ID: 1096478906

View in Genome Browser
Species Human (GRCh38)
Location 12:51924933-51924955
Sequence CAGTCCCAGCCCTGGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 433}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096478906_1096478913 19 Left 1096478906 12:51924933-51924955 CCAGTCTCCCAGGGCTGGGACTG 0: 1
1: 0
2: 4
3: 59
4: 433
Right 1096478913 12:51924975-51924997 CACTCTGGGTGGGCGACTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 111
1096478906_1096478912 9 Left 1096478906 12:51924933-51924955 CCAGTCTCCCAGGGCTGGGACTG 0: 1
1: 0
2: 4
3: 59
4: 433
Right 1096478912 12:51924965-51924987 GTGTAATCATCACTCTGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 79
1096478906_1096478911 8 Left 1096478906 12:51924933-51924955 CCAGTCTCCCAGGGCTGGGACTG 0: 1
1: 0
2: 4
3: 59
4: 433
Right 1096478911 12:51924964-51924986 TGTGTAATCATCACTCTGGGTGG 0: 1
1: 0
2: 0
3: 29
4: 271
1096478906_1096478910 5 Left 1096478906 12:51924933-51924955 CCAGTCTCCCAGGGCTGGGACTG 0: 1
1: 0
2: 4
3: 59
4: 433
Right 1096478910 12:51924961-51924983 AGCTGTGTAATCATCACTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 136
1096478906_1096478909 4 Left 1096478906 12:51924933-51924955 CCAGTCTCCCAGGGCTGGGACTG 0: 1
1: 0
2: 4
3: 59
4: 433
Right 1096478909 12:51924960-51924982 TAGCTGTGTAATCATCACTCTGG 0: 1
1: 0
2: 2
3: 19
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096478906 Original CRISPR CAGTCCCAGCCCTGGGAGAC TGG (reversed) Intergenic
900141785 1:1141781-1141803 CAGCCCGAGCCCCAGGAGACAGG + Intergenic
900161465 1:1226118-1226140 CAGCTCCAGCCACGGGAGACAGG + Intronic
900308193 1:2021104-2021126 CACTCCCATCCCTGGAAGAGGGG + Intronic
900496531 1:2978452-2978474 CAGTCACAGTCCTGTGAGGCAGG - Intergenic
900607161 1:3529012-3529034 CAGTGCCAGCTCTGCCAGACCGG + Intronic
901213381 1:7539247-7539269 CAGCCACAGCCTTGGGGGACAGG + Intronic
901661329 1:10799651-10799673 CAGTCCCTGCACTGGGAGTTTGG - Intergenic
901897815 1:12329550-12329572 CAGTGCCAGCCCTGGCACCCAGG - Intronic
902197825 1:14810817-14810839 CTGTCCCCACCCTGGGAGGCTGG - Intronic
902288142 1:15419722-15419744 CAGTTCCAGCTCAGGGAGAAGGG + Intronic
902475942 1:16687491-16687513 CAGTCCCAGCCTTGTGACACTGG - Intergenic
902715234 1:18268275-18268297 CAGAGCCAGCTCTGGGACACAGG + Intronic
902898183 1:19494088-19494110 CAGGCCCAGACCTGTTAGACGGG - Intergenic
903127295 1:21256699-21256721 CAGGACAAGCCCTGGAAGACAGG - Intronic
903362996 1:22788664-22788686 CATTCCCAGACCTGGGGGAGAGG - Intronic
903650817 1:24921064-24921086 CTGTGCCAGCCCTGGGGTACAGG - Intronic
904236621 1:29121329-29121351 CAGTCCCAGCCCGGGCCGTCGGG + Exonic
904558058 1:31378365-31378387 CCCTCCCTGCCCTGGGGGACAGG + Intergenic
905565851 1:38964149-38964171 CAGTCCCAGAGATGAGAGACAGG - Intergenic
905822771 1:41006669-41006691 AATTCCCAGCCCAGGGTGACAGG + Intronic
906025162 1:42667218-42667240 CAGTCCATGTCCTGGCAGACAGG - Intronic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
906122786 1:43405653-43405675 CAATCCCTGCCCTGGGATCCAGG - Intronic
906236610 1:44214966-44214988 CAGAACCAACCCTAGGAGACTGG - Intronic
906567671 1:46812442-46812464 CAGTCCAGGCCCTGGCAGCCTGG - Intronic
906960243 1:50415712-50415734 CAGTCACAGCCCTTGGCGCCTGG - Intergenic
908555710 1:65254738-65254760 CGTTCCCGGCCCTGGGAGCCTGG + Intronic
908782212 1:67700839-67700861 GAATCCCAGCCCTGGGGGAAGGG + Intergenic
910806910 1:91197586-91197608 CAGTCACACCCCAGAGAGACTGG + Intergenic
911474496 1:98359008-98359030 CTGTCCCAGCTCGGGGAGAGGGG - Intergenic
912414402 1:109498309-109498331 TATTCCCAGCCCTGGGAGGAAGG + Intronic
912548379 1:110467410-110467432 CAGTCCCAGCTGAAGGAGACAGG - Intergenic
912726965 1:112067305-112067327 TAGACCCAGCCCTGGGAGACAGG - Intergenic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
915565921 1:156712617-156712639 CTGTCCCTGCCCTGGGAGCTGGG - Intergenic
915582599 1:156823972-156823994 CAGGCCCAGCACTGGCAGATGGG - Intronic
916650990 1:166834242-166834264 AGGTCCCAGCCCAGGGACACAGG + Intergenic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
917035836 1:170746030-170746052 CACACCCAGGCCTGGGAAACAGG + Intergenic
917965495 1:180176070-180176092 CACTCCCAGGCCTGGGATCCTGG - Intronic
919781627 1:201224964-201224986 CATACCCAGCCCTGGTAGAGTGG - Intronic
919792298 1:201300065-201300087 CCCACCCAGCCCTGGGAGATAGG + Intronic
919797897 1:201332286-201332308 CAGCCCCTGCCCTGGGAACCAGG + Exonic
919801631 1:201357851-201357873 AGGTCCCAGCCCTGGGTGACAGG - Intergenic
919932568 1:202230876-202230898 CAGGCCCAGATCTGGGAAACTGG + Intronic
920075161 1:203330777-203330799 CTGGCCCAGCACTGGGAAACCGG - Intergenic
920092775 1:203465974-203465996 CAGTTCCAAGCCTGGGAGGCTGG + Intergenic
920103202 1:203531247-203531269 CAGAGCTAGCCCAGGGAGACAGG + Intergenic
920293973 1:204944611-204944633 CAGCCACAGCCCTGAGAAACTGG - Intronic
920345129 1:205301507-205301529 CATCCCCAGCCCTCGGAGCCTGG + Intergenic
920440296 1:205976166-205976188 CAGTCCCAGACTTGGGAGCAGGG + Intergenic
920935665 1:210432122-210432144 CAGTCGCATCCCTGGGAAATTGG - Intronic
921149000 1:212385245-212385267 CAGACCCAGCTCAGGCAGACAGG + Intronic
921476408 1:215615949-215615971 CTGCCCCATCCCTGGGAGAAAGG - Intronic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
923932031 1:238712269-238712291 CAGTCACAACCCTGGGCAACTGG + Intergenic
924038032 1:239955602-239955624 CAGTCCCTGCCATGCGAGTCTGG - Intergenic
924141008 1:241023445-241023467 CTGTGCCCTCCCTGGGAGACTGG - Intronic
924596826 1:245453498-245453520 TAGTCCCAGCCCTGGGGTAAAGG + Intronic
1063199142 10:3770777-3770799 CATTCTCTGCCCTGGGAGAAAGG - Intergenic
1066047529 10:31606347-31606369 CAGTGACAGCCATGGGAGAAAGG - Intergenic
1066393548 10:34998054-34998076 AGGTCCCAGCCTGGGGAGACTGG - Intergenic
1067071956 10:43138701-43138723 CAGGCTCATCCCTGAGAGACAGG - Intronic
1067457136 10:46427170-46427192 CAGGCCCAGGCCTAGGGGACCGG - Intergenic
1067535182 10:47104303-47104325 CAGACACAGGCCTGGGAAACTGG - Intergenic
1067630065 10:47957468-47957490 CAGGCCCAGGCCTAGGGGACCGG + Intergenic
1068536849 10:58249336-58249358 TAATCCCAGCCCTGGGAGGCTGG - Intronic
1069823673 10:71242494-71242516 CAGGCCCTGCCCAGGGAGAGGGG - Intronic
1070153211 10:73818022-73818044 AGGACCCAGCCCTGGGTGACAGG + Intronic
1070321981 10:75361394-75361416 CAGTCTCAGCCCTCTGAGAATGG + Intergenic
1070599074 10:77853330-77853352 TAGGCCCAGCCCCTGGAGACTGG - Intronic
1070826498 10:79393387-79393409 CAGTCCCACCCCAGGCAGGCTGG - Intronic
1072303583 10:94085629-94085651 TAGTGCCAGCCCTGGAAGTCAGG - Intronic
1072610640 10:97015184-97015206 CAGCCCCAGCCCTTACAGACTGG + Intronic
1073248532 10:102107902-102107924 CAGGCCCAGCCCAGGGCCACTGG + Exonic
1074430187 10:113387635-113387657 ATTTCCCAGCCCTGGGACACAGG + Intergenic
1074882795 10:117671722-117671744 CTGTGCCAGCCATGAGAGACAGG - Intergenic
1075518809 10:123131770-123131792 AATACACAGCCCTGGGAGACAGG - Intergenic
1075646923 10:124102748-124102770 CAGCCCCTGTCCTTGGAGACTGG - Intergenic
1075823588 10:125334703-125334725 CAGTAGCAGGCCTGGGAGCCAGG - Intergenic
1076197785 10:128532536-128532558 GAGTCCCAACCCTGGGACAAGGG - Intergenic
1076520934 10:131080859-131080881 CAGACCCTCCCCTGGGAGGCTGG - Intergenic
1076694281 10:132239667-132239689 CAGCCCCTGCCCCGGGAGCCCGG + Intronic
1076895270 10:133308549-133308571 CCCTCCCAGCCCTGGGAAGCCGG - Exonic
1077305597 11:1867454-1867476 CAGTCCCAGCCCTGCAGGCCAGG + Intronic
1077488931 11:2851572-2851594 CAGGCCCACCACTGGGAGAGGGG + Intergenic
1077514992 11:2996090-2996112 CGGACCCAGCCTGGGGAGACTGG + Intergenic
1077694723 11:4383843-4383865 AAGCCCCAGCCCTGGGGCACAGG + Intergenic
1077867972 11:6238978-6239000 AAGCCCAGGCCCTGGGAGACAGG + Intronic
1078092253 11:8271381-8271403 CAGTCCCAGGGTTGGGAGATGGG - Intergenic
1078106212 11:8359675-8359697 CTGTCCCGGCCCTGGGGGAGAGG - Intergenic
1078132545 11:8624742-8624764 CAGCCCCATCTCTGGGACACAGG + Exonic
1078240774 11:9529413-9529435 CAGGACCAGCACTGGGAGGCTGG - Intergenic
1078412943 11:11142553-11142575 CATGCCCAGCCCTGGGCTACAGG - Intergenic
1079102515 11:17550764-17550786 CAGCCCCAGCCCCAGGAGTCAGG - Intronic
1080563660 11:33487950-33487972 CTTTCCCATCCCTGGGAGGCAGG + Intergenic
1080644966 11:34181691-34181713 ACCTCCCAGCCCTGGGAGCCGGG - Intronic
1080832252 11:35906251-35906273 CTGTCCCAGCACTGGGTGCCTGG - Intergenic
1083183203 11:61001724-61001746 CAGTCACAGCCATGGAAGATAGG - Intronic
1083634491 11:64112979-64113001 CAGTCCCTGCCCTGGCAGTTTGG + Intronic
1083652439 11:64211224-64211246 GAGTCCCAGCCCTGGGGGACAGG + Intronic
1084155004 11:67308400-67308422 CACTCTGAGCCCTGGGAGAGAGG - Exonic
1084162027 11:67355259-67355281 CCTTCCCAGCCCTGGTAGACAGG - Intronic
1084741399 11:71141731-71141753 CAGGCCCAGGGCTGGGAGAGTGG - Intronic
1085031678 11:73275002-73275024 CAGGGCCAGCCCTGGGACAGGGG - Intronic
1085345237 11:75764313-75764335 CTCTCCCAGCCTTGGGAGGCAGG + Intronic
1085519947 11:77131837-77131859 AAGCCCCAGCCCTGGGGAACCGG + Intronic
1087838752 11:102901023-102901045 CAGTCCCAGGCCTGGGTAGCTGG + Intergenic
1089564032 11:119361431-119361453 CAGTCCCCTCCCTGAGAGAGGGG - Intronic
1090077935 11:123591127-123591149 CAGAGCCCGCCATGGGAGACTGG + Intronic
1090256931 11:125291095-125291117 CAGACCCAGCTCTGGCAGGCTGG + Intronic
1090423218 11:126589845-126589867 CAGCCCCAGCCCCAGGAGGCAGG - Intronic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1095349117 12:41188618-41188640 CAGTGCCAGCCCTTGGCGCCCGG + Exonic
1096214457 12:49791755-49791777 CATGCCCAGCCCCCGGAGACGGG - Exonic
1096478906 12:51924933-51924955 CAGTCCCAGCCCTGGGAGACTGG - Intergenic
1098577027 12:72054185-72054207 CAGTCCTTGTCTTGGGAGACAGG + Intronic
1100697763 12:97114161-97114183 TGATCACAGCCCTGGGAGACAGG - Intergenic
1100813798 12:98366132-98366154 GAGTACCATCCCTGGGAGAGTGG + Intergenic
1101838743 12:108312894-108312916 GACTCCCTGCCCTGGGAGTCTGG - Intronic
1102453175 12:113056469-113056491 CAGGCCCTGGACTGGGAGACTGG + Intergenic
1102499021 12:113338527-113338549 CTACCCCAGTCCTGGGAGACAGG - Intronic
1102514238 12:113435622-113435644 CAGTCCCAGCCGGTGGAGACGGG + Intronic
1103905859 12:124326916-124326938 CTGTCTCAGCCCTGGGAGTCAGG - Intronic
1103957240 12:124584052-124584074 CAATCCCAGCACAGGGAGAATGG + Intergenic
1104569102 12:129909459-129909481 CAGGCCCAGCCCAGGGAGGCCGG + Intergenic
1104985784 12:132596253-132596275 CTGTCCCAACCCTGGGAGCAGGG + Intergenic
1105038907 12:132946674-132946696 AACTCCCAGCCCTGGGATGCTGG - Intronic
1106381176 13:29241148-29241170 GAGCCCCAGCCCTGGGTTACAGG + Intronic
1112365599 13:98752702-98752724 CAGCCCCAGCTCTGCGAGGCGGG + Intergenic
1113354665 13:109566960-109566982 CAGCCCCAGGCCTGGGCGCCAGG - Intergenic
1113607142 13:111617271-111617293 CAGTCCTAGCTCAGGGAGAAAGG + Intronic
1114669276 14:24400150-24400172 GATTCCCAGCCCTTGGAGATGGG + Intronic
1115987146 14:39113874-39113896 CAGTCCCTGCCCTAAGAGAGCGG + Intergenic
1116203953 14:41836937-41836959 CTGTCCCAGCCCTGTCAAACAGG - Intronic
1119727149 14:76928388-76928410 CAATCTGAGGCCTGGGAGACAGG - Intergenic
1120836276 14:89040874-89040896 CAGTCCCGGGCCAGGGAGGCAGG + Intergenic
1121199579 14:92106312-92106334 CGGCCCCCGCCCTGGGAGCCGGG - Intronic
1121546883 14:94769450-94769472 CAGTGCCTGCCCGGGGAAACTGG - Intronic
1121897645 14:97663388-97663410 CAGTCCTGGCCCTGGGAAGCTGG - Intergenic
1122138581 14:99648702-99648724 CAGTCAGAGCCCTGGGAGCATGG + Intronic
1122552504 14:102557532-102557554 AACTCCCATCCCTGGGAGAGGGG - Intergenic
1122626497 14:103087879-103087901 CAGTCCCAACCCTGGGGGTAGGG - Intergenic
1122884034 14:104702655-104702677 CAGGCCCAGGCTGGGGAGACGGG - Intronic
1122888184 14:104719801-104719823 CAGCCCCTGGCCTGGGGGACTGG - Intronic
1122930487 14:104931174-104931196 CAGCACCATCCCTGGGAAACAGG + Intronic
1124346810 15:28928529-28928551 CAGTCACAGCCCAGGGAAATGGG - Intronic
1124551362 15:30683795-30683817 CAGTCCCTGGCCTAGGAGCCTGG + Intronic
1124630532 15:31334296-31334318 CCTCCCCAGCCCTAGGAGACAGG - Intronic
1124679885 15:31721870-31721892 CAGTCCCTGGCCTAGGAGCCTGG - Intronic
1125542042 15:40475222-40475244 CAGTTCCTGCCCTGGAGGACCGG + Intergenic
1126136256 15:45394955-45394977 CAATGCAAGCCCTGAGAGACAGG - Intronic
1128065334 15:64760959-64760981 AAGTCCCAATCCTGTGAGACAGG - Intronic
1128331758 15:66760772-66760794 CAGCGCCAGGCCTGGGAGACTGG - Intronic
1128550673 15:68596252-68596274 CAGTCCCTGCCCTCAGGGACAGG + Intronic
1129457568 15:75683815-75683837 CAGGCCCAGCCCTGGCAGGAGGG + Intronic
1129726228 15:77903129-77903151 CAGGCCCAGCCCTGGCAGGAGGG - Intergenic
1130459965 15:84153605-84153627 CATTCCCAGCCGAGGGAGAAAGG + Intergenic
1130649883 15:85756503-85756525 CAGGCCCTGCCCAGGGAGCCAGG - Intergenic
1130691609 15:86086197-86086219 CAGTTCCAGCCCTGGGAGATGGG + Intergenic
1131752839 15:95527827-95527849 CAGTGCAAGCCCTGGAAAACAGG + Intergenic
1132415251 15:101614624-101614646 CAGTCCCAGCCCTGGCAAAGGGG + Intergenic
1132504149 16:298349-298371 CCGTCCCAGCCCAGGGTGGCCGG + Intronic
1132666679 16:1084052-1084074 CTGTCCCCGTCCTGGGAAACGGG + Intergenic
1132870837 16:2115114-2115136 CAGGCCAAGACCTGGCAGACAGG + Intronic
1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG + Intronic
1132982445 16:2745404-2745426 TAGACCCAGCCCTGGCACACAGG + Intergenic
1133130055 16:3671434-3671456 CAGTCACAACCCTGGGGCACAGG + Intronic
1133270291 16:4608064-4608086 CAGTCACATCCCTGGGAGCCAGG + Intergenic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1134179678 16:12037385-12037407 CAGTCTCAGCCCTGGACCACAGG - Intronic
1134716576 16:16360470-16360492 CAGGCCAAGACCTGGCAGACAGG - Intergenic
1134950238 16:18348204-18348226 CAGGCCAAGACCTGGCAGACAGG + Intergenic
1134958174 16:18391689-18391711 CAGGCCAAGACCTGGCAGACAGG + Intergenic
1135306423 16:21371154-21371176 CAGTCTCAGCCCTGGACCACAGG - Intergenic
1136020566 16:27437378-27437400 CCCTCCCAGCCCTGAGAGTCTGG + Intronic
1136303166 16:29350298-29350320 CAGTCTCAGCCCTGGACCACAGG - Intergenic
1136390886 16:29963438-29963460 CTGTCCCATTCCTGGGACACAGG - Exonic
1137272001 16:46908129-46908151 CAGTCCTGGGCTTGGGAGACCGG + Intronic
1137275611 16:46931484-46931506 CAGCCTGAGCCCTGGGTGACAGG - Intergenic
1138432505 16:56978016-56978038 CAGTCCATGCCCTCGGAGATGGG - Intronic
1139507680 16:67407325-67407347 CAGCGCCACACCTGGGAGACAGG + Intronic
1139511204 16:67429662-67429684 AAGCCCCAGACCTGGGAGGCAGG - Intergenic
1141149291 16:81552969-81552991 GAGTCCCCTCCCTGGGGGACAGG + Intronic
1141526522 16:84615312-84615334 CACTCCCATCCCTGGGGGGCAGG + Intronic
1141630823 16:85287066-85287088 CAGTCCCCGTCCCCGGAGACAGG - Intergenic
1141772803 16:86101323-86101345 CAGCCCCAGCCCGAGGAGGCAGG - Intergenic
1141913514 16:87077130-87077152 CACTCCCCGCCCAAGGAGACGGG + Intergenic
1141982888 16:87560934-87560956 TAGCCCCACCCCTAGGAGACGGG - Intergenic
1142194512 16:88733252-88733274 CCGTCCCAGCCCTCGGGGGCCGG + Intronic
1142213257 16:88818359-88818381 CAGGCCAAGCCCTGGCAGAGAGG + Intronic
1142214286 16:88823177-88823199 GAGGCCCTGCCCTGGGAGAAGGG + Intronic
1142785039 17:2214541-2214563 CAGCACCAGCCCTGGGTGAGGGG - Intronic
1143020591 17:3915468-3915490 CACTCCCAGCCCGGTGGGACAGG + Intronic
1143166966 17:4901681-4901703 CAGGCCCAGCCCTGGAAGCTGGG + Exonic
1143390086 17:6555280-6555302 CAGTGCCTGCACAGGGAGACGGG + Intronic
1143701070 17:8660707-8660729 CAGTGCCAGGCTGGGGAGACTGG - Intergenic
1144939540 17:18928546-18928568 CAGTGCTACCCCTGGGAGCCTGG + Intronic
1145888038 17:28396359-28396381 TTGTCTCAGCCCAGGGAGACTGG - Exonic
1145961081 17:28886858-28886880 CAGTGCCAGCCCTGGGGCACTGG + Intronic
1146266140 17:31454094-31454116 CAGTCTCTGCCCTGGGAGAATGG - Intronic
1147420714 17:40320986-40321008 CAGCCAAAGCCCTGGGAGCCGGG - Intronic
1147597299 17:41725256-41725278 CTGTCCCAGCCAGGGGAGAGGGG + Intronic
1147598299 17:41730824-41730846 CTGTCCCAGCCCTGGGTGCCTGG + Intronic
1148450838 17:47777108-47777130 CACGCCCACCCCTGGGAGTCAGG + Intergenic
1150074529 17:62181232-62181254 CTGTGCCAGCCCTGTGGGACTGG + Intergenic
1150626891 17:66847703-66847725 CAGTCATGGCCCTAGGAGACAGG + Intronic
1151333407 17:73424695-73424717 GAGTGCCAGCCCTGGGGGGCAGG + Intronic
1151379785 17:73717738-73717760 CAGGCCCAGCGCTGGGAGGCTGG - Intergenic
1151571359 17:74927447-74927469 CACTCCCTCCCCTGGGAGAAAGG - Intronic
1152108514 17:78344019-78344041 CAGTCCCAGCTCTGGGCAGCAGG - Intergenic
1152227950 17:79101447-79101469 CAGCCCCAGGGCTGGGACACTGG + Intronic
1152344135 17:79741496-79741518 CCCTCCCAGCCCTGGGAGAAGGG + Intronic
1152349167 17:79774095-79774117 CAGTCACAGCCCGGGTAGATGGG - Intergenic
1152411614 17:80127063-80127085 TAATCCCAACACTGGGAGACCGG + Intergenic
1152430959 17:80248118-80248140 CAGGTCCAGCCCTAGGAGAAGGG - Exonic
1152603395 17:81276824-81276846 CAGGACCAGCCCTGTGAGCCTGG - Intronic
1152666153 17:81570759-81570781 CATGCCCAGCCCTGGGCCACAGG - Intronic
1153997634 18:10455185-10455207 CCGTCTCAGCCCTGGGAGAGGGG + Intronic
1154305527 18:13228034-13228056 CAGTCTCAACCCAGGGAGATGGG - Intronic
1154313692 18:13286785-13286807 CTGTCCCTGGCCTGGGGGACAGG + Intronic
1156487862 18:37477973-37477995 CAGCCCCAGCCCTGGGGAGCAGG + Intronic
1157612259 18:48964480-48964502 CATTCCCAGCCCCAGGAGGCAGG - Intergenic
1157793000 18:50549504-50549526 CCTTCCCTGCCCTGGAAGACTGG - Intergenic
1158987419 18:62832524-62832546 CAGTAACAGACCTGGGAAACAGG - Intronic
1159031516 18:63237150-63237172 CAGTCCCCGGGCTGGGAGAGGGG - Intronic
1159942108 18:74416204-74416226 CAGCCCATGCCCGGGGAGACAGG - Intergenic
1160266289 18:77342790-77342812 CTGACCCAGCCCTGGGACCCTGG - Intergenic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1160987255 19:1844785-1844807 CAGTCCCAGGCCTGGGGAAGGGG - Intronic
1161238186 19:3208204-3208226 CAGTGCCAGCCCTGGGGTTCTGG + Exonic
1161479861 19:4505037-4505059 CATTCACAGTCCTGGGAGAAAGG + Intronic
1162029160 19:7909947-7909969 CCGTGCCAGCCCTGGGAGGAGGG + Intronic
1162514377 19:11139150-11139172 AAGCCCCAGCTCTGGGAGAAGGG - Intronic
1163300487 19:16442651-16442673 CAGACCCAGGCCAGGGAAACTGG - Intronic
1163612813 19:18309905-18309927 CTGGCCCAGCCCTGGGAGCGCGG + Intronic
1163760366 19:19133090-19133112 CAGCCCCAGCCTTGGGAGGGTGG - Intronic
1164691347 19:30213045-30213067 CAATCTCACACCTGGGAGACCGG - Intergenic
1164745795 19:30611927-30611949 CAGTGGCAGCCCTGGGAGTTAGG + Intronic
1166504514 19:43362571-43362593 AAATCCCAGCACTGGGAGAAAGG - Exonic
1166541782 19:43610559-43610581 AAGTCCCAGCTCTCGGGGACAGG - Intronic
1166728441 19:45043460-45043482 CATACCCAGCTCTGTGAGACTGG + Intronic
1167088050 19:47324099-47324121 CAGGCTCAGGCCTGGGTGACTGG - Intergenic
1167419236 19:49393541-49393563 CACTTCCAGCCCTGGGAGAGAGG + Intronic
1167505833 19:49870644-49870666 CAGGCCCAGCTCCGGGTGACGGG - Intronic
1167570000 19:50280974-50280996 CAGTCCCAGCCCAAGGTGACTGG - Intronic
1168213135 19:54906287-54906309 CAGACACAGCCCTGGAAGACGGG - Exonic
1168281239 19:55306472-55306494 CAGTCCCAGCACTGGGCTGCAGG - Intronic
1168692526 19:58385713-58385735 CAGGCCCAGCCCTGGGACCTGGG + Intergenic
1202647878 1_KI270706v1_random:158078-158100 CAGTCCCTGCACTGGGACCCAGG + Intergenic
1202709956 1_KI270714v1_random:13345-13367 CAGTCCCAGCCTTGTGACACTGG - Intergenic
925029197 2:636471-636493 CCGGCCCACCCCGGGGAGACAGG + Intergenic
926238383 2:11067273-11067295 CAGGCCCATTCCTGGGAGATGGG + Intergenic
927451529 2:23213210-23213232 GGGGCCCAGCACTGGGAGACTGG + Intergenic
927481364 2:23456826-23456848 TATTGCCAGCCCTGGGTGACTGG - Intronic
927872347 2:26631647-26631669 AGCTCCCAGCCCTGGGAGAGTGG + Intronic
928149090 2:28810524-28810546 CAGCCCCAGCCCCGGGGGCCTGG + Intronic
928249140 2:29659588-29659610 CAGCCCCAGCCCTGAGAGAATGG - Intronic
928259364 2:29752962-29752984 CAGACCCAGCCCAGGGTCACAGG + Intronic
929461310 2:42103642-42103664 AAGTCCCAGACCCAGGAGACTGG - Intergenic
929815217 2:45225259-45225281 GAGTCCCAGCTCAGGGAGAAGGG - Intergenic
930594103 2:53364807-53364829 CAGTCAAAGCCCTTGGAGATAGG + Intergenic
930700982 2:54457180-54457202 CACGCCCAGCCCTGGGAGAGTGG - Intronic
930720086 2:54630053-54630075 CAGTCCCACACGTGGGAGGCTGG - Intronic
931254458 2:60557700-60557722 CAGTCCCAGCCCTCGGACCGAGG + Intergenic
932296898 2:70632240-70632262 CAGACCCATTCCTGGGAGACAGG + Intronic
936280461 2:111135682-111135704 CAGCCCCAGCCTTGGGTGTCTGG - Intronic
937083773 2:119157907-119157929 CAGTTGCAGCCCTGGCAGCCCGG + Exonic
937290664 2:120779811-120779833 CAGTCCTGGCCCGGGGAGGCAGG - Intronic
940733015 2:157416046-157416068 CAGGCCCAGCCCTTGTGGACCGG - Exonic
942657098 2:178225538-178225560 CAGTCAGAGCCCTGGGAGGTAGG + Intronic
943325027 2:186486879-186486901 CAGTACCATCCCTGGGTGACGGG - Intronic
944476335 2:200110483-200110505 CAGTCCCAGCCCAGAGACAAGGG - Intergenic
945385282 2:209191297-209191319 CAGTCACTGCCCTGGCAGGCAGG + Intergenic
945984558 2:216343037-216343059 CAGTCCCAGTCCTTTGGGACAGG - Intronic
946948751 2:224849677-224849699 CAGTACCAACCCTGGGACAATGG + Intronic
947623666 2:231606001-231606023 GAGTCCCTGCCCTGGAAGCCAGG - Intergenic
948598940 2:239097176-239097198 CAGACCCTGCCCTTGGAGCCAGG - Intronic
948874230 2:240818798-240818820 CAGTGCCAGCCCTGCGAGGCAGG + Intronic
1168890700 20:1293921-1293943 TAGGCCCAGTCCTGGGAGGCAGG - Intronic
1169252833 20:4073345-4073367 CACTCCCTGACCTGGGAGGCAGG - Intronic
1169617284 20:7462806-7462828 CAGTCACTGCTCTGGAAGACAGG - Intergenic
1169924466 20:10768380-10768402 TAGTCCCAGGCCTGGGAGCCAGG + Intergenic
1171181344 20:23093172-23093194 CAGTCCTGGCCTTGGGAGACTGG - Intergenic
1171311072 20:24144977-24144999 CAGACCCACCCCTGGAAAACTGG + Intergenic
1171413314 20:24960706-24960728 CAGTCACATCCCTGGGAGGCTGG + Intergenic
1171426618 20:25052480-25052502 CAGTCCCTGCCCTTGGGGAATGG - Intronic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172443761 20:34982518-34982540 TCGTCGCTGCCCTGGGAGACGGG + Exonic
1172627605 20:36357108-36357130 CAGTGCCAGTCCAGGGAGTCTGG - Intronic
1172765185 20:37346920-37346942 CAATCCCAGCCCAGGCAGACAGG - Intronic
1173335194 20:42106911-42106933 CAGCCCCAGCACTGGAAGAGAGG + Exonic
1173438089 20:43050505-43050527 CAGACCCAGCCCTGGGCCAGTGG + Intronic
1173707608 20:45124075-45124097 CAGCCCCAGCCCTGGGAGGCAGG + Intronic
1174303778 20:49600786-49600808 CAAGCCAAGACCTGGGAGACAGG + Intergenic
1174364762 20:50049920-50049942 CAGGCCCAGACCTGGGGGAGGGG - Intergenic
1174387210 20:50194237-50194259 CCCTCCCAGCCCTGGGCAACTGG + Intergenic
1174862680 20:54106217-54106239 CAGTTTCATCCCTGAGAGACAGG + Intergenic
1175214637 20:57385402-57385424 CACTGCCTGCCCTGGGAGCCCGG - Intergenic
1175220620 20:57414525-57414547 CGGCCACAGCCCTGGGAGGCAGG - Intergenic
1175257426 20:57655707-57655729 CACCCCGAGCCCTGGGAGTCTGG - Intronic
1175292074 20:57882585-57882607 CAGACCCAGCCTTGGGAGGGTGG + Intergenic
1175296675 20:57913477-57913499 CAGGACCAGAGCTGGGAGACCGG + Intergenic
1175521561 20:59605277-59605299 GCGCCCCAGCCCTGCGAGACTGG - Intronic
1175686937 20:61038092-61038114 CTGTCACAGCCCTGAGACACAGG - Intergenic
1175731747 20:61358883-61358905 CAGTTTCAGCCCAGGGTGACGGG + Intronic
1175763742 20:61578965-61578987 CAATCCCAGCCCAGGGGTACTGG - Intronic
1175839910 20:62020176-62020198 CAGCCCCAGCCCAGGACGACAGG + Intronic
1175917527 20:62433607-62433629 CAGTGCCAGCCTTGGCAGACGGG + Intergenic
1176075362 20:63245789-63245811 AATTCCCATCCCTGGGAGTCAGG + Intronic
1176097787 20:63352255-63352277 CAGGTCCAGCCCTGGGACTCGGG - Intronic
1176116605 20:63434324-63434346 GAGTCCCCGCCCTGGGAGGTTGG - Intronic
1176603973 21:8814651-8814673 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1178437957 21:32575975-32575997 CAGTCACGGCCCCTGGAGACCGG + Intergenic
1178854171 21:36237166-36237188 CAGTCCCAGCCCCGACATACTGG - Intronic
1178957902 21:37039846-37039868 CAGAGCAAGCCCTGTGAGACAGG - Intergenic
1179258266 21:39736648-39736670 CAGTCCCGGCCCGGGGTCACCGG + Intergenic
1179470093 21:41604724-41604746 CAGTCCCCTCCCTGGGAGCTAGG + Intergenic
1179881087 21:44293600-44293622 CAGTCCCATCCCCAGGAGGCAGG - Intronic
1179892884 21:44345769-44345791 CAGAGCCAGGCCTGGGAGAAGGG + Intergenic
1180075415 21:45459265-45459287 CACTCCCAGCCCTGGGTGAGGGG + Intronic
1180346257 22:11706228-11706250 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1180824704 22:18854520-18854542 CAGGCCTGGCCCTGGGAGACAGG - Intronic
1180867255 22:19126706-19126728 CAGGCCCCGCCCTGGGGGAGTGG - Intergenic
1181188026 22:21120027-21120049 CAGGCCTGGCCCTGGGAGACAGG + Intergenic
1181211172 22:21290466-21290488 CAGGCCTGGCCCTGGGAGACAGG - Intergenic
1181398332 22:22636422-22636444 CAGGCCTGGCCCTGGGAGACAGG + Intergenic
1181501070 22:23315785-23315807 CAGGCCTGGCCCTGGGAGACAGG + Exonic
1181651084 22:24259638-24259660 CAGGCCTGGCCCTCGGAGACAGG - Intergenic
1181706298 22:24651101-24651123 CAGGCCTGGCCCTGGGAGACAGG + Intergenic
1181777080 22:25167432-25167454 AAGTCCCAGCACTTGGGGACTGG + Intronic
1181785471 22:25223669-25223691 TAATCCCAGGCCTGGGAGAGAGG + Intronic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1182092287 22:27604038-27604060 CAGTGCCAGCCCAGGGAGGGGGG - Intergenic
1182443368 22:30376746-30376768 CAGCCTCAGCCCTGGGCCACAGG - Exonic
1182942223 22:34287742-34287764 CAGAGCCAGCCCTGGCAGAGTGG + Intergenic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183387842 22:37525310-37525332 CAGTCTCAGCGATGGGAGCCAGG - Intergenic
1183417144 22:37689001-37689023 CAGTCTCAGCCCTGGGAGGAAGG + Intronic
1183457465 22:37930462-37930484 CTGTGCCAGCCCAGGGAGAGAGG - Intronic
1184033118 22:41906261-41906283 GGGGCCCAGCCCTGGGAGGCTGG + Exonic
1184043923 22:41960384-41960406 CTGCCCCAGCCTTGGGTGACTGG - Intergenic
1203215776 22_KI270731v1_random:4965-4987 CAGGCCTGGCCCTGGGAGACAGG + Intergenic
1203274850 22_KI270734v1_random:80426-80448 CAGGCCTGGCCCTGGGAGACAGG - Intergenic
950476810 3:13220001-13220023 CAGCCCCAGTCCTGGGAACCGGG + Intergenic
950581845 3:13867481-13867503 CCGTCTCATTCCTGGGAGACAGG - Intronic
950726595 3:14921080-14921102 CTGTCCTTGCCCTGGGAGATGGG - Intronic
953454453 3:43030704-43030726 CAACCCCAGCCCTGGGAGCATGG - Intronic
953842448 3:46400109-46400131 TAGTCCCAGGCCCGGGAGGCTGG - Intergenic
953850148 3:46459809-46459831 CAGACACAGTCCTGGGAGAGAGG + Exonic
953885409 3:46712158-46712180 CTGTCACAGCCCTGAGAGTCAGG - Exonic
953912072 3:46898333-46898355 CAGTCAGAGCCCTGGGACCCAGG - Intronic
954589632 3:51771736-51771758 AAGTCCCAACCTTTGGAGACTGG + Intergenic
955292033 3:57701038-57701060 CAGTCCCTTGCCTGGGGGACTGG + Intergenic
957136739 3:76298049-76298071 TAGTCCCAGCCCTGAAACACGGG + Intronic
959849336 3:111070240-111070262 TAGACCGAGCGCTGGGAGACTGG + Intronic
960968829 3:123124615-123124637 CAGTTCCAACCCGTGGAGACGGG - Intronic
961167082 3:124770797-124770819 CAGTCACAGCCCCGGAAGGCGGG + Intronic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
961780722 3:129318781-129318803 GAGTCCCAGCCATGGGCAACAGG + Intergenic
962736159 3:138327464-138327486 GAATCTCAGCCCTGGGAGCCAGG + Intronic
963561684 3:146874363-146874385 CATTGCCAGTCCTGGGAGAGAGG - Intergenic
966932610 3:184685619-184685641 AAATCACAGCCCTGTGAGACAGG - Intergenic
967050800 3:185782803-185782825 CAGTCCCCACCCTGGGATCCTGG - Intronic
968611962 4:1561269-1561291 CAGCCACAGGCCTGGGAGCCGGG + Intergenic
969077427 4:4591168-4591190 CAGCCCCAGCCCTGAAAGACAGG - Intergenic
969264998 4:6058607-6058629 CAGTTCCAGCCAATGGAGACAGG + Intronic
969506485 4:7591334-7591356 CCCTCCCAGCCCTGGGACTCTGG - Intronic
969554206 4:7895064-7895086 CAGCCCCAGCCCTGCGAAGCGGG - Intronic
969564836 4:7971558-7971580 CAGAGCCAGACCTGGGAGCCAGG + Intronic
971425383 4:26510260-26510282 GAGGCCCAGCTCTGGGAGAAAGG - Intergenic
972730300 4:41788225-41788247 AAGACCCAGCCCTGGGAGTGGGG + Intergenic
973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG + Intergenic
973383269 4:49333974-49333996 CAGTCCCTGCACTGGGACCCAGG - Intergenic
973386877 4:49518989-49519011 CAGTCCCTGCACTGGGACCCAGG - Intergenic
974366850 4:60961353-60961375 CAGTCCCAGCTCTGGGAGTTAGG - Intergenic
975752584 4:77539230-77539252 CAGTCCCTTCACTGGGAGCCAGG - Intronic
975826489 4:78325186-78325208 AAGACCCAGCCCTAGGAGGCTGG - Intronic
978112248 4:104977160-104977182 CAGTCACAGCCATGGGAGGCAGG + Intergenic
983961380 4:173759282-173759304 CATTCTCAGAACTGGGAGACAGG + Intergenic
984500270 4:180550078-180550100 CAGTAGCAGCCCTGAGAGATCGG + Intergenic
985529003 5:422837-422859 CAGCCCCCGCCCTTGGAGACAGG + Exonic
985549379 5:525228-525250 CAGCCCCAGACCTGGGACGCAGG + Intergenic
985869489 5:2542822-2542844 CTGTCCCAGCTCTGGGACAGCGG - Intergenic
986009348 5:3698345-3698367 CAGCCCCAGCCCTGGGAGTGGGG - Intergenic
986278976 5:6306889-6306911 CAGTCCCAGCTCATGGAGTCTGG - Intergenic
990560000 5:56974455-56974477 CAGGCTCATTCCTGGGAGACAGG + Intergenic
990728986 5:58787635-58787657 TAGTCCCAGCCCAGTGAGGCTGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994130361 5:96220039-96220061 CAGTCTCTGTCGTGGGAGACAGG - Intergenic
995177787 5:109198582-109198604 AAGTGTCAGCCCTGGGAGAAAGG - Intergenic
996562268 5:124843585-124843607 CTCTGCCAGGCCTGGGAGACAGG + Intergenic
998374911 5:141683855-141683877 CAGACCCATTCCTGGGAGATAGG + Intergenic
1000586959 5:163112249-163112271 CAGGCCCATCCCTGGGAAACAGG + Intergenic
1001419024 5:171572929-171572951 CAATCCCAGCCCAGTGAGCCAGG - Intergenic
1001761613 5:174212328-174212350 CAGTTCCAGCCCTGGGCTCCGGG + Intronic
1002298703 5:178245825-178245847 CAGTCCCAGCCCTGGGGAAAGGG + Intronic
1004357770 6:14944970-14944992 CAGTCACAACCTTGGGAAACTGG + Intergenic
1004712745 6:18187950-18187972 CAATGCCAGCCCTGGGAAGCTGG + Intronic
1006050322 6:31337151-31337173 CAGTTCCAGCCAATGGAGACAGG - Intronic
1006085176 6:31590025-31590047 CAATGCCAGCCAAGGGAGACTGG - Exonic
1006419336 6:33923650-33923672 GAGTCCCAGCCCTGGAAGGTGGG + Intergenic
1006808627 6:36805642-36805664 CCGTCCCAGCCCTGGGGCCCAGG - Intronic
1007269442 6:40624897-40624919 CAGCCCCAGCCCTGGGGACCAGG - Intergenic
1007324417 6:41049148-41049170 GAGGCCCAGCTCTGGGAGAAGGG - Intronic
1007743846 6:44030114-44030136 ATTTCCCAGCCATGGGAGACTGG - Intergenic
1011693972 6:89895476-89895498 CACTGCCAGCCCAGGGACACGGG - Exonic
1012271505 6:97217981-97218003 CAGACCCAGCCTTGAGAGACTGG + Intronic
1012445743 6:99305418-99305440 CAGGCCTGGCCCTGGGAGTCTGG - Intronic
1013715588 6:112957063-112957085 CAGTCCCAGAAATGGGAGCCAGG - Intergenic
1014777301 6:125526158-125526180 CAATTCCACCCCTGGGAGAAGGG + Intergenic
1014961790 6:127695370-127695392 GAGTCTCAGGCCTGGGTGACAGG - Intergenic
1015514943 6:134074179-134074201 CAGGACCAGGCATGGGAGACAGG - Intergenic
1016370314 6:143366662-143366684 CTGTCCCAGCCATGGGACAGTGG + Intergenic
1016462818 6:144296133-144296155 CAGTCCAGGCCCTGGGAGTTGGG - Intronic
1017539430 6:155385236-155385258 CAGTCACAGGCCTGGGTGTCGGG - Intergenic
1018066973 6:160131306-160131328 CAGTCACTGCCCCAGGAGACAGG + Intronic
1018198591 6:161376013-161376035 CAGTCCCAGTATTGGGAGATGGG - Intronic
1019427609 7:984799-984821 CAGGGCCAGCCCAGGGGGACGGG + Intronic
1020011760 7:4809181-4809203 CAGTGACAGCCCGGGGAGGCGGG - Intronic
1020125874 7:5532268-5532290 CAGTCCCATCCCCAGGAGGCAGG - Intronic
1020963951 7:14842757-14842779 CATTTAAAGCCCTGGGAGACAGG - Intronic
1021280293 7:18708635-18708657 AAGTCCCAGTATTGGGAGACAGG + Intronic
1021979817 7:26043569-26043591 CAGTGCCAGCCCCTGGAGCCTGG - Intergenic
1022534005 7:31084642-31084664 CAGGCCCTGGCCTGGGAGACTGG + Intronic
1025093139 7:56079341-56079363 CTGTGCCAGTCCTGGGAGAAAGG - Intronic
1026000338 7:66556221-66556243 CAGCCCCAGCCATGGGCGCCCGG - Intergenic
1026878542 7:73893797-73893819 CTGTCCCAGCGCTGGCAGCCAGG + Intergenic
1026962525 7:74417782-74417804 CACTTCCATCCCTGGGAGAGAGG + Intergenic
1029087515 7:98022865-98022887 CAGACCCGCCCCTGGGAGAGAGG + Intergenic
1030141217 7:106305919-106305941 TAGTCTCAGCCCTGTGAGTCAGG - Intergenic
1030348007 7:108455486-108455508 AAGTCCCAGCCCTCGGAGGCAGG + Intronic
1032013343 7:128360675-128360697 CAGGCCCAGCCCCAGGAAACGGG - Intronic
1034825135 7:154255452-154255474 CACTCCCAGCACTGGGGGAAAGG + Intronic
1035174805 7:157042732-157042754 CAGTCCCAGCCCTAGGTCAGGGG + Intergenic
1035352795 7:158258304-158258326 CAGCCCCTGCCCTGCGCGACTGG + Intronic
1035468408 7:159094426-159094448 GAGTGCCAGCCCTGGCTGACGGG - Intronic
1035812012 8:2500389-2500411 CAGTCCGAGAACTGGAAGACAGG - Intergenic
1036922581 8:12872102-12872124 AAGTCCCAGCCCATGGAGGCGGG - Intergenic
1038179496 8:25213179-25213201 CAGGCCCAGACCTAGGAAACGGG + Intronic
1038283229 8:26184144-26184166 CTGCCCCAGCCCTGTTAGACAGG + Intergenic
1038320272 8:26519383-26519405 TAGTCCCAGGACTGGGAGAGAGG + Intronic
1041435232 8:57831870-57831892 CAGAGCCACCCCAGGGAGACTGG + Intergenic
1043923804 8:86014310-86014332 GAGTCAGAGCCCTGGGAGTCTGG - Intronic
1045573405 8:103393311-103393333 CAGTCCCAGCCTAGGAAGCCTGG + Intergenic
1047523253 8:125611916-125611938 CAGTCCCAGCCCAGAGAAACAGG - Intergenic
1047761272 8:127956240-127956262 CAGCCCCAGCCCTGCCAGCCTGG - Intergenic
1048581485 8:135732729-135732751 CCAGCCCAGCCCTGGGACACTGG - Intergenic
1048733485 8:137470994-137471016 CAGGCCAAGGCCAGGGAGACTGG + Intergenic
1049175422 8:141189658-141189680 CAGCCCCAGCCCTGGGTGAGGGG + Intronic
1049223979 8:141440978-141441000 CACTCCCAGCCCTTGGAGGGGGG - Intergenic
1049319452 8:141988247-141988269 GAGTACGAGCCCTGGGAGGCTGG + Intergenic
1049329722 8:142043742-142043764 CAGGCCAAGCCCCGGGAGCCGGG + Intergenic
1049593913 8:143474826-143474848 CCCTCCCAGCCCAGGGAAACAGG - Intronic
1049679949 8:143913666-143913688 CCGTGTCTGCCCTGGGAGACGGG + Intergenic
1053009755 9:34626252-34626274 CACCCCCAGCCCTGGCATACAGG - Intronic
1053464764 9:38297752-38297774 CAGTCCCTGCCCTGGCAGAGTGG + Intergenic
1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG + Intergenic
1053762712 9:41357278-41357300 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1054541315 9:66268392-66268414 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1057775954 9:98009688-98009710 CAGTACCAGTCCTGGGAGTTGGG + Intronic
1057979877 9:99650169-99650191 TAGTTCCTGCCCTGGAAGACTGG + Intergenic
1058206072 9:102109621-102109643 CATTCCCATTTCTGGGAGACAGG - Intergenic
1059352644 9:113676608-113676630 CAGTCACCGACCTGGGAGATGGG + Intergenic
1060229394 9:121815362-121815384 CTGTGGCTGCCCTGGGAGACAGG - Intergenic
1060496844 9:124125538-124125560 CAGCCCCAGCCCAGGCTGACCGG - Intergenic
1060765937 9:126295042-126295064 GAGTCCCAGCTATGGGAGGCAGG - Intergenic
1061013178 9:127967332-127967354 CACACCCAGCCCTAGGAGATGGG + Intronic
1061295801 9:129676078-129676100 CAGACCCAGCCCTGGAAAAACGG - Intronic
1061588713 9:131584459-131584481 CAGTCCCTGCTCTGGGAGCCCGG - Intronic
1061713761 9:132505709-132505731 CAGCCCCAGCCCCAGGAGCCAGG - Intronic
1061735728 9:132656528-132656550 TGATCCCAGCCCTTGGAGACAGG + Intronic
1061780165 9:132991130-132991152 CAGTCCCACCTCCAGGAGACTGG - Exonic
1061938895 9:133873625-133873647 CTTGCCCAGCCCTGGGACACAGG - Intronic
1061954484 9:133954543-133954565 CAGGTCCAGCCATGGGAGGCTGG + Intronic
1062174173 9:135151751-135151773 CAGGCCAAGGCCTGGGGGACGGG - Intergenic
1062197835 9:135284542-135284564 CAGCCACAGCCCTGGCAGCCTGG - Intergenic
1062398644 9:136362960-136362982 CTGGCCCAGCCCTGGGGTACAGG + Intronic
1062572322 9:137191377-137191399 CAGTGCCAGCTCTGGGAGGCTGG + Intergenic
1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG + Intergenic
1203551385 Un_KI270743v1:166810-166832 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1185785050 X:2883808-2883830 CAGTCCCATCCAGGGGTGACAGG + Intergenic
1185836088 X:3346731-3346753 CTGCCCCACCCCGGGGAGACGGG + Intergenic
1186099171 X:6136788-6136810 AAATGCCAGCCCTGAGAGACTGG + Intronic
1186874962 X:13807672-13807694 CCGTGCCAACCCTGGGGGACAGG - Exonic
1189240367 X:39519965-39519987 GTGTCCCAGGCCTGGGAGCCAGG + Intergenic
1190245850 X:48689462-48689484 CAGTGCTAGCCCTGGGAGCCAGG - Intronic
1191033042 X:55996110-55996132 GAATCCCAGCCCTCGAAGACAGG - Intergenic
1192072769 X:67958592-67958614 CACTCCCAACTCTGGGAGAGTGG + Intergenic
1194403033 X:93461610-93461632 CAGTCCCAGCCCTGGCGAAGAGG + Intergenic
1194918604 X:99735097-99735119 CATTCCCAGCCCATGGAGATTGG - Intergenic
1199763468 X:150923623-150923645 CAGTCCCAACCCTGAGGGAATGG + Intergenic
1199896349 X:152131048-152131070 AGGTCCCAGCCCTGGGATGCTGG + Intergenic
1200798270 Y:7361779-7361801 CAGTCCCAGTCGTGGAAGCCAGG + Intergenic
1200834348 Y:7718221-7718243 AAGTCACAGGCCTGGGAGAGGGG + Intergenic
1201240600 Y:11954070-11954092 CTGCCCCACCCCGGGGAGACGGG - Intergenic
1202601071 Y:26593532-26593554 CAGTCACAGCCCTGTCAGGCTGG + Intergenic