ID: 1096478570

View in Genome Browser
Species Human (GRCh38)
Location 12:51923500-51923522
Sequence CCCCGCGGGGGTCTGAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096478570_1096478581 7 Left 1096478570 12:51923500-51923522 CCCCTGCTCAGACCCCCGCGGGG 0: 1
1: 0
2: 2
3: 25
4: 246
Right 1096478581 12:51923530-51923552 TCTCAGTTCCTACCCCAGATTGG 0: 1
1: 0
2: 1
3: 17
4: 151
1096478570_1096478582 8 Left 1096478570 12:51923500-51923522 CCCCTGCTCAGACCCCCGCGGGG 0: 1
1: 0
2: 2
3: 25
4: 246
Right 1096478582 12:51923531-51923553 CTCAGTTCCTACCCCAGATTGGG 0: 1
1: 0
2: 1
3: 20
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096478570 Original CRISPR CCCCGCGGGGGTCTGAGCAG GGG (reversed) Intergenic
900428371 1:2590759-2590781 CCCCGCGGGTGTCTGTGGAGGGG + Exonic
900458682 1:2789894-2789916 CCCTGCGGGGGACCGTGCAGGGG - Intronic
901635660 1:10669045-10669067 CCCCGCAGGTCTCTGAGCTGAGG + Intronic
904119100 1:28184454-28184476 CCCTGGGGGGCTTTGAGCAGAGG - Intronic
904400023 1:30250099-30250121 CCCGGCTGGGGTGTGAGCTGTGG - Intergenic
907050767 1:51328930-51328952 TCCTGGTGGGGTCTGAGCAGAGG - Intronic
907341610 1:53739348-53739370 CCCGACGCGGGGCTGAGCAGAGG + Intergenic
912458957 1:109818589-109818611 CCCAGAGGGGGTCAGGGCAGAGG + Intergenic
915066646 1:153230552-153230574 CCCCGAAGGGGTCTCAGTAGAGG + Intergenic
915564554 1:156706384-156706406 CCCCGAGGGGGTCTCAGTAGGGG + Intergenic
916694321 1:167221102-167221124 CCCCGCCGGGCGCTGAGCGGAGG + Intronic
916694509 1:167221635-167221657 CCCCGCGCGGGGCTGAGCCCGGG + Intronic
918926439 1:190792654-190792676 CCCCCCAGGGGTTTGAGCAGTGG - Intergenic
924729276 1:246697091-246697113 TCCCTCGGGAGTCAGAGCAGAGG + Intergenic
1063348940 10:5337076-5337098 CCCAGCTGGGCTCTGAGCACAGG + Intergenic
1064030615 10:11880499-11880521 TCCCGCTGGGGCCTGCGCAGAGG + Intergenic
1064032518 10:11891917-11891939 CCCCGCTGAGCTCTGAGCTGCGG + Intergenic
1064709592 10:18109793-18109815 TCCCTCAGGGGTTTGAGCAGTGG + Intergenic
1065343301 10:24724868-24724890 CCCCGCGAGGCTCGGAGCCGGGG - Intergenic
1067227270 10:44384388-44384410 CCCCGCGAGGGTGTGGGGAGAGG + Intronic
1069797810 10:71064407-71064429 CCCCACGTGGGGTTGAGCAGAGG + Intergenic
1070855200 10:79603090-79603112 CCCCCTAGGGGTTTGAGCAGTGG - Intergenic
1075629386 10:123991914-123991936 CGCCGAGGGGGTCCCAGCAGCGG - Intergenic
1076998628 11:311250-311272 CCCCGCGGGGGTCTGGGCTGCGG - Intronic
1077000115 11:318509-318531 CCCCGCGGGGGTCTGGGCTGCGG + Intergenic
1077065243 11:638135-638157 CCCCCCAGGGTTCTCAGCAGGGG - Intronic
1077330764 11:1982958-1982980 CCCTGCGGGTGTCTGACCGGCGG + Intronic
1078216239 11:9314366-9314388 CCCCGTGGGGGACGGGGCAGCGG - Exonic
1079320687 11:19449180-19449202 CCCAGCTGGGCTCTGAGCTGAGG + Intronic
1080502709 11:32885765-32885787 CCCATCAGGGGTTTGAGCAGTGG + Intergenic
1082087042 11:48058781-48058803 CACTGCGGGGCTTTGAGCAGAGG - Intronic
1083895141 11:65616144-65616166 CCGCGCGAGGGTGCGAGCAGGGG - Exonic
1084004720 11:66316830-66316852 CTCCTCGGGGGTCCGAGGAGTGG + Exonic
1084175398 11:67420051-67420073 CCCAGCGTGGGGCTGAGCACAGG - Intronic
1084187989 11:67485224-67485246 TCCCCCAGAGGTCTGAGCAGCGG - Intronic
1084938612 11:72600624-72600646 GCTATCGGGGGTCTGAGCAGTGG - Intronic
1085513719 11:77100495-77100517 CCTGGGGAGGGTCTGAGCAGAGG - Intronic
1088507255 11:110538988-110539010 CCCCATGGAGGTTTGAGCAGTGG - Intergenic
1088640801 11:111871274-111871296 CCCCGGGAGGGTCTTAGCTGTGG - Intronic
1088802715 11:113320791-113320813 CCCCTCAGGGGTTTGAGCAGTGG + Intronic
1090458144 11:126867180-126867202 CCCCCCAGGGGTTTGAGCAGCGG + Intronic
1202813744 11_KI270721v1_random:38137-38159 CCCTGCGGGTGTCTGACCGGCGG + Intergenic
1096478570 12:51923500-51923522 CCCCGCGGGGGTCTGAGCAGGGG - Intergenic
1098697857 12:73581751-73581773 CCCCACAGGGGTTTAAGCAGTGG + Intergenic
1099202125 12:79690077-79690099 CCCCGCGGGGGGCTTCCCAGCGG + Exonic
1100468941 12:94873509-94873531 GCCCCCGGGGGACTGAGGAGGGG - Intergenic
1101236946 12:102799343-102799365 CCCCTTGGGGGACTGGGCAGTGG + Intergenic
1101873254 12:108582414-108582436 CCCCCCGGGGGCAGGAGCAGAGG + Intergenic
1103564005 12:121806361-121806383 GCCCGCGGGGGTGTCAGCGGTGG - Intronic
1104238255 12:126960909-126960931 TCCCCCAGGGGTTTGAGCAGCGG - Intergenic
1104597688 12:130131319-130131341 CCCCGCGGAGCTCTGGGCAGAGG - Intergenic
1104724400 12:131066942-131066964 CCCCCGGAGGGTCTGAGCAGAGG + Intronic
1105203161 13:18195671-18195693 CCCCACGGGCCTCTGAGCTGGGG + Intergenic
1105459178 13:20567377-20567399 CCCCGGGGCGGTCTGAGGCGGGG + Intronic
1107159694 13:37211420-37211442 CTCCTCGGGAGGCTGAGCAGGGG + Intergenic
1111405031 13:87793053-87793075 CCCCCTAGGGGTCTGAGCAGCGG - Intergenic
1111406185 13:87810584-87810606 TCCCCTGGAGGTCTGAGCAGCGG - Intergenic
1112058749 13:95716281-95716303 CCCAGTAAGGGTCTGAGCAGTGG - Intronic
1114083139 14:19218823-19218845 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1115752158 14:36504370-36504392 CCCCGCGTGGGTTCGGGCAGTGG - Intronic
1116345322 14:43786140-43786162 CCCCTAGGGGGTTTGAGCAGCGG - Intergenic
1122011920 14:98757375-98757397 CCCCTCGGGGCTCTGAGTACTGG + Intergenic
1122658517 14:103279102-103279124 CCGCGCGGGGGTCTGGCCTGGGG - Intergenic
1122945438 14:105006457-105006479 TCCCGCTGGGGTCAGAGAAGGGG - Intronic
1125729016 15:41882469-41882491 CCTAGCGGGGGGCAGAGCAGGGG + Exonic
1127027579 15:54824662-54824684 CCCCCTAGGGGTTTGAGCAGTGG - Intergenic
1129196389 15:73969734-73969756 CCCTGCAGGGTTCTAAGCAGAGG - Intergenic
1129325496 15:74798359-74798381 CCCAGCGGGGTGCTTAGCAGAGG + Intronic
1129926040 15:79365070-79365092 CCCCTCAGGGGTTTGAGCAGCGG + Intronic
1130352473 15:83104811-83104833 CCCGGCGGGGGGCAGGGCAGAGG + Intergenic
1132415480 15:101615867-101615889 CCCTGGGAGGGTCTGAGCTGTGG - Intergenic
1132703124 16:1230359-1230381 CCCCGCTGAGGGCTGAGCACTGG + Intergenic
1132705197 16:1240509-1240531 CCCCGCTGAGGGCTGAGCACTGG - Intergenic
1132708327 16:1255872-1255894 CCCCGCCGAGGGCTGAGCACTGG - Intergenic
1132714468 16:1283922-1283944 CACAGCAGGGGTCTGAGCTGAGG + Intergenic
1132759443 16:1501692-1501714 CTCTGCGGGGGTCTCTGCAGGGG - Exonic
1134410553 16:14000270-14000292 CCCCGCCGGGGGCTGGGAAGGGG - Intergenic
1136536352 16:30902151-30902173 CCCCGCGTGGCTCGGAGCCGGGG - Exonic
1136849888 16:33604206-33604228 GCCCACTGGGGTGTGAGCAGGGG - Intergenic
1138224451 16:55280860-55280882 CACCCTGGGGGGCTGAGCAGAGG - Intergenic
1140045154 16:71435877-71435899 CCAAAAGGGGGTCTGAGCAGTGG - Intergenic
1140500970 16:75433198-75433220 CCCCGCGGGCGTCTGCCCTGTGG - Intronic
1142253944 16:89004974-89004996 CCCAGCTGGGGTCTGAGGTGGGG - Intergenic
1142419619 16:89962212-89962234 CCACGGGAGGTTCTGAGCAGAGG + Intronic
1203111499 16_KI270728v1_random:1452659-1452681 GCCCACTGGGGTGTGAGCAGGGG - Intergenic
1142764873 17:2059240-2059262 CCCCGCTGGGGTCGGAGCGTCGG + Exonic
1143492880 17:7294321-7294343 CGCCGAGGGGGTCCCAGCAGCGG + Exonic
1143499190 17:7329191-7329213 TCCAACGGGGGTCTGGGCAGCGG - Exonic
1146185066 17:30719431-30719453 CCACGGAGGGTTCTGAGCAGAGG + Intergenic
1146996206 17:37323198-37323220 CCCCTTAGGGGTTTGAGCAGTGG + Intronic
1148615205 17:48996292-48996314 CCCCCCGCGGGTCTGACCTGGGG + Intergenic
1151964847 17:77425924-77425946 CCCCGCAGGGCCCTGTGCAGAGG + Intronic
1152329720 17:79665450-79665472 CGACGCCGGGGTCTGAGCTGCGG + Intergenic
1152337306 17:79706213-79706235 CCCCTCGGGGGTCTAAGGACGGG + Intergenic
1152700247 17:81815046-81815068 CCCCCCGGGGGGCTGACCACAGG - Intergenic
1153006180 18:500470-500492 CTCCGCGGGGCTCTGGGCGGGGG - Intronic
1154499839 18:14990498-14990520 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1157621802 18:49021202-49021224 CCCTGGAGGGGTCTGAGCCGGGG - Intergenic
1159359547 18:67382077-67382099 CCCCGTGTGTGTCTGAGCAGCGG + Intergenic
1160914703 19:1491027-1491049 TCCCGGCGGGGTCTGGGCAGCGG + Exonic
1161007840 19:1945246-1945268 CAGCCCGGGGGTCTGAGAAGCGG - Intronic
1162392492 19:10397969-10397991 CCACGCAGGGGTCTCAGGAGAGG - Intronic
1162744745 19:12792105-12792127 CCCCGCGGGGGTGGCAGCGGTGG + Exonic
1162973712 19:14196258-14196280 CCACGGAGGGTTCTGAGCAGAGG - Intronic
1163236131 19:16031655-16031677 GTCAGCGGGGGTCTGATCAGTGG + Intergenic
1163446752 19:17351566-17351588 CCCCTCGGGGCCCTGAGCCGGGG - Exonic
1163567173 19:18058645-18058667 CCCCACTGCGGTCTGAGCCGAGG - Intergenic
1164945264 19:32288091-32288113 CCCAACTGGGGTCTAAGCAGCGG + Intergenic
1164977033 19:32581172-32581194 CCCCGCGAGCGCCTGCGCAGTGG + Exonic
1166333402 19:42091435-42091457 CCAGGCGGGGTGCTGAGCAGGGG + Exonic
1166658126 19:44627162-44627184 CACAGCAGGGTTCTGAGCAGGGG + Intronic
1167371519 19:49085466-49085488 CCGCGCGGGTGGCTGAGCAGCGG + Exonic
1167698031 19:51026302-51026324 GCCAGCGGGGGTGGGAGCAGAGG + Intronic
1168276969 19:55284124-55284146 CGCCGGGGGGGTCTGAGGTGCGG - Intronic
1168332473 19:55578500-55578522 CCCGGCGGGGGGCCGAGCCGGGG + Exonic
1168452490 19:56477281-56477303 CGCCGCCGGGGTCTGAGCCCGGG - Exonic
928117929 2:28561059-28561081 CCCCTGGGGGGCCTGAGGAGGGG - Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932478565 2:72024412-72024434 CCCCACGGGGGACAGAGAAGGGG + Intergenic
935113198 2:100110650-100110672 CCCAGCAGGACTCTGAGCAGTGG - Intronic
938081797 2:128374153-128374175 CCCTGCTGGAGTCTGTGCAGTGG - Intergenic
938499050 2:131820853-131820875 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
938548040 2:132352959-132352981 CCCCGTGTGGGGCTGAGCGGCGG - Intergenic
938794340 2:134705565-134705587 CCCTGCTGGGGTAGGAGCAGGGG + Intronic
942444178 2:176067302-176067324 CTCGGCGAGGGTCTGAGAAGTGG - Intergenic
943906478 2:193505856-193505878 TCCCGCAGAGGTTTGAGCAGTGG - Intergenic
944306925 2:198189196-198189218 CCCCCTAGGGGTTTGAGCAGTGG + Intronic
946300454 2:218820829-218820851 GCCCGCAGAGGTCTGAGGAGGGG + Intergenic
948159641 2:235813546-235813568 CCCCCTAGGGGTCTGAGCTGCGG - Intronic
948795310 2:240399544-240399566 CCCAGCGGGGGGCAGGGCAGGGG - Intergenic
948873512 2:240815677-240815699 CCCCGTGGGGGTGGGAGAAGTGG + Intronic
948897913 2:240935737-240935759 CCCCGTGGGGGTGGGGGCAGGGG + Intronic
948912603 2:241011930-241011952 CCCCGCTGGGGGCTGAGCCAGGG - Intronic
1168824584 20:801291-801313 TCCCTCAGGGGTTTGAGCAGTGG + Intergenic
1169093172 20:2873633-2873655 CGCCGCGGGGCTCGGAGCCGCGG + Intronic
1170026037 20:11890876-11890898 CCCGGCCGGGGCCTGAGGAGCGG + Exonic
1171876909 20:30585731-30585753 CCCCGAGTGGGGCTGAGCGGCGG - Intergenic
1172896593 20:38304582-38304604 ACCCTCAGGGGTCTGAGCACTGG - Intronic
1173920239 20:46738982-46739004 CCCTGAAGGGGTGTGAGCAGTGG + Intergenic
1173953414 20:47011394-47011416 CCCTGGAGGGATCTGAGCAGAGG - Intronic
1174363232 20:50041236-50041258 CCCTGGAGGGCTCTGAGCAGAGG - Intergenic
1174761360 20:53210121-53210143 CCCCTCAGGGGTTTGAGCAGTGG - Intronic
1175511321 20:59528155-59528177 CCCCCTAGAGGTCTGAGCAGCGG + Intergenic
1175866311 20:62179050-62179072 CCCCGCAGAGATGTGAGCAGAGG + Intronic
1176714798 21:10342334-10342356 CCCCACGGGCCTCTGAGCTGGGG - Intergenic
1178195762 21:30343972-30343994 TCCCCCAGAGGTCTGAGCAGGGG - Intergenic
1179186284 21:39087491-39087513 GCCAGCTGGGGTCTGAGCCGGGG + Intergenic
1180163223 21:46007161-46007183 CCCCGTGGGGGTCTGCGTGGTGG - Intergenic
1180294834 22:10874444-10874466 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1180497640 22:15903858-15903880 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1180603547 22:17037604-17037626 CCCCACGGGCCTCTGAGCTGGGG + Intergenic
1180764157 22:18234058-18234080 ACCCTCGGGGGCCTGGGCAGTGG - Intergenic
1180771486 22:18390483-18390505 ACCCTCGGGGGCCTGGGCAGTGG + Intergenic
1180802867 22:18640098-18640120 ACCCTCGGGGGCCTGGGCAGTGG + Intergenic
1180833069 22:18915923-18915945 ACCCTCGGGGGCCTGGGCAGTGG - Intronic
1180985767 22:19903205-19903227 CCCCACGGGGACCTGGGCAGGGG + Intronic
1181218851 22:21355163-21355185 ACCCTCGGGGGCCTGGGCAGTGG - Intergenic
1183350748 22:37333325-37333347 CCCCTGGGGGTTCTGAGGAGGGG + Intergenic
1184337411 22:43862050-43862072 CCCCGCAGGGATCCGAGCATCGG + Intronic
1184424754 22:44402936-44402958 CCCAGCAGGGGCCTGAGCAGTGG + Intergenic
1184473294 22:44707716-44707738 CCCAGCTGGGGTCTCTGCAGTGG - Intronic
1184571917 22:45330656-45330678 CCCCGCAGGGGTCCGTGTAGAGG - Exonic
1185295218 22:50049764-50049786 CACCACGGGGGCCTGAGGAGTGG + Intronic
1203233324 22_KI270731v1_random:131474-131496 ACCCTCGGGGGCCTGGGCAGTGG + Intergenic
1203283153 22_KI270734v1_random:141227-141249 ACCCTCGGGGGCCTGGGCAGTGG - Intergenic
949260581 3:2099106-2099128 CCCCGCGGGAGTCAGAGCCCCGG - Intronic
949808082 3:7977063-7977085 CCCCATGGGGATTTGAGCAGTGG + Intergenic
949808209 3:7978164-7978186 CCCCCTAGGGGTTTGAGCAGTGG - Intergenic
950466825 3:13160782-13160804 CCCAGGGGGTGTCTGTGCAGTGG - Intergenic
952845281 3:37683023-37683045 CCCTTCAGGGCTCTGAGCAGAGG - Intronic
954630186 3:52043811-52043833 CCCCACTGGGGTCTGGGCACAGG - Intergenic
954660962 3:52226569-52226591 CCAGGGAGGGGTCTGAGCAGAGG - Intergenic
956390888 3:68771447-68771469 CCCCTTTGGGGTTTGAGCAGCGG + Intronic
956735219 3:72232931-72232953 CCCCCTAGGGGTTTGAGCAGTGG - Intergenic
957029226 3:75221067-75221089 CCCCCTAGGGGTTTGAGCAGTGG - Intergenic
959583494 3:108004770-108004792 CCCCTAGGGGTTTTGAGCAGCGG + Intergenic
961349148 3:126287853-126287875 CACCGCGAGGGTCTGTGCATGGG + Intergenic
961445408 3:126978713-126978735 CCACTAGAGGGTCTGAGCAGAGG + Intergenic
961653077 3:128426853-128426875 CCCCACGTGGCTCTGAGCACCGG + Intergenic
962482518 3:135810003-135810025 TCCCTCAGGGGTTTGAGCAGCGG - Intergenic
965185221 3:165454571-165454593 CCCCCTAGGGGTTTGAGCAGCGG - Intergenic
968048148 3:195635432-195635454 GCCCGCGGGGGTCCGGGCAGGGG - Intergenic
968048174 3:195635494-195635516 GGCCGCGGGGGTCGGGGCAGGGG - Intergenic
968099230 3:195954126-195954148 GGCCGCGGGGGTCGGGGCAGGGG + Intergenic
968099256 3:195954188-195954210 GCCCGCGGGGGTCCGGGCAGGGG + Intergenic
968306437 3:197654427-197654449 GGCCGCGGGGGTCGGGGCAGGGG + Intergenic
968306463 3:197654489-197654511 GCCCGCGGGGGTCCGGGCAGGGG + Intergenic
968612665 4:1564202-1564224 GCCAGTGGGGATCTGAGCAGGGG + Intergenic
969573571 4:8024094-8024116 CGCTGCCGGGGTCTGGGCAGTGG + Intronic
969878621 4:10155039-10155061 CCCTGCAGGCTTCTGAGCAGAGG + Intergenic
970178845 4:13366328-13366350 CACTGCGTGGGACTGAGCAGGGG - Intronic
972940260 4:44186653-44186675 CCCCTAGGGGTTTTGAGCAGTGG + Intronic
973240854 4:47954457-47954479 TCCCTCAGGGGTTTGAGCAGCGG + Intronic
974303335 4:60098472-60098494 CCCCCTAGGGGTATGAGCAGTGG + Intergenic
979862079 4:125706980-125707002 TCCCCTGGAGGTCTGAGCAGCGG - Intergenic
984081734 4:175255472-175255494 CCCCCTGGAGGTTTGAGCAGTGG + Intergenic
985103803 4:186482840-186482862 CCAAGAGGGGGTCTGATCAGTGG - Intronic
985646150 5:1085614-1085636 GCCCGCGGGGGTCAGCGCACAGG + Intronic
985646160 5:1085648-1085670 GCCCGCGGGGGTCAGCGCACAGG + Intronic
985646170 5:1085682-1085704 GCCCGCGGGGGTCAGCGCACAGG + Intronic
985646180 5:1085716-1085738 GCCCGCGGGGGTCAGCGCACAGG + Intronic
985854908 5:2417126-2417148 CCCCCTAGGGGTTTGAGCAGTGG + Intergenic
985931215 5:3059156-3059178 GCCCGCGGGTGTCTGAGCGAGGG - Intergenic
986352572 5:6894192-6894214 CCCAGCAGGTGCCTGAGCAGAGG + Intergenic
986543322 5:8870084-8870106 CTCCCCAGGGGTTTGAGCAGTGG - Intergenic
988566581 5:32323959-32323981 CCCCCTAGGGGTTTGAGCAGTGG + Intergenic
989462969 5:41722713-41722735 CCCAGCAGGTGTCTGTGCAGTGG + Intergenic
989541853 5:42627634-42627656 CCCCCTAGGGGTTTGAGCAGTGG - Intronic
992866219 5:80960169-80960191 CCCGGCGGGCGCCCGAGCAGAGG + Intergenic
995525986 5:113050897-113050919 TCCCGTAGGGGTCTGAGCTGTGG - Intronic
999536948 5:152528356-152528378 CCCCACAGGGGTTTGAGCAGCGG - Intergenic
1000572738 5:162935522-162935544 CCTCCCAGGGGACTGAGCAGAGG - Intergenic
1001617712 5:173056494-173056516 CCCCTGGGGGTTCCGAGCAGCGG - Intronic
1003244917 6:4375509-4375531 CATCGTGGGGCTCTGAGCAGGGG - Intergenic
1005029395 6:21494687-21494709 CCCCTAGGGGTTTTGAGCAGCGG + Intergenic
1005971319 6:30764119-30764141 CCCTGCTGGGGGCTGAGAAGGGG + Intergenic
1006244354 6:32717404-32717426 TCCCCTGGAGGTCTGAGCAGCGG - Intergenic
1006783382 6:36648014-36648036 CCTCAAGGAGGTCTGAGCAGAGG + Intergenic
1007476295 6:42122108-42122130 CCCAGGAGGGGTCTGAGCTGTGG - Intronic
1010503725 6:76631745-76631767 CCCCTAGGGGGTTTGAGCTGTGG - Intergenic
1012733160 6:102907353-102907375 CCCCCTAGGGGTTTGAGCAGCGG - Intergenic
1013452274 6:110295481-110295503 CCCCCAGGGCGTCTGACCAGAGG + Intronic
1014323855 6:119966696-119966718 CCCCCTAGGGGTTTGAGCAGTGG + Intergenic
1015729668 6:136335040-136335062 CCCCTAGGGGTTTTGAGCAGCGG + Intergenic
1018620460 6:165725444-165725466 CCCCCTAGGGGTATGAGCAGTGG + Intronic
1019792674 7:3027203-3027225 CACCGGGGCGTTCTGAGCAGCGG - Intronic
1022372408 7:29783963-29783985 CCCCATAGGGGTTTGAGCAGGGG + Intergenic
1022423945 7:30249654-30249676 CCTGGCAGGGCTCTGAGCAGAGG + Intergenic
1022992826 7:35725376-35725398 CCCCCTAGGGGTTTGAGCAGTGG + Intergenic
1024065312 7:45727268-45727290 CCCAGCGCGGGCCCGAGCAGGGG - Intergenic
1026557721 7:71422562-71422584 CCCCCTAGGGGTTTGAGCAGTGG - Intronic
1026677767 7:72442289-72442311 CAGCGCTGGGCTCTGAGCAGAGG - Intronic
1030207636 7:106966476-106966498 CCCCCTAGGAGTCTGAGCAGCGG - Intergenic
1031681541 7:124680972-124680994 CCCCCTAGGGGTTTGAGCAGAGG + Intergenic
1034275133 7:149820705-149820727 CCTCCTGGAGGTCTGAGCAGCGG - Intergenic
1034954915 7:155328130-155328152 ACCCGGGGTGGTCTGAGCAGGGG - Intergenic
1036562352 8:9907423-9907445 GCCCGCGAGGGTCGCAGCAGAGG + Intergenic
1039451085 8:37675568-37675590 CCAGGCGGGAGTCTTAGCAGAGG - Intergenic
1045942564 8:107755746-107755768 CCCCTAGGGGTTTTGAGCAGCGG + Intergenic
1049196190 8:141316946-141316968 CCCCAGGAGGGTCTGAGCAGAGG + Intergenic
1049812515 8:144581830-144581852 CCCAGCGGGGGTCTGAGGGCCGG - Intronic
1050043668 9:1521395-1521417 CCCCTTAGAGGTCTGAGCAGTGG + Intergenic
1050382428 9:5043127-5043149 CCCCGCAGGTGTATGTGCAGGGG + Intronic
1051606587 9:18923185-18923207 CCTGGCTGGGGTCTGAGCTGAGG - Intergenic
1051629228 9:19127305-19127327 CCCCGCGGGGAGCAGAGCAGCGG + Intronic
1052795682 9:32921607-32921629 CCCTTCAGGGGTTTGAGCAGCGG - Intergenic
1054581047 9:66913465-66913487 CCCCCAGGGGGTCAGATCAGTGG + Intronic
1055985638 9:82055283-82055305 GTCAGCGGGGATCTGAGCAGTGG + Intergenic
1056243427 9:84670489-84670511 CGCCGCGGAGCTCCGAGCAGCGG + Exonic
1056327412 9:85491231-85491253 CCCCTTAGAGGTCTGAGCAGCGG + Intergenic
1056732455 9:89178042-89178064 CCCCGAGGGGGCCTGGGCAGCGG + Exonic
1056833437 9:89934755-89934777 CCCCTGGGAGGGCTGAGCAGAGG - Intergenic
1056871964 9:90289952-90289974 CCCCCTAGGGGTTTGAGCAGTGG + Intergenic
1057432078 9:95004457-95004479 CCCCTCGGGGCTCCGGGCAGCGG - Intronic
1057828813 9:98391824-98391846 ACGTGCGGGGCTCTGAGCAGAGG + Intronic
1060076101 9:120591958-120591980 TCCCTCGGGGGTTTGAGCAGTGG - Intergenic
1060725068 9:126001067-126001089 CGTCCCTGGGGTCTGAGCAGAGG + Intergenic
1061586868 9:131575247-131575269 CCCCGAAGGTGTCTGAGCTGAGG - Intergenic
1061679687 9:132236800-132236822 CCCAGCGGGATTCTGGGCAGTGG + Intronic
1062036759 9:134385904-134385926 CCCAGCAGGGGCCTGGGCAGAGG - Intronic
1062082824 9:134633478-134633500 CCTCGCGGGGGCCTGGCCAGAGG + Intergenic
1062118743 9:134822725-134822747 CCCCGCGGCTGTCTGAGCTGGGG + Intronic
1062121249 9:134835231-134835253 CCCCACGGAGGCGTGAGCAGGGG - Intronic
1062431948 9:136530172-136530194 CCCAGCCGGGGTCTGAGCCGGGG + Intronic
1062514650 9:136926500-136926522 CCACACAGTGGTCTGAGCAGAGG - Exonic
1185982301 X:4793195-4793217 CCCCGTAGGGGTTTGAGCTGCGG + Intergenic
1188117521 X:26263550-26263572 CCCCTCAGGGGTTGGAGCAGTGG - Intergenic
1190221516 X:48515212-48515234 CACGGCAGGGCTCTGAGCAGAGG + Intronic
1190232167 X:48590575-48590597 CACGGCAGGGCTCTGAGCAGAGG + Intronic
1190473023 X:50801432-50801454 CCCCACCTGGGTCTTAGCAGTGG + Intronic
1193836281 X:86348856-86348878 CCCCTAGGGGTTATGAGCAGCGG - Intronic
1195298211 X:103500788-103500810 GCCCGCGGGGTTGTGCGCAGAGG + Exonic
1197459670 X:126724472-126724494 CCCCTAGGGGTTTTGAGCAGCGG + Intergenic
1198223218 X:134622045-134622067 CACCCCTGGGCTCTGAGCAGAGG + Intronic