50295797-50295819 CCCCACCCAGACTCAGGGCCTGG - Intronic
1137768011 16:50992690-50992712 CCTGTTCCACACTCAGAGCCAGG - Intergenic
1138106709 16:54290952-54290974 ACAGTCACAGACTCAGGGCGAGG - Intergenic
1138383165 16:56617601-56617623 GCATTCCCAGGCGCAGAGCCGGG - Intergenic
1138537754 16:57668718-57668740 CCAACCCCTGTCTCAGAGCCAGG - Intronic
1139235361 16:65332709-65332731 CAAGTCACTGACACAGAGCCAGG - Intergenic
1141595079 16:85092448-85092470 CCAGCCCCAGCCTCAGGGACGGG + Exonic
1141620893 16:85235995-85236017 CCAGGCCCAGCCTCAGCCCCAGG - Intergenic
1141714528 16:85719153-85719175 CCTGGCCCAGGCTCAGAGCTGGG - Intronic
1141741637 16:85897294-85897316 CCAGTCTCAGCCTCTCAGCCTGG - Intergenic
1141926142 16:87170908-87170930 CCTGGCACCGACTCAGAGCCAGG - Intronic
1142126361 16:88412542-88412564 CCAGACCCAGCCATAGAGCCAGG + Intergenic
1144025446 17:11272667-11272689 CTAATCCCTGGCTCAGAGCCTGG + Intronic
1144425858 17:15141689-15141711 TCCTCCCCAGACTCAGAGCCTGG + Intergenic
1144695480 17:17301318-17301340 CCAGTCCCAGTACCAGAGCGGGG + Intergenic
1145758044 17:27407221-27407243 CCGGTCCCAGTTTCAGAGCTGGG - Intergenic
1146455540 17:33006683-33006705 CCAGTACCTAACTCAGTGCCTGG + Intergenic
1146508327 17:33424501-33424523 CCAGTCACAGAGCCAGAGCTGGG - Intronic
1146509044 17:33430066-33430088 CCAGTCCCATCCCCAGAACCAGG + Intronic
1146793492 17:35765906-35765928 CCAGCCCCAGACAAAAAGCCAGG + Intronic
1146839935 17:36144310-36144332 CCAGTCATTGCCTCAGAGCCTGG - Intergenic
1147168898 17:38606793-38606815 CCGGACCCAGACCCAGACCCAGG + Intergenic
1147454308 17:40526748-40526770 TCAGTCCCAGAGAGAGAGCCAGG - Intergenic
1147746099 17:42695619-42695641 CCAGTGCCAGGCTATGAGCCTGG + Exonic
1147748635 17:42712192-42712214 CCAGACCCAGACACACAGCCTGG + Intronic
1149600820 17:57891982-57892004 CCAGTGCCCGAATCAGTGCCTGG + Intronic
1149682658 17:58517052-58517074 CTACTCCCAGACTCAGAGACTGG - Intronic
1149864495 17:60143211-60143233 CCAGTGGGAGAATCAGAGCCTGG - Intergenic
1149988138 17:61363974-61363996 CCTGTCCCAGAGTGAGAGCAAGG - Intronic
1150554265 17:66239637-66239659 CCAGTCCCAGTGTGAGAGTCTGG + Intronic
1151323558 17:73365683-73365705 CTTGTCCCACACTCATAGCCCGG - Intronic
1151371369 17:73648250-73648272 CCAGTCCCCGACACAGATCCGGG - Intergenic
1151408142 17:73902658-73902680 CCGGTGACAGACACAGAGCCGGG - Intergenic
1151519387 17:74617423-74617445 GCAGTGCCAGTCACAGAGCCGGG + Exonic
1151758495 17:76087992-76088014 CCAGGCCCAGGCCCAGGGCCAGG - Intronic
1152387819 17:79985587-79985609 CCAGCACCAGTCTCAGGGCCTGG - Intronic
1152767721 17:82150059-82150081 CCAGGCACACACTCAGAACCTGG + Intronic
1152767820 17:82150509-82150531 CCAGGCGCACACTCAGAACCTGG + Intronic
1152767856 17:82150689-82150711 CCAGGCACACACTCAGAACCAGG + Intronic
1152767870 17:82150761-82150783 CCAGGCGCACACTCAGAACCTGG + Intronic
1152767938 17:82151067-82151089 CCAGGCGCACACTCAGAACCTGG + Intronic
1152779413 17:82219659-82219681 CAAGTCCGAGACTGAGAGGCGGG - Intergenic
1153146507 18:2039000-2039022 CCAGTACCAGATCCAGTGCCAGG + Intergenic
1153321072 18:3774802-3774824 CCAGTCCCAGTCTCTCATCCTGG + Intronic
1153637776 18:7128076-7128098 CCAGCTCAAGGCTCAGAGCCTGG + Intergenic
1154290395 18:13101718-13101740 CAAGTGCCAGGCTCAGAGCGGGG - Intronic
1156449676 18:37259735-37259757 CCAATCCCAGAGTCTGAGACTGG - Intronic
1156680438 18:39582058-39582080 CCAATGGCAGAGTCAGAGCCAGG - Intergenic
1156795313 18:41037944-41037966 CTAGTCCCAATCTCACAGCCTGG - Intergenic
1157453156 18:47802858-47802880 CCAACCCCAGCCTCAGGGCCCGG + Intergenic
1159959240 18:74542433-74542455 CCAGTGCCAGGCTCAGTGCTGGG - Intronic
1160042522 18:75358855-75358877 CCTGTGCCAGACTCTGAGTCTGG + Intergenic
1160281906 18:77498948-77498970 CCAGTACCAGAACCAGAACCAGG - Intergenic
1161061187 19:2215904-2215926 CCCCTCTCAGACTCAGCGCCCGG + Intronic
1161097162 19:2399075-2399097 CCAGGCCCAGGCTCAGCGTCTGG - Exonic
1161435650 19:4261274-4261296 CCACTCCCAGAATTAGAGACCGG + Intronic
1161613115 19:5254715-5254737 CCCCTCTCAGACTCTGAGCCCGG - Intronic
1161756068 19:6135286-6135308 CCACTCCCAGACTCCCTGCCTGG + Intronic
1161913458 19:7211942-7211964 CAAGTCACAGACTCAGACTCTGG + Intronic
1162386980 19:10365599-10365621 CCAGCAGCAGACTCAGGGCCAGG + Exonic
1162562254 19:11423487-11423509 CCAGTACCATCCTCAGATCCTGG - Intronic
1162736696 19:12750868-12750890 ACAATCCCAGGCTCAGAGCGGGG - Intergenic
1163322191 19:16581366-16581388 CCAGTCCCAGACAGACAGCAAGG + Intronic
1163373455 19:16915275-16915297 CCATTCCCAGGCTCAGAAACTGG - Intronic
1163555986 19:17993146-17993168 CCAACCCCAGCCTCAGAGGCGGG + Intronic
1163635910 19:18437215-18437237 TCAGTTCCAGGCTCACAGCCAGG + Intronic
1163700674 19:18785205-18785227 CCATTCCCACTCGCAGAGCCCGG + Intronic
1163725702 19:18922013-18922035 CCAGGCCCAATGTCAGAGCCTGG + Intronic
1163845018 19:19633861-19633883 CCAGTCCTAGCCTCAGACCCCGG - Exonic
1163991434 19:21002487-21002509 CCAGTGCCACACCCTGAGCCTGG + Intergenic
1164625197 19:29723258-29723280 GCAGTTCCAGACTCTGAGCCTGG - Intergenic
1164913401 19:32030194-32030216 GCAGTCCCCGACCCAGACCCAGG + Intergenic
1165305299 19:34999841-34999863 CCTCTCCCAGTCTCTGAGCCCGG - Intronic
1166693824 19:44840941-44840963 CCTGTCTCAGAATAAGAGCCGGG + Intergenic
1166746607 19:45144850-45144872 CCAGCCGCACACTCAGAGCCTGG + Exonic
1167418857 19:49390990-49391012 CAAGTCCCCGAGTCACAGCCTGG - Intronic
1168581691 19:57560247-57560269 CCAGTCCCAGGGACAGTGCCTGG - Intergenic
926112069 2:10189840-10189862 CCAGTTCCTGGCCCAGAGCCTGG + Intronic
926205682 2:10833141-10833163 GCTGTCCCTGACACAGAGCCTGG - Intronic
926640426 2:15230047-15230069 TCAGTCCCAAACTCATAACCTGG - Intronic
927185152 2:20477049-20477071 TCAGTCCCTGACCCAGAGTCAGG + Intergenic
927520009 2:23692967-23692989 CCAGGCCCAGGCTCTGAGCAGGG + Intronic
927812922 2:26190160-26190182 CCAGTCCCAGCTACAGAGCTGGG + Intergenic
928268469 2:29832752-29832774 GCAGTGCCTCACTCAGAGCCTGG - Intronic
930747363 2:54898436-54898458 CCAGCCCCAGAGTCACAGTCAGG - Intronic
931249940 2:60521368-60521390 CCATTCCCAGACCCAGGCCCAGG - Intronic
931582230 2:63789379-63789401 CCAGTGCCTGGCTCAGAACCTGG + Intronic
931757914 2:65390380-65390402 CCAGTCCCACAGTCATTGCCAGG - Intronic
932128355 2:69165496-69165518 CCAGTCCCAGTCACAGAGTGAGG + Intronic
932325804 2:70860821-70860843 CCAGTCCCAGAGGCCAAGCCAGG + Intergenic
932465990 2:71924662-71924684 TCAGACCCGGACTCAAAGCCTGG + Intergenic
932570165 2:72934358-72934380 CCAGCTCCAGCCCCAGAGCCTGG + Exonic
932817636 2:74874489-74874511 CCAGCCCCAGACTCAGCTCCAGG - Intronic
933806199 2:85999612-85999634 CCAGTCCCAGGATCAGGGCAAGG - Intergenic
934460811 2:94213014-94213036 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
934660837 2:96142913-96142935 CCCGTCCGTGACTCAGAGCCAGG - Intergenic
934769589 2:96899367-96899389 CCAGTACCTGGCACAGAGCCTGG + Intronic
936533536 2:113293208-113293230 CCAGTCCCAGAGACAGACTCTGG - Intergenic
936576963 2:113665290-113665312 CCTGAGCCAGACACAGAGCCAGG - Intergenic
937301573 2:120845990-120846012 CCAGTTACAGACCCAGATCCTGG - Intronic
937961823 2:127465960-127465982 CCAGACCTAGCCTCAGATCCTGG - Intronic
938388339 2:130883627-130883649 CCTGGCCCAGTCACAGAGCCAGG + Intronic
940458746 2:153935768-153935790 CTAGATCCAGAATCAGAGCCTGG - Intronic
941398497 2:165001321-165001343 CAAGTCCCAGACTCCTATCCAGG + Intergenic
946002775 2:216496663-216496685 CCTGGCCCAGACTGAGTGCCAGG + Intergenic
946113052 2:217437180-217437202 CCAGGGCCATACTCTGAGCCAGG - Intronic
946252927 2:218424345-218424367 CCTGCCCCTGACTCACAGCCAGG - Exonic
946412432 2:219522049-219522071 CCAGCCCCAGCCTAGGAGCCAGG - Intronic
947924160 2:233906434-233906456 CCAGTGCCAGAAGCAGAGACTGG - Intergenic
948831827 2:240602045-240602067 CCAGTCACAGGCTCAGAGACCGG + Intronic
949039945 2:241843642-241843664 CCTCACCCAGACTCAGAGCGAGG + Intergenic
1169204750 20:3733245-3733267 CAGGTCCCAGCCTCAGACCCTGG - Intronic
1170894347 20:20400280-20400302 CCAAACCCAGAGTCAGAGCCAGG - Intronic
1171205303 20:23274386-23274408 CCATTCTCAGACTCAGACCTGGG - Intergenic
1171302562 20:24076423-24076445 GCAGTCCCAGCCTCAGAGAGGGG - Intergenic
1172312251 20:33927711-33927733 CCAGACCCACAGACAGAGCCTGG - Intergenic
1172774193 20:37397748-37397770 CAAGCCGCAGACTCAGGGCCTGG + Exonic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1173926054 20:46782168-46782190 CCAGTGCCTGGGTCAGAGCCTGG - Intergenic
1174408067 20:50315750-50315772 CCAGCACCTGGCTCAGAGCCTGG - Intergenic
1174415159 20:50361184-50361206 CCCCACCCAGAATCAGAGCCAGG - Intergenic
1174506153 20:51018897-51018919 CCAGTCCCTGACTCACTGCAAGG - Intronic
1174635462 20:51995823-51995845 CCAGCCCCAGACTCTGCCCCTGG - Intergenic
1175379736 20:58554549-58554571 CCGGTCCCTGACACAGTGCCAGG - Intergenic
1175997193 20:62817156-62817178 CCACGTCCAGCCTCAGAGCCCGG - Intronic
1176591937 21:8656056-8656078 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
1179594156 21:42430925-42430947 ACATTCCCAGCCCCAGAGCCAGG - Intronic
1179599054 21:42463691-42463713 CCAGCCCCAGGCACAGTGCCTGG + Intergenic
1179638659 21:42732194-42732216 CCAAGGCCAGCCTCAGAGCCTGG - Intronic
1180274785 22:10633185-10633207 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
1180832882 22:18915024-18915046 CCAGCCCCAAACTTAGAGGCTGG - Intronic
1180839060 22:18950290-18950312 CCAGTGGCACAGTCAGAGCCGGG + Intergenic
1181066940 22:20311228-20311250 CCAGCCCCAAACTTAGAGGCTGG + Intergenic
1181328610 22:22071037-22071059 TCACTCCTAGACTCTGAGCCGGG - Intergenic
1181534232 22:23533463-23533485 GCAGGCCTAGACACAGAGCCGGG + Intergenic
1181557034 22:23677121-23677143 CAACTCCCAAACTCAGAGGCAGG + Intergenic
1181645734 22:24231094-24231116 CCAGTCCCAGACACAGAAGCAGG - Intronic
1181967015 22:26663898-26663920 CCAGTCCCAGCCCCAGTCCCAGG + Intergenic
1183066492 22:35367079-35367101 CCAATCCCAGTCTTAGAGTCTGG + Intergenic
1183086674 22:35491276-35491298 CCTGTCCCAGACTCAGTGGAGGG + Intergenic
1183309453 22:37101555-37101577 CCAGTCCCAGGAGCACAGCCTGG + Intronic
1183442768 22:37832601-37832623 ACAGGCCCAGACCCAGGGCCTGG - Intronic
1183529175 22:38343476-38343498 ACAGTCCCAGGCGCAGAGCAAGG - Intronic
1183591227 22:38780384-38780406 CCAGGCCCAGGTTCAGATCCTGG - Intronic
1183609040 22:38884804-38884826 CCTGTCCCAGAGTCTGAGGCTGG - Intergenic
1184421003 22:44382902-44382924 CGACTCCCAGACTGAGAGCACGG + Intergenic
1184432533 22:44449867-44449889 CCAGTGCCTGGCCCAGAGCCTGG + Intergenic
1185012299 22:48321009-48321031 CCAAACCCAGACTCGGAGGCAGG + Intergenic
1185423277 22:50747384-50747406 CCTGAGCCAGACACAGAGCCAGG + Intergenic
1203282967 22_KI270734v1_random:140328-140350 CCAGCCCCAAACTTAGAGGCTGG - Intergenic
949875056 3:8621201-8621223 CCTGTCCCAGACTCAGATGTGGG + Intronic
950407913 3:12816109-12816131 CCAATCCCAGGCTCAGTCCCTGG + Intronic
952879027 3:37971514-37971536 CCAGCCCCACACTCCCAGCCTGG + Intronic
953263930 3:41367557-41367579 GGAATCCCAGACTCAGGGCCAGG - Intronic
953998872 3:47540849-47540871 CCAGTCTCAGTCCCAGAGCCTGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954283308 3:49600223-49600245 CCAGGCCCAGGCTCAAGGCCTGG - Intronic
954292073 3:49655047-49655069 CCAGGCCCAGTGCCAGAGCCAGG + Exonic
955210817 3:56939198-56939220 CCATTCCCAGATTCAGACACAGG + Intronic
959108492 3:102093744-102093766 CCAGTGCCTAGCTCAGAGCCTGG + Intergenic
959888457 3:111528204-111528226 CCCCTCCCATACTCAGAGTCTGG - Intronic
960148368 3:114227230-114227252 ACAGTCCCAGAGGCAGAACCTGG - Intergenic
961284015 3:125785684-125785706 CCAGAGCCAGAGCCAGAGCCAGG - Intergenic
961481246 3:127182650-127182672 CCAACCCCAGACCCAGGGCCAGG + Intergenic
961507439 3:127379379-127379401 CCAGACCCAAACCCAGAGCCTGG + Intergenic
962835592 3:139185750-139185772 CCAGTCTCAGCTGCAGAGCCGGG + Intronic
962982862 3:140506534-140506556 CCAGTAACAGAGTAAGAGCCTGG + Intronic
963971046 3:151429771-151429793 CTAATCCCACCCTCAGAGCCCGG - Intronic
964790901 3:160452682-160452704 GCTGTCCCAGACACTGAGCCTGG + Intronic
966718537 3:183038077-183038099 CCAGTGCCTGGATCAGAGCCTGG - Intronic
966924487 3:184635442-184635464 CCAGTGTCAGAGTCAGATCCTGG - Intronic
967494436 3:190127171-190127193 CCAGAGCCAGACTCAGTTCCTGG - Intergenic
968323498 3:197791700-197791722 CCTGCGCCAGACCCAGAGCCTGG + Intronic
968447035 4:657347-657369 CCAGTCCCTGACACAGTTCCTGG + Exonic
968752920 4:2399535-2399557 CAAGTCCCAAGCTCAAAGCCTGG + Intronic
968844076 4:3030156-3030178 CCAGCACCAGGCCCAGAGCCAGG - Intronic
968973914 4:3811276-3811298 CGAGTGCCAGGCTCAGAGGCAGG - Intergenic
969013688 4:4088504-4088526 CCAGAGCCAGAGCCAGAGCCAGG + Intergenic
969104038 4:4791552-4791574 CCGGTCCCAAACTCTGGGCCTGG - Intergenic
969497715 4:7535430-7535452 ACAGGGCCAGACTCAGACCCAGG - Intronic
969657835 4:8508354-8508376 CCAGACCCACCCTCAGGGCCCGG - Intergenic
970098212 4:12488930-12488952 ACAGTGCCAGAGCCAGAGCCAGG + Intergenic
972841467 4:42934933-42934955 CCAATTCCAGACTCAAATCCTGG - Intronic
973774001 4:54229458-54229480 CCAGTCCCAGAGTCTGATCAGGG - Intronic
976856329 4:89609440-89609462 CCAGTCCCAGAGTCAGCACTTGG - Intergenic
983388843 4:167102822-167102844 CAAGTCCTAGGCTCAGAGACAGG + Intronic
984024590 4:174527932-174527954 ACAGGCCCAGGCTCAGAGGCAGG + Intergenic
984756647 4:183331166-183331188 CTAGTGCCAGCCTCAGGGCCAGG + Intergenic
985017411 4:185651038-185651060 GCAGTGCCAGCCTCCGAGCCTGG + Intronic
985779856 5:1864836-1864858 TAAGTCCCAGGGTCAGAGCCAGG - Intergenic
985823771 5:2178447-2178469 CCAGGCCCAGGGTCAGGGCCTGG - Intergenic
986437455 5:7748035-7748057 CCAGGCCCAGATGCAGAGGCTGG - Intronic
987421742 5:17728867-17728889 CCAGATCCAGACCTAGAGCCTGG - Intergenic
992894200 5:81232897-81232919 CCAGCCCCTGGCTCAGGGCCCGG + Intergenic
995248731 5:109965020-109965042 AAAGTCCCAGAGTCAGAACCAGG + Intergenic
997304871 5:132829873-132829895 CCAGTCGCACACTCGGAGCGTGG - Intronic
997457266 5:134026633-134026655 CCTGGCCCAGTCTTAGAGCCAGG + Intergenic
997635251 5:135399539-135399561 ACAGTCCCGTGCTCAGAGCCAGG - Exonic
997724811 5:136111789-136111811 TTAGTCCCAGGCTCAGAGCTTGG + Intergenic
997806677 5:136924676-136924698 CCAGTCCCAGGTCCAGAGCCTGG - Intergenic
998162863 5:139823188-139823210 CCAGACACAGCCTCACAGCCTGG - Intronic
998862645 5:146459156-146459178 CCAGGCCCAGGCTCAGGTCCAGG + Exonic
999047098 5:148481286-148481308 CCAGCCACAGAGTCAGAGTCAGG + Intronic
1001128662 5:169044853-169044875 CCAGGCCCAGAAACAGAGCTGGG - Intronic
1001278616 5:170369555-170369577 CCAGGCCCTGGCACAGAGCCTGG + Intronic
1001310805 5:170608939-170608961 ACAGAGCCCGACTCAGAGCCAGG - Intronic
1001357238 5:171040329-171040351 AAAGTCTCAGAGTCAGAGCCAGG + Intronic
1001514089 5:172342868-172342890 GCAGCCACAGACTCAGCGCCAGG + Intronic
1001683891 5:173578075-173578097 CCAGACTCAGATTCAGAGCCAGG - Intergenic
1002461913 5:179378112-179378134 CGAGTGCCTGACGCAGAGCCAGG + Intergenic
1003108301 6:3231821-3231843 TGAGTCCTAGACACAGAGCCAGG + Intronic
1004518852 6:16343697-16343719 CCAGTCCCTGATTCAGAGGGTGG - Intronic
1004580438 6:16946166-16946188 GCAGCCCCAGACACAGAGCTGGG - Intergenic
1004982809 6:21045437-21045459 CTAGCCCCTGACTCAGAGTCAGG - Intronic
1006223777 6:32519067-32519089 ACAGTCTCAGACCCAGAGGCAGG + Intronic
1006230367 6:32581254-32581276 TCAGTCTCAGACCCAGAGGCAGG + Intronic
1006379615 6:33689944-33689966 CCAGTGCCCAGCTCAGAGCCTGG - Intronic
1006440908 6:34053230-34053252 GCAGAGCCAGACTCAGACCCAGG + Intronic
1006510899 6:34520481-34520503 GCAGAGCCAGACTCAGACCCAGG - Intronic
1006843550 6:37047531-37047553 CCAGACAGAGCCTCAGAGCCAGG - Intergenic
1007324265 6:41048361-41048383 CCAATCCCAGCCTCAGACTCTGG + Intronic
1007448982 6:41928878-41928900 AAAGTCCCAAACTCAGTGCCTGG + Intronic
1007707382 6:43799167-43799189 CTATTCACAGACTCAGAGCCTGG + Intergenic
1007777798 6:44233468-44233490 CCAGTGCCAGACCCAGACACAGG - Exonic
1008394065 6:50986438-50986460 CCACTGTCATACTCAGAGCCAGG + Intergenic
1010042498 6:71402280-71402302 TCAGTTCCAGACCCAGGGCCTGG + Intergenic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1012858128 6:104527354-104527376 CCCTTCTCAGACTCAGAGCACGG + Intergenic
1013470390 6:110458862-110458884 TCAGTCCCAGACTGAAGGCCTGG - Intronic
1014234698 6:118940806-118940828 CCAGTCCCTGGCTCAGGGACAGG + Intergenic
1015386655 6:132632459-132632481 CCCGTCCCTGCCACAGAGCCTGG - Intergenic
1016466559 6:144331308-144331330 CCACTGTCAGCCTCAGAGCCTGG + Intronic
1017862136 6:158408652-158408674 CGAGGCCCGGAGTCAGAGCCAGG + Intronic
1017929442 6:158939301-158939323 CTTGTCCCAGACACTGAGCCAGG - Intergenic
1018455610 6:163949281-163949303 CCAGTTACAAACTCTGAGCCTGG - Intergenic
1019032337 6:169024223-169024245 CCAGGCCCAGACTCAGCCCATGG - Intergenic
1019629612 7:2041354-2041376 CCAGCCCCAGACTAGGAGACAGG - Intronic
1019703118 7:2483867-2483889 CCAGCACCAGCTTCAGAGCCAGG + Intergenic
1019783676 7:2959654-2959676 CCTGTCCCAGCCACAGAGCAGGG - Intronic
1020127661 7:5541905-5541927 CCAGACCCAGCCTCAGTGCAGGG + Intronic
1020620665 7:10514894-10514916 CCCGACACAGACACAGAGCCTGG + Intergenic
1021577261 7:22115939-22115961 GCAGTCCCAGCCTCAGAGGCTGG - Intergenic
1021959346 7:25857148-25857170 CTGGTCCCAGACGCAGAGACAGG - Intergenic
1022473149 7:30694053-30694075 CCAGTCCCCAGTTCAGAGCCTGG + Intronic
1022499460 7:30873347-30873369 CCAGCCCCAGACTCTGATCTGGG - Intronic
1022559698 7:31336002-31336024 GCAGTCCCGGACACAGTGCCAGG + Intergenic
1023937684 7:44750896-44750918 CCCAACCCAGACTCAAAGCCAGG + Intronic
1023979740 7:45061847-45061869 CCAGTCTCACCCTGAGAGCCTGG + Intronic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1029072339 7:97910131-97910153 CCAGAGCCAGAGCCAGAGCCAGG + Intergenic
1029663442 7:101978907-101978929 CCAGCCCCAGGCACAGAGCCCGG + Intronic
1030329910 7:108260311-108260333 ACAGTGCCAGAGTCAGTGCCTGG + Intronic
1031180746 7:118411996-118412018 CCAGGCCCAGGCCCAGACCCAGG - Intergenic
1032609471 7:133396427-133396449 CCAGACCAAGATTCAAAGCCTGG - Intronic
1035612895 8:980092-980114 CCAAGGCCAGACTCAGAGCTGGG + Intergenic
1036255436 8:7202631-7202653 CCAGCGCCAGAGCCAGAGCCAGG + Intergenic
1036362054 8:8084872-8084894 CCAGCGCCAGAGCCAGAGCCAGG - Intergenic
1036888914 8:12582158-12582180 CCAGCGCCAGAGCCAGAGCCAGG + Intergenic
1036896495 8:12640300-12640322 CCAGCGCCAGAGCCAGAGCCAGG + Intergenic
1037936389 8:22917560-22917582 CCAGAGCCAGAGTCAAAGCCAGG - Intronic
1038285646 8:26204110-26204132 CCAAGCCCACATTCAGAGCCAGG + Intergenic
1038455569 8:27670196-27670218 CCAGCCCTGGACACAGAGCCTGG - Intronic
1038760967 8:30384291-30384313 CCAGCCCCCGACTCAGCGGCTGG - Intergenic
1041094301 8:54333672-54333694 CAAGTACCAGTTTCAGAGCCAGG + Intergenic
1042527120 8:69774657-69774679 GCAGTCCCAGACCCTGAGACTGG - Intronic
1044620942 8:94190365-94190387 CCATTCCCAGTCTCAGAACATGG + Intronic
1044907984 8:97025610-97025632 CCAGTGCCAGACTGGGGGCCAGG + Intronic
1045387989 8:101689665-101689687 CCAGTCCCGGGCCCAGGGCCGGG - Intronic
1046118691 8:109817587-109817609 CAAGGCCCAAACCCAGAGCCTGG - Intergenic
1047277142 8:123414793-123414815 CCAGCCCCAGACTCAGAACATGG - Intronic
1048002186 8:130387849-130387871 CCAGTGCCAGGCACAGAGTCTGG - Intronic
1048595719 8:135863523-135863545 CCAGTCCAAGTCTAAGGGCCTGG - Intergenic
1049311068 8:141934157-141934179 CCAGCCCCAAACTCAGGCCCAGG - Intergenic
1051478597 9:17535644-17535666 CCAGTCTCTGCCTCAGAGCAAGG - Intergenic
1051716903 9:19994592-19994614 CCACTCTCAGATTGAGAGCCAGG + Intergenic
1052902642 9:33807323-33807345 CCAGGCCCAGGCTCACAGCCAGG + Intergenic
1053160707 9:35811519-35811541 CCAGGACCAGAGCCAGAGCCAGG + Exonic
1053422584 9:37988931-37988953 CCAGTCCAAGACTAAAGGCCTGG - Intronic
1053487942 9:38474562-38474584 CCAGGCCCAGGCTCACAGCCAGG - Intergenic
1053691305 9:40588712-40588734 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
1053824264 9:42004167-42004189 CGAGACCCAGACCCAGACCCAGG + Intronic
1054273497 9:63048773-63048795 CCAGGGCCAGGGTCAGAGCCAGG + Intergenic
1054302565 9:63389683-63389705 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
1054401337 9:64716183-64716205 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
1054434945 9:65200503-65200525 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
1054495444 9:65821178-65821200 CCAGGGCCAGGGTCAGAGCCAGG + Intergenic
1054606310 9:67183196-67183218 CGAGACCCAGACCCAGACCCAGG - Intergenic
1056492657 9:87122667-87122689 CCAGCCCCAGACCCAGAGAAGGG + Intergenic
1056721296 9:89074309-89074331 CCAGCCCCAGAAGCTGAGCCGGG + Intronic
1057147046 9:92765202-92765224 CCTTCCCCACACTCAGAGCCGGG + Intergenic
1057857046 9:98609835-98609857 CCAAACCCAGGCTCAGGGCCAGG + Intronic
1058668918 9:107344249-107344271 TCAGTCCCAGACTCAGGCCCTGG - Intergenic
1058788168 9:108412731-108412753 CCAGACCCAGACTCTGAGGAGGG + Intergenic
1058955114 9:109939293-109939315 CCTGTTCTAGAATCAGAGCCTGG - Intronic
1059343536 9:113613038-113613060 CCCTGCCCAGAGTCAGAGCCAGG - Intergenic
1059381607 9:113931399-113931421 CCACTCCCTGACTTTGAGCCTGG - Intronic
1060027352 9:120184471-120184493 CTAGTCACTGACCCAGAGCCAGG - Intergenic
1061144951 9:128792085-128792107 CCAGGCCCAGACTCACAGATAGG + Intronic
1061211234 9:129194597-129194619 GCAGTCCCAGATCCAGACCCTGG - Intergenic
1061923177 9:133793322-133793344 CCAGAGCCAGAGCCAGAGCCAGG + Intronic
1062011287 9:134268228-134268250 CCAGCCCAAGACTCAGAGCTGGG - Intergenic
1062374290 9:136255029-136255051 CCAGAAGCAGACTCAGAGCCTGG + Intergenic
1062479234 9:136743826-136743848 CCAGCCCCCGCCTCTGAGCCCGG + Intergenic
1203621983 Un_KI270749v1:134903-134925 CCAGGGCCAGGGTCAGAGCCAGG - Intergenic
1188811308 X:34656924-34656946 CCAGGTCCAGACACAGCGCCAGG + Exonic
1189467943 X:41291711-41291733 CCAGTATCAGACCTAGAGCCAGG - Intergenic
1190288179 X:48974206-48974228 CCTGACCCAGACCTAGAGCCAGG - Exonic
1190770829 X:53512780-53512802 CCAGTGCCACACTCTGGGCCTGG + Intergenic
1192177690 X:68896023-68896045 CCAGTTCCAGGCTCAGTGCCAGG + Intergenic
1195095122 X:101494116-101494138 CCAGCCCCAGACTCAGTCCCAGG - Exonic
1195742311 X:108077307-108077329 CCAGAGCCAGAGTCAGAGCCTGG + Exonic
1195900819 X:109795432-109795454 CCAGTCCCAGACACTCATCCTGG - Intergenic
1196056065 X:111356402-111356424 GCTGTCCCAGGCTCAGGGCCTGG + Intronic
1196820261 X:119695265-119695287 CCTGTCCCAGACACCCAGCCTGG - Intergenic
1197331797 X:125161836-125161858 CCAGACCCAGACCCAGACCCAGG + Intergenic
1198870599 X:141174537-141174559 CAAGTCTCTGACTCTGAGCCTGG - Intergenic
1200084077 X:153594387-153594409 CCAGCCACAAACACAGAGCCAGG + Intronic