ID: 1096479349

View in Genome Browser
Species Human (GRCh38)
Location 12:51927883-51927905
Sequence AGCTACTCGGGAGGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109344
Summary {0: 5, 1: 210, 2: 7956, 3: 41130, 4: 60043}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096479349 Original CRISPR AGCTACTCGGGAGGCCCAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr