ID: 1096482411

View in Genome Browser
Species Human (GRCh38)
Location 12:51951565-51951587
Sequence GCCGCCGCGCGCGCCCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096482411_1096482424 25 Left 1096482411 12:51951565-51951587 CCTTCGGGGGCGCGCGCGGCGGC 0: 1
1: 0
2: 4
3: 29
4: 226
Right 1096482424 12:51951613-51951635 CACGTGCAGGCGCCGGGCGGAGG 0: 1
1: 0
2: 0
3: 17
4: 175
1096482411_1096482418 12 Left 1096482411 12:51951565-51951587 CCTTCGGGGGCGCGCGCGGCGGC 0: 1
1: 0
2: 4
3: 29
4: 226
Right 1096482418 12:51951600-51951622 TCCGCCGGGAGCGCACGTGCAGG 0: 1
1: 0
2: 0
3: 1
4: 62
1096482411_1096482421 18 Left 1096482411 12:51951565-51951587 CCTTCGGGGGCGCGCGCGGCGGC 0: 1
1: 0
2: 4
3: 29
4: 226
Right 1096482421 12:51951606-51951628 GGGAGCGCACGTGCAGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 164
1096482411_1096482423 22 Left 1096482411 12:51951565-51951587 CCTTCGGGGGCGCGCGCGGCGGC 0: 1
1: 0
2: 4
3: 29
4: 226
Right 1096482423 12:51951610-51951632 GCGCACGTGCAGGCGCCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 150
1096482411_1096482422 19 Left 1096482411 12:51951565-51951587 CCTTCGGGGGCGCGCGCGGCGGC 0: 1
1: 0
2: 4
3: 29
4: 226
Right 1096482422 12:51951607-51951629 GGAGCGCACGTGCAGGCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1096482411_1096482415 -2 Left 1096482411 12:51951565-51951587 CCTTCGGGGGCGCGCGCGGCGGC 0: 1
1: 0
2: 4
3: 29
4: 226
Right 1096482415 12:51951586-51951608 GCCGCGGCGCCGGCTCCGCCGGG 0: 1
1: 0
2: 2
3: 51
4: 407
1096482411_1096482425 30 Left 1096482411 12:51951565-51951587 CCTTCGGGGGCGCGCGCGGCGGC 0: 1
1: 0
2: 4
3: 29
4: 226
Right 1096482425 12:51951618-51951640 GCAGGCGCCGGGCGGAGGAGAGG 0: 1
1: 0
2: 4
3: 54
4: 574
1096482411_1096482414 -3 Left 1096482411 12:51951565-51951587 CCTTCGGGGGCGCGCGCGGCGGC 0: 1
1: 0
2: 4
3: 29
4: 226
Right 1096482414 12:51951585-51951607 GGCCGCGGCGCCGGCTCCGCCGG 0: 1
1: 1
2: 6
3: 76
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096482411 Original CRISPR GCCGCCGCGCGCGCCCCCGA AGG (reversed) Intergenic