ID: 1096483054

View in Genome Browser
Species Human (GRCh38)
Location 12:51955739-51955761
Sequence TCCTCTCTGTATTCATAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096483054 Original CRISPR TCCTCTCTGTATTCATAAAA AGG Intronic
900015038 1:142428-142450 TCATCACTCCATTCATAAAATGG + Intergenic
900045304 1:501037-501059 TCATCACTCCATTCATAAAATGG + Intergenic
900067501 1:742767-742789 TCATCACTCCATTCATAAAATGG + Intergenic
901118952 1:6874587-6874609 TCCTCTCTCTAAACATATAAGGG - Intronic
903558957 1:24213529-24213551 ACGTTTCTGTATACATAAAAAGG - Intergenic
907269948 1:53285118-53285140 TACTTTCTTCATTCATAAAATGG - Intronic
907295189 1:53446795-53446817 GCCACTCTGTATTCATGAAATGG - Intergenic
909487456 1:76189544-76189566 TCTACTCTCTATTCATCAAAGGG - Intronic
910091330 1:83467879-83467901 TGCTCTCTGTATACATTACAAGG - Intergenic
910701385 1:90078269-90078291 TCCTCTGTTTATTTTTAAAATGG + Intergenic
911659402 1:100483913-100483935 TTCTCTCTGTTTTTATAAATAGG + Intronic
911701432 1:100957785-100957807 TCCTAACTGTACTCAGAAAATGG - Intronic
912534627 1:110357329-110357351 CACTCTCTGTATCCCTAAAAAGG + Intergenic
918005044 1:180534175-180534197 TCCTGTGTGTGCTCATAAAATGG + Intergenic
918289806 1:183095976-183095998 TTCTCTCTGTATGCATATAATGG + Intronic
918640553 1:186836482-186836504 TACTATATGTATTAATAAAATGG - Intronic
918669958 1:187202683-187202705 CCCTCTCTTTATTCATATGAAGG - Intergenic
919347502 1:196403701-196403723 TTCTCTCTGTAAACCTAAAATGG + Intronic
921605086 1:217142273-217142295 TCAACTCTGTAGTCAAAAAAAGG + Intergenic
922102105 1:222485540-222485562 TCATCACTCCATTCATAAAATGG + Intergenic
922263188 1:223960651-223960673 TCATCACTCCATTCATAAAATGG + Intergenic
923974038 1:239239617-239239639 TCATCTCTGACCTCATAAAAGGG + Intergenic
924566217 1:245200630-245200652 TTCTCTCTGTTTTCAGAAAGGGG + Intronic
1063293594 10:4777671-4777693 TCCACTCTGTATTCTTAGAAAGG - Intergenic
1063443709 10:6094487-6094509 TTCTTTCTTTATTCTTAAAATGG - Intronic
1063529273 10:6815272-6815294 TCCTGTTTGTTTGCATAAAAGGG - Intergenic
1064437241 10:15321681-15321703 TCTTTTCTGTTTTCATTAAAGGG - Intronic
1064522006 10:16212137-16212159 TCCTGTCTCTATTTAAAAAACGG + Intergenic
1065790590 10:29256677-29256699 TCCTCTCTCTTTACATTAAAAGG + Intergenic
1066731305 10:38439417-38439439 TCATCACTCCATTCATAAAATGG - Intergenic
1067734957 10:48843436-48843458 TCATCTCTGTGTTCATAGAAAGG - Intronic
1070839884 10:79477581-79477603 TCCACACTGTATTCATCACAAGG - Intergenic
1071020109 10:81043768-81043790 TCCCCGCTGACTTCATAAAATGG + Intergenic
1071088259 10:81889338-81889360 TCCTTTCTGTACTCATCACATGG + Intronic
1071322021 10:84471213-84471235 TGCTCTATTTATTCATGAAATGG - Intronic
1072329835 10:94336756-94336778 TCCTGTCTGTATTTAAAAAAAGG + Intronic
1072413390 10:95226676-95226698 GCCTCTCTTTATAGATAAAATGG - Intronic
1072967284 10:99984912-99984934 TCCTGTCTGTACACAAAAAAGGG - Intronic
1073999018 10:109349017-109349039 TTCTCTCTATATTCAGAAAAAGG + Intergenic
1074366212 10:112859513-112859535 TCCTCGCTGTGTTTATTAAATGG - Intergenic
1076971631 11:137528-137550 TCATCACTCCATTCATAAAATGG + Intergenic
1078029009 11:7729480-7729502 TCCTCTCTGTAGTAGGAAAATGG - Intergenic
1079328042 11:19511363-19511385 TACTCTCTGTCTCCATAAACTGG - Intronic
1079488808 11:20964544-20964566 TCTTGTCTGTACTCATAAAATGG - Intronic
1079642768 11:22828107-22828129 TACTCTCTTTTTTAATAAAAAGG + Intronic
1080168508 11:29269787-29269809 TCCGCTGTGTCTGCATAAAATGG + Intergenic
1081957870 11:47109237-47109259 TGCTCTCTGGATTCAGACAATGG + Intronic
1085076276 11:73595970-73595992 TCTTCTCTGTTTACATAAAGCGG + Intronic
1086644419 11:89202155-89202177 TGCTCTTTGTATTGATAATAAGG - Intronic
1086694862 11:89831360-89831382 TCGGTTCTGTATTTATAAAATGG + Intergenic
1086711286 11:90013136-90013158 TCGGTTCTGTATTTATAAAATGG - Intergenic
1086844023 11:91725819-91725841 TCCTTTCTTTATTAATTAAAAGG - Intergenic
1087315890 11:96601758-96601780 TCCTCATTGTTTTCAAAAAAGGG + Intergenic
1087467585 11:98528171-98528193 TCCTCTCTATTTTAATAATATGG - Intergenic
1087902224 11:103653846-103653868 TCCTTTCTGCATTCTTATAATGG + Intergenic
1088182000 11:107122830-107122852 TCCTCTGTGTATTTTTAAATAGG - Intergenic
1090111361 11:123912431-123912453 TCCTCTCTGTATTTTCAAATAGG - Intergenic
1091032079 11:132199551-132199573 TCCCCTCTGTATCCATAGATAGG + Intronic
1092606790 12:10129060-10129082 GGATCTCTGTATTCATAGAATGG - Intronic
1093710899 12:22328843-22328865 TCATTTCTCTATCCATAAAATGG - Intronic
1093858331 12:24133126-24133148 CCCACTCTGTTTTAATAAAAAGG + Intergenic
1095527283 12:43142404-43142426 TACTTTCTATATTCATAAAACGG - Intergenic
1096483054 12:51955739-51955761 TCCTCTCTGTATTCATAAAAAGG + Intronic
1097250249 12:57628525-57628547 TTCTCTCTGAATTCTTAGAATGG - Intronic
1097879957 12:64677760-64677782 TTCTCTTTGTATTCATCACAGGG + Intronic
1098343586 12:69476514-69476536 TACTTGCTGTATTAATAAAAAGG - Intronic
1100673636 12:96843449-96843471 TCCTCACTGTATTTCTGAAAAGG - Intronic
1101554400 12:105794575-105794597 TCCTCACTGTATTCCTGTAAGGG - Intergenic
1101564736 12:105894847-105894869 TCCCATCTGTAATCATAATAAGG - Intergenic
1101859805 12:108473892-108473914 TTCTCTCTGTATTCAGGAGATGG - Intergenic
1104287353 12:127436203-127436225 TCCTCACTCTGTTCACAAAAAGG - Intergenic
1105665077 13:22545499-22545521 TTCTCTTTTTAATCATAAAAGGG + Intergenic
1106556883 13:30817474-30817496 TCCTCTCTGTTTTCAGATACGGG - Intergenic
1108153377 13:47559656-47559678 TCATGTCTATATTCAAAAAAAGG + Intergenic
1108462533 13:50680997-50681019 TACTATCTGTGTTCACAAAATGG + Intronic
1108649747 13:52466086-52466108 TCCTTTCTGCATACAGAAAATGG + Intronic
1110039823 13:70739681-70739703 TCCAAACTGTATTTATAAAAGGG - Intergenic
1110112089 13:71760426-71760448 TGCGCTCTGTATTCAAACAAGGG + Intronic
1110732588 13:78896273-78896295 CCCTTTGTGTGTTCATAAAAAGG + Intergenic
1111002419 13:82203187-82203209 TACTTTCTTTGTTCATAAAATGG + Intergenic
1111947364 13:94679874-94679896 ATCACTCTGTATTCAAAAAAAGG - Intergenic
1112506420 13:99979063-99979085 CCCTCTCTCTGTGCATAAAAGGG - Intergenic
1112849716 13:103690497-103690519 TCCTCTTTAAACTCATAAAATGG - Intergenic
1112918906 13:104585995-104586017 TTCTCTATGTATTCTCAAAAAGG + Intergenic
1114927083 14:27416590-27416612 TATTTTCTGTATTTATAAAAAGG + Intergenic
1115990699 14:39146596-39146618 TCCTCTCTGTATTGATCATGTGG - Intergenic
1118513846 14:66506003-66506025 AACTTTCTGCATTCATAAAAGGG - Intergenic
1120182834 14:81363181-81363203 TTGTTTCTGCATTCATAAAATGG + Intronic
1120234929 14:81879558-81879580 TCCTCTGGCTTTTCATAAAATGG + Intergenic
1120554839 14:85916821-85916843 TCCTTTCTGTATTCTTACATGGG + Intergenic
1127830960 15:62750814-62750836 TCCTCTCTTTTTTCACAAATGGG + Intronic
1128220800 15:65967086-65967108 TCCTCTTCTTTTTCATAAAATGG + Intronic
1128630863 15:69265422-69265444 TCCTCTGTATATCTATAAAATGG + Intronic
1128662168 15:69509698-69509720 TCCTTTCCCTATCCATAAAATGG - Intergenic
1129028524 15:72601938-72601960 TAGTATCTGTATTAATAAAAAGG - Exonic
1131194034 15:90340756-90340778 CCCTCTCTTTAAACATAAAAGGG + Intergenic
1131750967 15:95507748-95507770 ATTTCTCTGTATCCATAAAATGG - Intergenic
1133531497 16:6659237-6659259 CCCTGTCTGTGTTTATAAAATGG - Intronic
1133741032 16:8651601-8651623 CCCTCTCTCTATAAATAAAAGGG + Intergenic
1133763316 16:8817404-8817426 TCCTCTCTGTCTACAAGAAATGG - Intronic
1135048140 16:19170719-19170741 GCTTCCCTGTATTCAGAAAATGG + Intronic
1135297769 16:21297784-21297806 TCCTCTCAGTAAACATAGAAAGG + Intronic
1137887091 16:52117436-52117458 TTCTCACTGTATTCACAAACAGG - Intergenic
1138110660 16:54321203-54321225 TCCTGTGTGCATTCATTAAAGGG + Intergenic
1138901575 16:61276654-61276676 TTCTACCTGTATTCATGAAAAGG + Intergenic
1140124423 16:72107864-72107886 TTCTCTCTGTATTACTGAAATGG + Intronic
1140242258 16:73213851-73213873 TCCTCTCAGTTTTCAGAAGATGG + Intergenic
1140450746 16:75068969-75068991 CCCTCTCTTCATTCAGAAAATGG + Intronic
1141059547 16:80853126-80853148 CCCTCTCTGTGTTCCTACAATGG + Intergenic
1142448617 16:90159994-90160016 TCATCACTCCATTCATAAAATGG - Intergenic
1142458868 17:75295-75317 TCATCACTCCATTCATAAAATGG + Intergenic
1146813566 17:35923867-35923889 TCCTTTTTTTACTCATAAAAGGG - Intronic
1147596208 17:41719343-41719365 GTCTCTCTGAATACATAAAATGG - Intronic
1148046482 17:44748071-44748093 TCCTCTGTGAAGTCATGAAATGG + Intronic
1149572835 17:57685825-57685847 TTCTCTCAGGATTCCTAAAAGGG - Intergenic
1151867262 17:76812275-76812297 TCCTCTCTCTATTCTCAGAAGGG + Intergenic
1153694233 18:7624289-7624311 TGAACTCTGTATTCATAATAAGG + Intronic
1158169606 18:54582588-54582610 TCTACTCTTTATTCAAAAAAAGG + Intergenic
1159747539 18:72256476-72256498 TTCTCTCTGTTTTTCTAAAAAGG - Intergenic
1160023040 18:75195555-75195577 TCTTTTCTTCATTCATAAAATGG + Exonic
1160130402 18:76220094-76220116 GACTTTCTTTATTCATAAAATGG - Intergenic
1160648587 19:207808-207830 TCATCACTCCATTCATAAAATGG + Intergenic
1161280742 19:3444236-3444258 TCCTCTCTGTATTTGACAAAAGG - Intronic
1162290574 19:9776985-9777007 TCTTCTCTGTGGTCATCAAATGG + Intronic
1168331531 19:55572672-55572694 TCCTCTCTGCATCCAGAAAATGG + Intergenic
926158784 2:10473730-10473752 TTCTCTCTTTTTTCATAAAAAGG - Intergenic
926468249 2:13218399-13218421 TCCTCTCATTACTCATAACAGGG - Intergenic
927981001 2:27375166-27375188 TCCTCTCTGTCTTCCTCTAAGGG + Intronic
928563731 2:32520053-32520075 TTCTATCTGTATACATAAGAAGG + Intronic
928678840 2:33678416-33678438 TTGTCTCTGTTTTCAAAAAAAGG + Intergenic
929275294 2:40018674-40018696 TCCTTGCTAAATTCATAAAATGG - Intergenic
931327230 2:61239203-61239225 GCCTCTCTGTATCCAGTAAAAGG + Intronic
931605416 2:64047838-64047860 TCCTACCTGTATTCACAAACAGG - Intergenic
931958233 2:67452106-67452128 TCTTCTCTGGATTTTTAAAATGG - Intergenic
932963013 2:76437507-76437529 TCCTCACTCTATTCATAAGTTGG + Intergenic
935548113 2:104422297-104422319 TCATCTCTTTATTCTAAAAATGG - Intergenic
936038823 2:109133457-109133479 TCAGCTCTGTACTCAAAAAATGG - Intronic
936639572 2:114297102-114297124 TTCTATCTGTATGCATACAATGG + Intergenic
938285805 2:130115490-130115512 TGCTCGCTGTATTAATGAAAGGG + Intronic
938429799 2:131223412-131223434 TGCTCGCTGTATTAATGAAAGGG - Intronic
938739834 2:134220581-134220603 TCCTCTCTGTTTTCCTTAAGAGG + Intronic
939306053 2:140413800-140413822 TCATCTATTTATTGATAAAATGG + Intronic
939395214 2:141620266-141620288 TACTTTGTATATTCATAAAAGGG + Intronic
939663288 2:144917738-144917760 TCATCTCTGTATTCTAAACATGG + Intergenic
940560777 2:155293055-155293077 TCCTCTTTGTACTCATAAGTGGG + Intergenic
943251480 2:185525917-185525939 TCCTCTCTTGATTTATAAAAAGG + Intergenic
945787659 2:214262651-214262673 TCATCTCCGTATCTATAAAATGG + Intronic
946459198 2:219854131-219854153 TCCTCTCTGGAGTCAGAAACGGG + Intergenic
947695842 2:232187861-232187883 TCCTTTCTTTATTTTTAAAAAGG + Intronic
947963177 2:234257193-234257215 TGCTCTCTATGTTTATAAAATGG - Intergenic
1170343588 20:15357014-15357036 TCTTCTTTCTATTCATATAAAGG - Intronic
1170779694 20:19413223-19413245 TTCTTTCTGTTTTCAGAAAATGG - Intronic
1173552417 20:43941889-43941911 TGCTGTCTTTATTCACAAAACGG - Intronic
1173934765 20:46851736-46851758 TCCTATCTTTATTCTTATAAGGG + Intergenic
1177234612 21:18371928-18371950 TCCTTTCTGTAGTGATCAAATGG + Intronic
1177282533 21:19001424-19001446 TCATTTGTGTATTTATAAAATGG - Intergenic
1177474652 21:21604010-21604032 TCCTGATAGTATTCATAAAACGG - Intergenic
1178262271 21:31110823-31110845 TCCCCTCTGTATTGAGAACAGGG - Intergenic
1179471653 21:41614356-41614378 TCCTCACAGTGTTCTTAAAAGGG + Intergenic
1182761202 22:32723684-32723706 TCCGCTCTATTTTCATAAAGGGG - Intronic
1183006556 22:34907700-34907722 TCCTCTCAGTATATATAAATGGG + Intergenic
1184792189 22:46707096-46707118 TCCTGTCTTCATCCATAAAATGG + Intronic
949464833 3:4333427-4333449 TCCTTTCTGTATTCACTAAATGG - Intronic
949866283 3:8550100-8550122 TCCTTTCTGTTTTCTCAAAATGG - Intronic
951356431 3:21672481-21672503 TCCTCTCTGTGGTCATAAGCAGG - Intronic
951843507 3:27060941-27060963 ACATGCCTGTATTCATAAAATGG + Intergenic
952466774 3:33597438-33597460 TCCTCCCTGTATTAATGATAAGG + Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953352432 3:42225560-42225582 CTCTCTCTGAATACATAAAATGG - Exonic
956246120 3:67185599-67185621 TCCTCTCTAAATTCTTATAAGGG - Intergenic
956622036 3:71231014-71231036 TCCGCTCTTTAATCATAAGAAGG + Intronic
957304552 3:78440972-78440994 TCCTATTCCTATTCATAAAATGG - Intergenic
958907209 3:99955212-99955234 TCTTCTCTGTAGTAATAAAGTGG + Intronic
959310326 3:104727808-104727830 TCCTGTCTGTATTCAGCAAACGG + Intergenic
959610214 3:108285429-108285451 TCCACTCTGTAGTAATGAAATGG + Intergenic
959627677 3:108471187-108471209 TCATCTGTGTTTTCATAAAGAGG - Intronic
960355714 3:116650851-116650873 TCCTTTCATTGTTCATAAAATGG - Intronic
966216788 3:177511800-177511822 TCCCCTTTATATTTATAAAATGG + Intergenic
967402589 3:189080532-189080554 TCCTCTCTGTATCACTACAAGGG - Intronic
968369261 3:198212307-198212329 TCATCACTCCATTCATAAAATGG - Intergenic
969258400 4:6018713-6018735 TCCTCTCTGTGTTCATCACTAGG - Intergenic
969861649 4:10040542-10040564 ACCTCTCTGAATGTATAAAATGG - Intronic
970722536 4:19004925-19004947 TCATCTCTATGTTTATAAAAAGG + Intergenic
972117142 4:35650681-35650703 TCCTCTTTGGATTAAGAAAATGG + Intergenic
973851091 4:54962367-54962389 TCTGTACTGTATTCATAAAATGG + Intergenic
974943099 4:68491780-68491802 TCTAATCTGTATTCATAAAATGG + Intronic
975604671 4:76142564-76142586 TCCTCTCTTCACCCATAAAATGG + Intronic
975829587 4:78355557-78355579 TCCTGCCTGTAATCAAAAAAAGG - Intronic
976123386 4:81806974-81806996 TCATCTCTTCATTCTTAAAATGG - Intronic
976562962 4:86522694-86522716 TCCTATCTGTAGTCAGCAAATGG - Intronic
976681591 4:87762392-87762414 TACTTTCTGCATTCGTAAAATGG - Intergenic
977334439 4:95678586-95678608 TTCTCTCTCTATTAATAAAGTGG - Intergenic
977714256 4:100163591-100163613 TCTTCTCTTTATTCATAAAATGG - Intergenic
979257688 4:118622035-118622057 TCATCACTCCATTCATAAAATGG - Intergenic
979330659 4:119418527-119418549 TCATCACTCCATTCATAAAATGG + Intergenic
980463500 4:133147810-133147832 TCCTATCTCTTTGCATAAAAAGG + Intergenic
983057267 4:163112759-163112781 TCCTCTTTGTACTGAGAAAATGG - Intronic
986192377 5:5509431-5509453 TCCTCTCAGTAGTCATACCATGG + Intergenic
986556048 5:9010594-9010616 TCATCTCTGCTTTTATAAAAAGG - Intergenic
986640965 5:9871640-9871662 TTCTCTCTTCATGCATAAAAAGG + Intergenic
986774202 5:10998869-10998891 TCCCGGCTGTATTAATAAAATGG - Intronic
987499667 5:18692448-18692470 TCATCTCAGTATTCTCAAAATGG + Intergenic
987764883 5:22213225-22213247 AACTCTCTGAATTTATAAAAAGG + Intronic
988259552 5:28866966-28866988 TACTCAGTGTATTTATAAAATGG + Intergenic
988663233 5:33296902-33296924 CCCTCTCTGCATTTATAAGAAGG + Intergenic
990387451 5:55280077-55280099 TCCTGACTGTCTTCATAAAGAGG + Intronic
990550649 5:56874677-56874699 TCAACTCTGTATTCATATTAAGG - Intronic
990795686 5:59537940-59537962 ACTTCCCTGTAATCATAAAATGG - Intronic
991899621 5:71446371-71446393 AACTCTCTGAATTTATAAAAAGG + Intergenic
992421377 5:76609001-76609023 TCCTCTGTTTATAAATAAAAGGG - Intronic
993583778 5:89698038-89698060 TCATTTCTGTATTTGTAAAATGG - Intergenic
994556130 5:101306591-101306613 TACTCTCTGTATGCAGAATATGG - Intergenic
994752788 5:103759479-103759501 TCCTCTCTGTAATAAGAAACAGG + Intergenic
995229680 5:109745023-109745045 TCCTCTCAGAATTCATAAAATGG - Intronic
995554930 5:113317856-113317878 TCCTTTTGGTATTCACAAAATGG - Intronic
995903519 5:117096101-117096123 TCCTCTTTGTATTTTTATAATGG + Intergenic
996102018 5:119453661-119453683 TCATATCTGTATTGATAAAGTGG + Intronic
996580971 5:125032024-125032046 TCCTTTCTGTCTTCAAATAAAGG + Intergenic
997360694 5:133292928-133292950 TACTCTCTGGAATCATAAAAAGG - Intronic
1000715158 5:164633649-164633671 TCTTCACTGTATTAATAACAAGG - Intergenic
1002728540 5:181317892-181317914 TCATCACTCCATTCATAAAATGG - Intergenic
1003192951 6:3890117-3890139 GCCTCTCTACATTCAAAAAATGG - Intergenic
1003653954 6:7988359-7988381 TCTTCTCTGTCCTCATAAATGGG + Intronic
1005640789 6:27794129-27794151 TCCTCCCTGTATTCTCAGAAAGG + Intergenic
1006206559 6:32348937-32348959 TCCTCTCTTTATTCTTTAATCGG + Intronic
1007001835 6:38320673-38320695 TTCTGTCAATATTCATAAAAAGG - Intronic
1007319096 6:41013528-41013550 TCCTATCTGCATCCTTAAAATGG + Intergenic
1007376425 6:41459974-41459996 TCCTCTCTGCATTCCCAAAGCGG + Intergenic
1008391185 6:50953607-50953629 TCCCTTCTGTATTGCTAAAATGG - Intergenic
1008943074 6:57068593-57068615 TCTTCACTGTGATCATAAAATGG - Intergenic
1009412830 6:63386213-63386235 TCCTATCTATATTCACAAAGGGG - Intergenic
1009788885 6:68373914-68373936 TCCTATCTGTATTCCTGAGAAGG - Intergenic
1012259980 6:97077021-97077043 TCCTCTCTGTCTTCAGAAAGTGG - Intronic
1012503245 6:99914401-99914423 TGCGATCTGTATTCATTAAATGG - Intergenic
1012807542 6:103913691-103913713 TCATCTCTGTATTATCAAAATGG + Intergenic
1016191058 6:141264936-141264958 TCCCCTCTTTATTCTTTAAAGGG - Intergenic
1016601242 6:145863521-145863543 TCCTCTTTGTCTTAATAACATGG - Intergenic
1017187347 6:151615323-151615345 TCCATTCTTTATTCATAAAAAGG + Intronic
1020992084 7:15211148-15211170 TTGTTTCTGTATTTATAAAATGG + Intronic
1021575357 7:22101274-22101296 TCCACTGTGCATCCATAAAAAGG + Intergenic
1021711520 7:23420736-23420758 TCCTGTCTACAATCATAAAATGG + Intronic
1022424798 7:30258078-30258100 TTCTCTCTGTCTTCAAAGAATGG - Intergenic
1023399672 7:39783294-39783316 TCATCACTCCATTCATAAAATGG - Intergenic
1023488299 7:40710531-40710553 TCCTCTAGATCTTCATAAAAAGG + Intronic
1024072605 7:45799094-45799116 TCATCACTCCATTCATAAAATGG - Intergenic
1024650728 7:51401084-51401106 TCATCACTTCATTCATAAAATGG + Intergenic
1025857886 7:65299647-65299669 TCCTTTCTGTCTTCTTCAAAGGG + Intergenic
1026510997 7:71027330-71027352 TCCTCTCTGCATTGATAGAAGGG - Intergenic
1027308173 7:76924328-76924350 TGCTCTCTGTATACATTACAAGG - Intergenic
1029274864 7:99398008-99398030 TCTTCTCTGTGTGGATAAAATGG + Exonic
1030521713 7:110606060-110606082 TGCTCTCTGTATTTAGAAAATGG + Intergenic
1031378660 7:121058882-121058904 TCCTCTCTTTGTTCATTATAAGG - Intronic
1032049995 7:128642776-128642798 TCATCACTCCATTCATAAAATGG - Intergenic
1033524889 7:142201502-142201524 ACCTAACTGTATTCTTAAAATGG - Intronic
1033707689 7:143904828-143904850 TCCTTTTTGTATTAATATAAAGG - Intergenic
1033915248 7:146315879-146315901 TGTTCTCTCTTTTCATAAAAAGG + Intronic
1038514313 8:28171750-28171772 TCCTCTCTGTTTTCTTCTAAGGG + Intronic
1038827465 8:31020156-31020178 TCCTCTCTGTACGTATAGAATGG - Intronic
1039164626 8:34663914-34663936 AGCTCTCGTTATTCATAAAATGG - Intergenic
1041608541 8:59815709-59815731 TACTCTCTCTATCCTTAAAATGG + Intergenic
1043671511 8:82891023-82891045 ACCTTTCTTTATACATAAAACGG - Intergenic
1045767664 8:105693813-105693835 ATCTCTCTGTAGTCATACAATGG + Intronic
1047295601 8:123568167-123568189 CCCTCTCTGGGTTTATAAAATGG + Intergenic
1047695909 8:127403568-127403590 CCCTCTCTTTAGACATAAAAAGG + Intergenic
1048018752 8:130519804-130519826 TCCTCTCTGTATGCCTGAGATGG + Intergenic
1048736072 8:137503485-137503507 TCATCTCTGTATTTTTACAAAGG + Intergenic
1050021521 9:1289452-1289474 TCCTCTTTACATTGATAAAATGG - Intergenic
1051192097 9:14524053-14524075 TCCCCTCTCTATTAGTAAAATGG + Intergenic
1052449973 9:28616644-28616666 TTCTGTCTGTTTTCATTAAAGGG - Intronic
1052492020 9:29181801-29181823 TCCTCTGAGTATTAAAAAAAAGG + Intergenic
1052806382 9:33017558-33017580 TCCTATCAGAATTCATAAATTGG - Intronic
1053298864 9:36934693-36934715 CCTTCTCTGTGTTCCTAAAATGG + Intronic
1053336996 9:37283742-37283764 TCCTTTCTGTTTTAATAAACTGG - Intronic
1054900819 9:70367801-70367823 TCCTCTCTGACTACATAAACCGG + Intergenic
1056569072 9:87800095-87800117 TCCTCTTTTTGTTCATAAAGTGG - Intergenic
1056676861 9:88683278-88683300 TCCTCTCTGCATCTACAAAAAGG + Intergenic
1056945085 9:90987863-90987885 TCCTCTGTGTGTTTATATAATGG + Intergenic
1057645305 9:96868199-96868221 TCCTATCAGTATTCCTAAATTGG - Intronic
1058470923 9:105278027-105278049 TCCTCCCTGTATTGAAACAATGG - Intronic
1059598709 9:115752280-115752302 TGCTCTCCGTATTCAGAAAGAGG - Intergenic
1059680167 9:116578064-116578086 TCCACTCTGTAGTCAGAGAAAGG - Intronic
1059859280 9:118440019-118440041 TCCTAGCAGTATTCATGAAAGGG - Intergenic
1059959305 9:119549870-119549892 TCTTCTCTGGGTTCATAAGATGG - Intergenic
1060033095 9:120232452-120232474 TCTTCTCTGTCTTCCTCAAATGG - Intergenic
1062088876 9:134663647-134663669 TCTTCTCTGTATTCATAATCTGG - Intronic
1062286954 9:135777637-135777659 TCCTCTCAGCTTTCCTAAAAAGG + Intronic
1062647349 9:137555450-137555472 TCCTCTCTGCATTCATGACAGGG + Exonic
1062753602 9:138274991-138275013 TCATCACTCCATTCATAAAATGG - Intergenic
1203576115 Un_KI270745v1:9770-9792 TCATCACTCCATTCATAAAATGG - Intergenic
1186686593 X:11931053-11931075 TCCTCTCTTTAGTCATGAACTGG - Intergenic
1188582462 X:31731111-31731133 TCCTCTCTGTATTGAAAAATTGG + Intronic
1188858384 X:35225514-35225536 TCCTCTCTTGATTCATGCAAAGG + Intergenic
1195323310 X:103738522-103738544 TCCTGTCTGCATTCATTGAATGG - Intergenic
1197450772 X:126613873-126613895 TCATCTCTCTCTTCATAATAGGG + Intergenic
1197851702 X:130868917-130868939 TCCTCTTCCTACTCATAAAATGG + Intronic
1198157133 X:133972267-133972289 TCCTTTCTGTTTTCAGAAACAGG - Intronic