ID: 1096485007

View in Genome Browser
Species Human (GRCh38)
Location 12:51974156-51974178
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1828
Summary {0: 2, 1: 0, 2: 18, 3: 180, 4: 1628}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096485007_1096485020 30 Left 1096485007 12:51974156-51974178 CCCCCACCACCTCCACCCGCCAA 0: 2
1: 0
2: 18
3: 180
4: 1628
Right 1096485020 12:51974209-51974231 CCCCAGCCTCAGTGTTCTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096485007 Original CRISPR TTGGCGGGTGGAGGTGGTGG GGG (reversed) Intronic
900104548 1:976728-976750 TTGGCGGGGGGAGTGGGAGGCGG - Intronic
900104563 1:976760-976782 TTGGCGGGGGGAGTGGGAGGCGG - Intronic
900104578 1:976792-976814 TTGGCGGGGGGAGTGGGAGGCGG - Intronic
900104593 1:976824-976846 TTGGCGGGGGGAGTGGGAGGCGG - Intronic
900104608 1:976856-976878 TTGGCGGGGGGAGTGGGAGGCGG - Intronic
900104623 1:976888-976910 TTGGCGGGGGGAGTGGGAGGCGG - Intronic
900104638 1:976920-976942 TTGGCGGGGGGAGTGGGAGGCGG - Intronic
900158658 1:1213327-1213349 CTGGCGGCTGGAGGCGGTGGAGG - Intronic
900172449 1:1275595-1275617 CTGGGGGCTGGAGGAGGTGGGGG - Intergenic
900182343 1:1317027-1317049 TTGGGAGGCGGAGGTGGAGGCGG - Intronic
900243019 1:1625792-1625814 CTGGTGGGTGGAGGTGGGTGGGG + Intronic
900243103 1:1626084-1626106 GAGGGGGCTGGAGGTGGTGGCGG + Intronic
900285268 1:1896022-1896044 CTGGGGGGTGGAGGAGGTGATGG + Intergenic
900303310 1:1988834-1988856 TGGGGGGGTGGGGGTGGGGGTGG - Intronic
900385298 1:2407859-2407881 GTGGCAGGTGGACATGGTGGTGG + Intronic
900394332 1:2446962-2446984 TGGCCTGGTGGAGGTGGAGGTGG + Intronic
900975147 1:6012045-6012067 GTGGTGGGTGGAGGTGATGAAGG + Intronic
900975174 1:6012165-6012187 GTGGTGGGTGGAGGTGGAGATGG + Intronic
900975197 1:6012251-6012273 GTGGTGGGTGGAGGTGGAGATGG + Intronic
900975210 1:6012303-6012325 GTGGTGGGTGGAGGTGGAGATGG + Intronic
900975242 1:6012425-6012447 GTGGTGGGTGGAGGTGGAGATGG + Intronic
900975274 1:6012547-6012569 GTGGTGGGTGGAGGTGGAGATGG + Intronic
900975293 1:6012620-6012642 GTGGTGGGTGGAGGTGGAGATGG + Intronic
901056458 1:6450739-6450761 ACAGCGGGTGGGGGTGGTGGGGG - Intronic
901143035 1:7047787-7047809 TTGGTGGGTGGTGATGGTGGTGG + Intronic
901145076 1:7059274-7059296 GTGGTGGGTGGAAGAGGTGGGGG + Intronic
901159348 1:7163262-7163284 TTGGTGGCTGGAGGTGTGGGTGG + Intronic
901171507 1:7261624-7261646 TTTGCGGATGGTGGAGGTGGAGG + Intronic
901214545 1:7548495-7548517 TTTAGGGGTGGAGGTGCTGGTGG + Intronic
901229408 1:7633593-7633615 TTGGCTGGGGGAGCTGGTGCAGG - Intronic
901344100 1:8523556-8523578 TTGTCTGGTGGAGGAGGTGAGGG - Intronic
901510686 1:9716800-9716822 TTGGGAGGTGGAGGTGGGGCAGG + Intronic
901882974 1:12204799-12204821 TTTGTTGGTGGTGGTGGTGGTGG - Intronic
901897565 1:12327476-12327498 AAGGAGGGTGGGGGTGGTGGGGG - Intronic
901947912 1:12718644-12718666 TAGCCGGGTGGGTGTGGTGGTGG - Intronic
901973056 1:12923163-12923185 TTGGGGGGTAGGGATGGTGGGGG + Intronic
902012125 1:13278600-13278622 TTGGGGGGTAGGGATGGTGGGGG - Intergenic
902149337 1:14430189-14430211 TTGCAGGGCAGAGGTGGTGGAGG - Intergenic
902243246 1:15102468-15102490 TTTGAGGTGGGAGGTGGTGGGGG + Intronic
902308949 1:15565759-15565781 TTGGCGGGTGGAGGTGGTGGAGG - Intronic
902410235 1:16207885-16207907 ATGCCGGGTGGGGGTGGGGGTGG - Intronic
902741920 1:18444878-18444900 TTGTCTGGGGCAGGTGGTGGTGG - Intergenic
902921519 1:19668549-19668571 TTAAGGTGTGGAGGTGGTGGTGG - Intronic
903196900 1:21696882-21696904 GTGGCCGGTGGGGGCGGTGGGGG + Intronic
903462511 1:23529748-23529770 TGGGGGAGTGGAGGTGGTGGTGG - Intronic
904019142 1:27449018-27449040 TAGGCTGGTGGGGGTTGTGGTGG - Intronic
904118362 1:28178621-28178643 TGGGGGGCTGGAGGTGGAGGAGG - Intronic
904244969 1:29181448-29181470 TGCGCGGGTGGGGGTGGTGGAGG - Intronic
904301855 1:29559306-29559328 ATGGTGGGTGGAGGTGGGTGGGG + Intergenic
904412481 1:30332839-30332861 TTGGGCGGGGGAGGTGTTGGGGG - Intergenic
904466178 1:30708905-30708927 TTGGCAGGGGGTGGGGGTGGGGG - Intergenic
904478956 1:30782422-30782444 TGGGCTGGTGGGGGTGGTCGGGG - Intergenic
904494601 1:30879547-30879569 TTGGCTGGTTCAGGTTGTGGAGG - Intronic
904509691 1:30993635-30993657 ATGGGGGCTGGTGGTGGTGGTGG - Intronic
904588023 1:31590825-31590847 GTGGCTGGTGGAGGTGGCTGAGG - Intergenic
905126055 1:35716995-35717017 TTGGCGGGGGGCGGTGGTGGAGG - Intronic
905127600 1:35726467-35726489 ATGCTGGGTGGTGGTGGTGGGGG + Intronic
905307633 1:37030537-37030559 TGGGGGGGGGGAGGGGGTGGGGG - Intronic
905364027 1:37439115-37439137 GTGGCAGGTGGTGGTGGTGGGGG - Intergenic
905402232 1:37712103-37712125 TTGGGTGGTGGATATGGTGGAGG + Intergenic
905450701 1:38054214-38054236 GTGGAGGGTGGAAGTGGTGAAGG + Intergenic
905665614 1:39761416-39761438 ATTGGGGGTGGGGGTGGTGGTGG - Intronic
905978885 1:42204687-42204709 GTGGGGGGTGGTGGTAGTGGTGG - Intronic
906083141 1:43107518-43107540 GGGGCGGTGGGAGGTGGTGGGGG + Intergenic
906198535 1:43945002-43945024 TTCACTGGTGGAGGTGGTGGTGG - Intergenic
906509608 1:46403453-46403475 ATGGCGGGAGATGGTGGTGGCGG - Intronic
906564005 1:46783675-46783697 TGTTCTGGTGGAGGTGGTGGAGG + Intronic
906682504 1:47738942-47738964 TGGGGGGGTGGGGGTGGTGGTGG + Intergenic
907050301 1:51325796-51325818 GTGGGGGATGGAGGTGGTGAGGG - Intronic
907055208 1:51359984-51360006 TTGGGGGGCTGAGGTGGTGGAGG - Intronic
907097977 1:51799341-51799363 TTGGGGGGTGGGGGTGCTGGGGG - Intronic
907101737 1:51844136-51844158 TCGGGGGATGGTGGTGGTGGAGG - Intronic
907158276 1:52353802-52353824 TTTGGAGGAGGAGGTGGTGGTGG + Intronic
907185841 1:52608440-52608462 TGGGCGGGATGAGGTGGTGGAGG - Exonic
907257392 1:53190400-53190422 TTGGGGGGTGGGGGTGGTTTTGG - Intergenic
907440660 1:54476103-54476125 GTGGCGGGAGGTGGTGCTGGGGG + Intergenic
907729637 1:57053493-57053515 TTGGGAGGTGGAGGTGGAGGTGG - Intronic
907909567 1:58814641-58814663 TTGACGGGTGGAGCTGGAAGAGG + Intergenic
908256617 1:62308687-62308709 TTTGGGGGTGGTGGTTGTGGTGG - Intronic
908682897 1:66682288-66682310 TAGGTGGGTGGTGGTGGGGGAGG - Exonic
908777749 1:67657514-67657536 TTGGAGGGTGCAGTTGGGGGAGG + Intergenic
908799764 1:67867232-67867254 TTGGGAGGCGGAGGTGGAGGCGG + Intergenic
909651287 1:77978943-77978965 TCAGCTGGTGGCGGTGGTGGCGG - Exonic
910081485 1:83347683-83347705 TTGGAGGGTGGCAGTGGTTGGGG - Intergenic
910118788 1:83761510-83761532 GTGGCAGGTGGAGGGGGAGGCGG - Intergenic
910325946 1:86007241-86007263 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
910415395 1:86992174-86992196 TTTGGGGGTGGGGGTAGTGGTGG - Intronic
910458795 1:87426184-87426206 TTGGCAGGGTGAGCTGGTGGTGG - Intergenic
910878717 1:91903088-91903110 TTGGCAGGCCGAGATGGTGGGGG + Intronic
911413441 1:97540330-97540352 GTGGGGGGTGGGGGTGGCGGCGG + Intronic
911969275 1:104409406-104409428 TTGTGGGGTGGGGGTAGTGGGGG - Intergenic
912553478 1:110499346-110499368 ATGTCAGGTGGTGGTGGTGGGGG + Intergenic
912583263 1:110738500-110738522 TTGCAGGGTGGGGGTGGGGGGGG + Intergenic
912680219 1:111724627-111724649 TTTGGAGGTGGAGATGGTGGAGG - Exonic
912689854 1:111796624-111796646 TTGGAGGGTGGAGGAGGGAGAGG + Intronic
912901327 1:113652973-113652995 TTGAGGGGTGGAGGTTGGGGAGG + Intronic
913500440 1:119468145-119468167 TTGCAGGGTGGGGGTGGGGGGGG - Intergenic
913720514 1:121588095-121588117 TTTGCTGCTGGAGGTGGAGGTGG - Intergenic
914256269 1:145962631-145962653 TTGGCGGGGGGGGGGGGGGGGGG + Exonic
914330920 1:146670425-146670447 TGGGCGGGGGGAGGGGGCGGGGG + Intergenic
914916817 1:151824139-151824161 TCGGCGGTTGGAGGGGCTGGTGG + Intronic
915032254 1:152891467-152891489 CTGGGAGGTGGAGGTTGTGGTGG - Intergenic
915068043 1:153243307-153243329 GTAGGTGGTGGAGGTGGTGGTGG + Intergenic
915068267 1:153244340-153244362 GTGGTGGGTGATGGTGGTGGAGG + Intergenic
915068397 1:153245067-153245089 GCAGCTGGTGGAGGTGGTGGTGG + Intergenic
915326136 1:155082129-155082151 TTTGAGGGTGGTGGCGGTGGTGG - Intronic
915376347 1:155399635-155399657 TTGGGGGGTGGGGGTTGGGGTGG - Intronic
915446552 1:155977839-155977861 TGGAGGGGTGGTGGTGGTGGTGG + Intronic
915482709 1:156198010-156198032 TTGGCTGGGGAAGGTGGTTGAGG + Intronic
915580905 1:156812722-156812744 TTGGAAGGTGGAGCTGCTGGTGG + Intronic
915658471 1:157381217-157381239 TTGGTGTCTGGAGCTGGTGGTGG + Intergenic
915944489 1:160140023-160140045 CTGGAGGGAGGAGCTGGTGGTGG - Intronic
916108374 1:161446900-161446922 TGCGAGGGTGGCGGTGGTGGTGG + Intergenic
916109961 1:161454280-161454302 TGCGAGGGTGGCGGTGGTGGTGG + Intergenic
916111547 1:161461691-161461713 TGCGAGGGTGGCGGTGGTGGTGG + Intergenic
916113133 1:161469071-161469093 TGCGAGGGTGGCGGTGGTGGTGG + Intergenic
916455755 1:164969729-164969751 TAGGGGGGTGGGGGAGGTGGGGG - Intergenic
916562604 1:165946122-165946144 GTGGCTGCTGGTGGTGGTGGTGG + Intergenic
916830429 1:168485382-168485404 TGGTGGGGTGGGGGTGGTGGGGG + Intergenic
916937779 1:169647925-169647947 TTGGCGGTAGGGGGTGGGGGTGG - Intergenic
916963968 1:169916228-169916250 GTGGCGGGGGGGGGTGGTGAGGG + Intergenic
917073275 1:171176059-171176081 TTGGAGTGGGAAGGTGGTGGTGG + Intergenic
917264372 1:173204739-173204761 TCGGGTGGTGGTGGTGGTGGTGG - Intronic
917268085 1:173242996-173243018 TTGGTGGGTGGGGGGGGGGGGGG + Intergenic
917337847 1:173943533-173943555 TTTGGAGGTGGCGGTGGTGGGGG + Exonic
917434422 1:175005100-175005122 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
917454025 1:175170518-175170540 TAGGGCGGTGGGGGTGGTGGAGG - Intronic
917542242 1:175925669-175925691 TTTGGTGGTGGTGGTGGTGGTGG + Intergenic
917558194 1:176114584-176114606 TTTGCGGGGGGAGGGAGTGGGGG + Intronic
917642205 1:176994100-176994122 TTGGTGGGTGGCGGGGGGGGTGG - Intronic
918018298 1:180659550-180659572 GTGGTGGGTGGTGGTGGTGGAGG - Intronic
918036638 1:180879908-180879930 TTGCGGGGAGGTGGTGGTGGGGG - Intronic
918369687 1:183847077-183847099 TGGTAGGGTGGTGGTGGTGGAGG - Intronic
919115475 1:193275865-193275887 TGTTCTGGTGGAGGTGGTGGGGG + Intergenic
919204649 1:194406264-194406286 TTGGGGGGTGGGGGGGCTGGGGG + Intergenic
919419612 1:197354820-197354842 TGGGCGGGGGGGGGGGGTGGGGG - Intronic
919972485 1:202590266-202590288 TGGGCGGGGCGGGGTGGTGGTGG - Exonic
920098184 1:203500057-203500079 GTGGTAGGTGGAGGTGGTGGTGG - Intronic
920098190 1:203500076-203500098 GAGGTGGGTGGTGGTGGTGGTGG - Intronic
920098207 1:203500130-203500152 GAGGTGGGTGGTGGTGGTGGAGG - Intronic
920098213 1:203500146-203500168 GTGGGTGGTGGAGGTGGAGGTGG - Intronic
920098228 1:203500189-203500211 GTGGGTGGTGGTGGTGGTGGTGG - Intronic
920098229 1:203500192-203500214 GAGGTGGGTGGTGGTGGTGGTGG - Intronic
920098255 1:203500271-203500293 GTGGGTGGTGGAGGTGGAGGTGG - Intronic
920098263 1:203500293-203500315 GAGGTGGGTGGTGGTGGTGGAGG - Intronic
920098293 1:203500393-203500415 GAGGCGGGTGATGGTGGTGGAGG - Intronic
920111651 1:203591380-203591402 TTGGGGGGCGGAGGGGATGGGGG + Intergenic
920739394 1:208565979-208566001 TTGGCTGGTGGGGTTGGGGGAGG + Intergenic
920905942 1:210168062-210168084 TTCGGTGGTGGTGGTGGTGGTGG + Intronic
921020388 1:211229728-211229750 TTGGGGTGTAGTGGTGGTGGCGG - Intergenic
921168285 1:212523255-212523277 TTGGCGGGTGGTGAGGGTGCTGG + Intergenic
921213907 1:212921487-212921509 TTGAAGGGTGGAGGTGGTAGAGG - Intergenic
921456794 1:215380751-215380773 GTGGCCTGTGGTGGTGGTGGTGG + Intergenic
922123373 1:222697827-222697849 CTGGGAGCTGGAGGTGGTGGGGG + Intronic
922178068 1:223212539-223212561 TTGGTGGGAGGTGGGGGTGGAGG + Intergenic
922196455 1:223364089-223364111 CTGGCGGGGGGAGGAGGCGGAGG - Intronic
922239341 1:223745320-223745342 CGAGTGGGTGGAGGTGGTGGTGG + Exonic
922271973 1:224043332-224043354 TTGGAGGGTAGAGGTAGTGTTGG - Intergenic
922410181 1:225365774-225365796 TTGGGGGGTGGAGGTACTGGGGG + Intronic
922440775 1:225653409-225653431 TGGGCGGGAGGGGGGGGTGGTGG - Intergenic
922615664 1:226960011-226960033 TTGGTGCTTGGTGGTGGTGGTGG + Intronic
922658380 1:227406292-227406314 TTTGTTGGTGGTGGTGGTGGTGG - Intergenic
922771801 1:228189212-228189234 TTAGCTGCTGGGGGTGGTGGTGG + Intergenic
923007264 1:230060525-230060547 CTGCTGGGTGGGGGTGGTGGTGG - Intronic
923230723 1:231983640-231983662 TTGGGGGGAGGGGGTGGAGGTGG + Intronic
923616785 1:235544899-235544921 TGCGGGGGTGGTGGTGGTGGAGG + Intergenic
923648277 1:235846125-235846147 TTTTCTGGTGCAGGTGGTGGAGG - Intronic
924305167 1:242680538-242680560 TTAGCGGGGTGTGGTGGTGGGGG - Intergenic
924437613 1:244056658-244056680 GTGGAGGGTGGTGGTGGGGGGGG - Exonic
924517859 1:244781159-244781181 TTTGTTGGTGGTGGTGGTGGTGG + Intergenic
924580929 1:245323872-245323894 TGGGTGGATGGAGGTGGAGGTGG + Intronic
924580942 1:245323908-245323930 TGGGTGGATGGAGGTGGAGGTGG + Intronic
924580991 1:245324056-245324078 TGGGTGGTTGGAGGTGGAGGTGG + Intronic
924850586 1:247825572-247825594 CTGGCGGGCGGAAGTGCTGGCGG + Intergenic
924850590 1:247825588-247825610 CTGGCGGGCGGAAGTGCTGGCGG + Intergenic
1063167927 10:3480630-3480652 TTGGGGGGTGGAGGAGGTTCAGG - Intergenic
1063597344 10:7448218-7448240 TTGTCAGTTTGAGGTGGTGGTGG - Intergenic
1063618138 10:7620172-7620194 TTTGCGGGGGTAGGGGGTGGTGG - Intronic
1063665181 10:8056353-8056375 TAGGCGGGTGGGCGGGGTGGAGG + Intronic
1063693725 10:8312574-8312596 TTGCCAGCTGGAGGTAGTGGTGG + Intergenic
1064111898 10:12546807-12546829 TTGTGGGGTGGGGGTGGGGGAGG + Intronic
1064238620 10:13603286-13603308 TTTGGGGGAGGTGGTGGTGGTGG + Intronic
1064340532 10:14481460-14481482 TCTGGGGGTGGAGGTGTTGGGGG + Intergenic
1064425640 10:15226861-15226883 CTGGGGGGTGGTTGTGGTGGGGG - Intronic
1064445112 10:15386195-15386217 GTGGCAGGTGGTGGTGGTGGTGG + Intergenic
1064648862 10:17487841-17487863 TTGTGGGGTGGTGGTGGGGGAGG + Intergenic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1065024136 10:21525758-21525780 TTGGCGGTGGAAGGTGGGGGTGG + Intergenic
1065028352 10:21560592-21560614 TTAGGTGGTGGTGGTGGTGGTGG - Intronic
1065043072 10:21717390-21717412 TTGGCGGGTGGGGGGTGGGGAGG + Intronic
1065097340 10:22294749-22294771 ATAGAGGGTGGTGGTGGTGGTGG + Intergenic
1065461313 10:25967992-25968014 ATGGCGGGTGTAGGGGGTGGAGG + Intronic
1065539819 10:26751741-26751763 TCATCTGGTGGAGGTGGTGGCGG + Exonic
1065540882 10:26765725-26765747 TTGGTGGGTGCAGGTGGGTGGGG + Intronic
1066350485 10:34632381-34632403 ATGGCGTGTGAAGGTTGTGGTGG - Intronic
1067072361 10:43142916-43142938 TTTGTTGGTGGTGGTGGTGGTGG - Intronic
1067214677 10:44292820-44292842 TTGGGGGGAGGGGGTGGGGGGGG - Exonic
1067806438 10:49396292-49396314 TTTGGGGGTGATGGTGGTGGTGG - Intergenic
1068065537 10:52126162-52126184 ATGGTGAGGGGAGGTGGTGGTGG + Intronic
1068080551 10:52313681-52313703 GTGGCGGGGGGAGGTGGGGGAGG + Intergenic
1068244307 10:54343640-54343662 TTTGCGGGGGGAGGTGGGAGGGG + Intronic
1068813502 10:61283322-61283344 GTGGCGGGAGGAAGTGATGGTGG + Intergenic
1068971276 10:62960966-62960988 TTGGGAGGTGGAGGTGGGTGTGG + Intergenic
1069485253 10:68818395-68818417 TTGGTGGTTGGTGGAGGTGGAGG - Intergenic
1069511829 10:69048321-69048343 CTGGAGGGTGGAGGGTGTGGGGG - Intergenic
1069572185 10:69500931-69500953 CTGGGTGGTGGTGGTGGTGGTGG + Intronic
1069605658 10:69737286-69737308 TTGGCTGGGTGAGTTGGTGGTGG - Intergenic
1069613608 10:69792109-69792131 ATGGTGGGTGGTGGTGGTGGTGG - Intergenic
1069626059 10:69868293-69868315 TGGGCAGGTGGTGGTGGTGGCGG + Intronic
1069754021 10:70762256-70762278 TTGGAGAGTGGAGGTCCTGGGGG + Exonic
1069947659 10:71998904-71998926 CAGGGGGGTGGAGGTGGTGGGGG + Intronic
1070039098 10:72757273-72757295 TCAGCTGGAGGAGGTGGTGGTGG - Intronic
1070140457 10:73734148-73734170 TTGGTGCCTGGAGCTGGTGGAGG - Intergenic
1070464972 10:76712082-76712104 TGCTCTGGTGGAGGTGGTGGGGG - Intergenic
1070533021 10:77353968-77353990 TTTGGGGGGGGGGGTGGTGGGGG + Intronic
1070568199 10:77619895-77619917 TTGGAGGATGGAGGAGGTGGAGG + Intronic
1070766676 10:79060742-79060764 TGGTCGGGTGGAGGTGGTGGGGG + Intergenic
1070794344 10:79208070-79208092 GGTGGGGGTGGAGGTGGTGGGGG + Intronic
1070829677 10:79410772-79410794 TTGCTGGGGAGAGGTGGTGGGGG + Intronic
1070901231 10:80030539-80030561 GTGGGAGGTGGAGGTGGAGGTGG + Intergenic
1071209207 10:83318018-83318040 GTGGCCTGTGGTGGTGGTGGTGG + Intergenic
1071536410 10:86435589-86435611 TTGGTGGGGGGAGGTGGTGGGGG - Exonic
1071810644 10:89177269-89177291 TAGGTGGGTAGAGGTGGTAGTGG - Intergenic
1071844878 10:89511577-89511599 TCGGAGGGTGGAGGGGCTGGGGG + Intronic
1072241404 10:93498197-93498219 TTGGTGGGACTAGGTGGTGGGGG + Intronic
1072341316 10:94454284-94454306 CTGGGAGGTGGAGGTTGTGGTGG - Intronic
1072714654 10:97742402-97742424 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
1072863102 10:99027702-99027724 TTGGCCCGTAGTGGTGGTGGTGG - Intronic
1073096914 10:100985446-100985468 TTGTGGGGTGGAGGTGGGAGAGG - Exonic
1073149670 10:101303249-101303271 ATGGCAGGTGGGGGTGGAGGGGG - Intergenic
1073217437 10:101844020-101844042 TTGGCGGGGGGGGGGGGTGGGGG + Intergenic
1073921671 10:108466381-108466403 GGGGCGGGTGGAGGTGGCGCCGG + Intergenic
1073986627 10:109216891-109216913 TTTGGGGGTGGAGGTGGGGCAGG + Intergenic
1074040312 10:109781656-109781678 TTGGTGGGAGGAGGCGGAGGAGG - Intergenic
1074095208 10:110305275-110305297 GTGGCGGGGGGTGTTGGTGGGGG + Intergenic
1074130941 10:110574680-110574702 TGTGTGTGTGGAGGTGGTGGGGG - Intronic
1074377040 10:112949751-112949773 GTGGCTGGGGGAGGGGGTGGGGG - Intergenic
1074584342 10:114752584-114752606 TTGGCAGGTGGGGTTGGGGGAGG - Intergenic
1074679447 10:115889302-115889324 TTGGGAGGTGGGGGTGGGGGTGG - Intronic
1074753754 10:116609813-116609835 CTGGCGGGTGGGGGGGGAGGAGG - Intergenic
1074870376 10:117571323-117571345 TTGGAGGGAGGACATGGTGGGGG - Intergenic
1075119052 10:119651278-119651300 GGGGCGGGAGGAGGTGGGGGAGG + Intergenic
1075218859 10:120566627-120566649 TCGGGAGGTGGAGGTGGAGGTGG - Intronic
1075275615 10:121090006-121090028 CTGGCTGGTGGAGGTTGAGGTGG - Intergenic
1075331780 10:121579269-121579291 CGGGCGGTTGGAGGTAGTGGGGG + Intronic
1075784821 10:125041967-125041989 TTTGGGGGTGGGGGTGGGGGAGG + Intronic
1075891625 10:125956202-125956224 TGGGGGGGGGGCGGTGGTGGGGG + Intronic
1075904573 10:126069831-126069853 ATGTTGGGTGGAGGAGGTGGTGG + Intronic
1075904574 10:126069834-126069856 TTGGGTGGAGGAGGTGGTGGTGG + Intronic
1076013300 10:127007318-127007340 TTGGAGGGTGGTGATGGTGATGG + Intronic
1076184285 10:128434402-128434424 GTGACGGGCTGAGGTGGTGGTGG - Intergenic
1076455785 10:130593834-130593856 TTGGAGGCTGGAGGTGGGAGAGG + Intergenic
1076525340 10:131109065-131109087 TTGTGGGGTGGGGGGGGTGGAGG + Intronic
1076567963 10:131411868-131411890 TTGGCAGGTGGTGGTGTGGGTGG - Intergenic
1076949512 10:133670143-133670165 TGGGGGGGGGGTGGTGGTGGGGG - Intronic
1076950496 10:133673442-133673464 TGGGGGGGGGGTGGTGGTGGGGG - Intergenic
1076953459 10:133683361-133683383 TGGGGGGGGGGTGGTGGTGGGGG - Intergenic
1076958394 10:133752941-133752963 TGGGGGGGGGGTGGTGGTGGGGG - Intergenic
1076960367 10:133759550-133759572 TGGGGGGGGGGTGGTGGTGGGGG - Intergenic
1077007293 11:364232-364254 TTGGGAGGTGGAGGTGGGAGAGG - Intergenic
1077097474 11:805143-805165 TGGGCGGGCGGAGGGGGCGGCGG - Intronic
1077460941 11:2709221-2709243 CTGGGGGGTGGGGGTGGGGGGGG - Intronic
1077728837 11:4705967-4705989 GGGGCGGGTGGTGGTGGTGGTGG + Intronic
1078390574 11:10932168-10932190 TGGGGGGGAGGAGGTGGTGGGGG + Intergenic
1078390583 11:10932185-10932207 TGGGGGGGAGGAGGTGGTGGGGG + Intergenic
1078538178 11:12192041-12192063 GTGGCGGGCGGGGGTGGGGGTGG - Intronic
1078589482 11:12627000-12627022 TTGGCGGGGGGGGGGGGGGGGGG + Intergenic
1078590963 11:12640845-12640867 ATGGTGGGGGGAGGTGGTGGGGG - Intergenic
1078636533 11:13055475-13055497 TTGGGAGGTGAAGGTGGTGGGGG + Intergenic
1079135876 11:17775763-17775785 GTGGCCGGTGGAGGGGGTGGTGG + Intronic
1079200433 11:18372786-18372808 TCGGGGGGTGGTGGTGGCGGGGG - Intergenic
1079399539 11:20094842-20094864 TGGTTGGGTGGAGGTGGGGGAGG - Intronic
1079645901 11:22863620-22863642 GTGGCGGAGGGAGGTGGCGGAGG + Intergenic
1079822390 11:25147060-25147082 TTGACGGTAGGGGGTGGTGGTGG - Intergenic
1079884867 11:25974695-25974717 TTGTGGGGTAGAGGTTGTGGAGG - Intergenic
1080252041 11:30244299-30244321 TTGGTGGGTGGAGAGGGTGGAGG + Intergenic
1080349622 11:31368954-31368976 GTTGCTGGTGGTGGTGGTGGTGG - Intronic
1081753412 11:45528025-45528047 GTGGAGGGTGGAGGTGGTGGTGG - Intergenic
1081835431 11:46149628-46149650 TTTCCGGGGAGAGGTGGTGGAGG - Intergenic
1081839357 11:46185279-46185301 TTGGCAGGTGGGGCTGGGGGTGG + Intergenic
1081856214 11:46305355-46305377 GAGGCGGGTGGAGGAGGCGGCGG - Intronic
1081999693 11:47387334-47387356 TGGTGGGGTGGTGGTGGTGGTGG + Intergenic
1082045528 11:47723019-47723041 TTGGGAGCTGGTGGTGGTGGAGG + Exonic
1082045708 11:47724589-47724611 TCCGCAGGAGGAGGTGGTGGAGG + Exonic
1082654899 11:55842507-55842529 TTGTGGGGTGGGGGTGGGGGAGG - Intergenic
1082698548 11:56400891-56400913 TTGGTGGGGGCAGCTGGTGGAGG + Intergenic
1083012474 11:59416228-59416250 TTGGGGGCGGGAGGTGGAGGAGG + Intergenic
1083589181 11:63882965-63882987 CTGGGGGATGGGGGTGGTGGGGG - Intronic
1083594425 11:63912106-63912128 GTGGGAGGTGGAGGGGGTGGTGG + Exonic
1083614115 11:64018087-64018109 TTGCTGGGTGGAGCTGGGGGAGG + Intronic
1083649798 11:64195736-64195758 TTGGGAGGGGGTGGTGGTGGAGG - Exonic
1083828261 11:65215237-65215259 TCGGGGGGTGGGGGTGGGGGGGG + Intergenic
1083968059 11:66055139-66055161 AGGCCTGGTGGAGGTGGTGGGGG - Exonic
1084142540 11:67242662-67242684 GGGGCGGATGGTGGTGGTGGGGG - Intronic
1084309761 11:68310164-68310186 ATAGTGGGTGGTGGTGGTGGGGG + Intergenic
1084466052 11:69323699-69323721 TTGGGTGGTGGTGGTGGTGGAGG + Intronic
1084466234 11:69324616-69324638 TTTGGTGGTGGTGGTGGTGGAGG + Intronic
1084661977 11:70551334-70551356 TGGCCGGGTGGAGATGGGGGAGG - Intronic
1084701486 11:70788969-70788991 TTGGGGTGTGGGGCTGGTGGCGG + Intronic
1084777264 11:71385750-71385772 TTGGCGGGAGGAGGCAGTGGAGG + Intergenic
1084903282 11:72326550-72326572 GTGGTAGGTGGAGGTGGAGGAGG + Intronic
1084953623 11:72679951-72679973 TTGGAGGGTGGTGGTGGTGAGGG - Intergenic
1084978692 11:72816952-72816974 GGGGGTGGTGGAGGTGGTGGGGG + Intronic
1085206089 11:74732720-74732742 TTGGAGGGTGGAGATCTTGGGGG - Intergenic
1085278495 11:75315052-75315074 TGGGGTGGTGGTGGTGGTGGTGG - Intronic
1085386587 11:76161376-76161398 GTGGGGTGTGGAGGAGGTGGGGG + Intergenic
1085417329 11:76328086-76328108 CTGGCGGGTGTGGGTGGAGGAGG + Intergenic
1085518234 11:77123603-77123625 ATGGGGGGTGCTGGTGGTGGTGG - Intronic
1085755434 11:79197741-79197763 TTTGCTGGGGGACGTGGTGGGGG + Intronic
1087127297 11:94640675-94640697 GGGGCGGGGGGTGGTGGTGGTGG - Intergenic
1087264455 11:96045081-96045103 TGGGTGGGTGGAGATGGGGGTGG + Intronic
1087313334 11:96576920-96576942 TGGGCCTGTGGTGGTGGTGGTGG - Intergenic
1087499144 11:98929188-98929210 ATGGGGGCTGGGGGTGGTGGGGG - Intergenic
1087855835 11:103091476-103091498 TTGTGGGGTGGGGGTGGGGGTGG + Intronic
1087896249 11:103589909-103589931 TTGGCTGGGGGAGGTTGTGGTGG + Intergenic
1088089868 11:106024961-106024983 TTGGTGGGGGGGGGTGGGGGGGG + Intergenic
1088304300 11:108391735-108391757 CTGGGGGGAGGGGGTGGTGGTGG - Intronic
1088774975 11:113073742-113073764 TGGTGGTGTGGAGGTGGTGGTGG + Intronic
1089013275 11:115147430-115147452 TGGGCGGGTGGAGTGTGTGGGGG + Intergenic
1089015518 11:115162174-115162196 GTGGCGGGAGGAGGGGGGGGTGG + Intergenic
1089081261 11:115777929-115777951 GTGGCTGGTGGTGGTGGTGGGGG + Intergenic
1089092080 11:115886333-115886355 TAGGAGGGTGGTGGGGGTGGAGG + Intergenic
1089125724 11:116175185-116175207 TAGGAGGGTCGATGTGGTGGTGG - Intergenic
1089334502 11:117713786-117713808 TGGCTGTGTGGAGGTGGTGGTGG + Intronic
1090032339 11:123217827-123217849 TTGGAGGGTGAGGGTGGGGGGGG - Intergenic
1090414115 11:126529017-126529039 TTGTCAGGTGGACGTGGAGGGGG + Intronic
1090431870 11:126653030-126653052 TTGTCGGGTTGTGGGGGTGGGGG + Intronic
1090473662 11:127001297-127001319 TGGGTGGGTGGTTGTGGTGGGGG + Intronic
1090832868 11:130431268-130431290 GTGGGTGGTGGGGGTGGTGGGGG - Intergenic
1090832871 11:130431271-130431293 GTGGTGGGTGGTGGGGGTGGTGG - Intergenic
1090832886 11:130431308-130431330 TCAGCAGGTGGTGGTGGTGGTGG - Intergenic
1091004767 11:131942869-131942891 CTGGAAGGTGGAGGTTGTGGTGG + Intronic
1091205586 11:133818670-133818692 GTGGCGGTGGGTGGTGGTGGTGG - Intergenic
1091224801 11:133950948-133950970 CTGGCAGATGGAGGTGGCGGTGG - Intronic
1091270490 11:134308262-134308284 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
1091270536 11:134308452-134308474 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
1091311866 11:134580572-134580594 GTGGCAGGGGGAGGGGGTGGTGG - Intergenic
1091483623 12:860938-860960 TTGGCGGGGGGTGGTGGTGGGGG + Intronic
1091771326 12:3153061-3153083 GTGGGGTGTGGTGGTGGTGGTGG + Intronic
1091808429 12:3374777-3374799 TGGGTTGGTGGTGGTGGTGGTGG + Intergenic
1092056949 12:5515404-5515426 TGGGATGGTGGAGGTGGAGGTGG - Intronic
1092073930 12:5657201-5657223 ATGGGGGGTGGAGGTGGCAGTGG + Intronic
1092157697 12:6295162-6295184 TTGGGGGGTGGGGGGGTTGGGGG - Intergenic
1092410344 12:8248086-8248108 ATGGCAGGTGGCGGTGGGGGGGG + Intergenic
1092659514 12:10723064-10723086 CGGGAGGGTGGTGGTGGTGGTGG + Exonic
1093172626 12:15876299-15876321 TGTTCTGGTGGAGGTGGTGGAGG - Intronic
1093235823 12:16607237-16607259 TTTCGGGGTGGTGGTGGTGGGGG - Intronic
1093357159 12:18180016-18180038 TTGGGTGGTGGAGGTGGGGAGGG + Intronic
1093413343 12:18892860-18892882 TTTGGTGGTGGTGGTGGTGGTGG + Intergenic
1093620100 12:21278117-21278139 TGGGCCTGTGGTGGTGGTGGTGG + Intronic
1093653883 12:21674104-21674126 CTGGGGGGTGGGGGTGGGGGTGG + Intronic
1093708641 12:22303826-22303848 TGGCAGGGTGGTGGTGGTGGTGG - Intronic
1093914269 12:24783430-24783452 TTGGGGGGTGGGGGTGGTGAGGG + Intergenic
1093957104 12:25233120-25233142 TAGGGGGATGGTGGTGGTGGTGG - Intronic
1094146449 12:27233388-27233410 TTGGCGGGGGGTGGGGGCGGGGG + Intergenic
1094174180 12:27524510-27524532 TTTGGGGGTGGTGGGGGTGGAGG + Intronic
1094819596 12:34214211-34214233 TGGGCGGGTGGTGGGCGTGGTGG + Intergenic
1095284647 12:40393984-40394006 GTGGCTGCTGAAGGTGGTGGGGG + Intronic
1095814479 12:46406534-46406556 TCTGTGGGTGGAGGTGCTGGGGG - Intergenic
1096305773 12:50473806-50473828 TGGGGGGGTGGGGGGGGTGGGGG + Intronic
1096436154 12:51592047-51592069 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1096439362 12:51626740-51626762 TTGGAGAGTGGAGGTGGGAGAGG - Intronic
1096485007 12:51974156-51974178 TTGGCGGGTGGAGGTGGTGGGGG - Intronic
1096496460 12:52041977-52041999 TTGGGGGGCAGAGGTGGGGGTGG + Intronic
1096570407 12:52519956-52519978 TTCGGCGGTGGAGCTGGTGGTGG - Exonic
1096570455 12:52520163-52520185 TCCGGGGGTGGCGGTGGTGGTGG - Exonic
1096662716 12:53138211-53138233 CTGGGAGGTGGAGGTTGTGGAGG - Intergenic
1096731154 12:53613766-53613788 TTGGGGGGTTGAGGTGGGGGTGG - Intronic
1096734213 12:53640021-53640043 CTGGGAGGTGGAGGTGGAGGTGG - Intronic
1096771982 12:53940825-53940847 TTGGCACGTGGAGCTGGTCGGGG - Intronic
1097100173 12:56582353-56582375 TTTACTTGTGGAGGTGGTGGAGG - Intronic
1097109025 12:56644364-56644386 TTGGGGGGCCGAGGTGGGGGGGG + Intronic
1097263739 12:57734297-57734319 GGTGAGGGTGGAGGTGGTGGGGG - Exonic
1097323093 12:58246837-58246859 TTTGGGGGAGGGGGTGGTGGTGG + Intergenic
1097449542 12:59719744-59719766 TTGGAGGGTGGAGGTGGGGATGG - Intronic
1097760596 12:63459781-63459803 TGCTCTGGTGGAGGTGGTGGGGG - Intergenic
1097768990 12:63558442-63558464 TTGGTGGGGGGTGGGGGTGGGGG - Intergenic
1097823096 12:64147356-64147378 TTGGGAGGAGGAGGTGGGGGTGG - Exonic
1098141184 12:67451576-67451598 TGGGTGGGAGGAGGAGGTGGGGG - Intergenic
1098238067 12:68437847-68437869 TTTGTGGGTGGTGGTTGTGGTGG - Intergenic
1098244275 12:68500347-68500369 TGGGGCAGTGGAGGTGGTGGAGG - Intergenic
1098588958 12:72187441-72187463 GGGGGGGGTGGTGGTGGTGGTGG + Intronic
1099010475 12:77285329-77285351 ATGGCGGCTTGAGGTGGTAGGGG + Intergenic
1099979660 12:89583786-89583808 TTGGCGGGGGGGGGGGGGGGGGG + Intergenic
1099986915 12:89677019-89677041 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
1099986916 12:89677022-89677044 TTGTTTGGTGGTGGTGGTGGTGG - Intronic
1100138038 12:91579235-91579257 AGGAGGGGTGGAGGTGGTGGGGG - Intergenic
1100440277 12:94610561-94610583 GTGGTTGGTGGTGGTGGTGGTGG - Intronic
1100571705 12:95849052-95849074 TTGAGGGGTGAAGGAGGTGGGGG + Intergenic
1100806643 12:98292515-98292537 CTGGGGGGAGGTGGTGGTGGTGG - Intergenic
1101302824 12:103498868-103498890 TTGGGGGGTGGGGTTGGGGGAGG + Intergenic
1101945412 12:109132485-109132507 TTGGAGGGAGGTGGTGGTGAGGG + Intronic
1102209366 12:111113433-111113455 TTGTCAGGTGTAGGGGGTGGGGG - Intronic
1102512644 12:113426017-113426039 TTGGGAGGTGGTGGTGGAGGTGG - Intronic
1102837498 12:116079212-116079234 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
1102918595 12:116774780-116774802 GTGGAGGGTGGAGGGGATGGAGG + Intronic
1103063252 12:117875859-117875881 TGGGTGTGTGGTGGTGGTGGGGG - Intronic
1103559960 12:121788462-121788484 TTGGGGCGTGGGGGTGGTGGGGG + Intronic
1103658220 12:122491751-122491773 CTGGCAGGTGGAGGTTGTGTTGG + Intronic
1103693611 12:122796188-122796210 TTGTCGGGGGGCGGTGGGGGAGG - Intronic
1103902795 12:124311948-124311970 TGCGCGGGAGGAGGGGGTGGGGG + Intronic
1103946212 12:124528128-124528150 CTTGGTGGTGGAGGTGGTGGTGG - Intronic
1103949038 12:124541605-124541627 GTGGGGAGTGGAGATGGTGGGGG + Intronic
1104405520 12:128513296-128513318 TTGGGGGCTGGAGGAGGGGGAGG - Intronic
1104627968 12:130375410-130375432 AATGCGGATGGAGGTGGTGGTGG - Intergenic
1104643517 12:130481932-130481954 GTGGGTGGTGGTGGTGGTGGCGG - Intronic
1104643518 12:130481935-130481957 GCGGTGGGTGGTGGTGGTGGTGG - Intronic
1104643519 12:130481938-130481960 TGGGCGGTGGGTGGTGGTGGTGG - Intronic
1104800928 12:131554897-131554919 ATGGTGGGTGGAGCTGGTGGGGG - Intergenic
1105258201 13:18759290-18759312 GTGGGGGGTGGGGGTGGTAGGGG - Intergenic
1105260858 13:18778590-18778612 GTGGGGGGTGGGGGTGGTAGGGG - Intergenic
1105299307 13:19118166-19118188 TGGGTGGCTGCAGGTGGTGGTGG - Intergenic
1105322665 13:19343889-19343911 CTGTCGGGGGGAGGGGGTGGGGG + Intergenic
1105355450 13:19655478-19655500 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
1105401140 13:20097150-20097172 GCGGCGGGTGGGGGTGGGGGTGG + Intergenic
1105402661 13:20109638-20109660 CTGGAGAGGGGAGGTGGTGGGGG - Intergenic
1105416662 13:20219136-20219158 TGGGCAGGTGGAGGTGGGGCAGG + Intergenic
1105428453 13:20315748-20315770 TTGGGGGGTGGAGGGTGGGGGGG + Intergenic
1105428456 13:20315755-20315777 GTGGAGGGTGGGGGGGGTGGTGG + Intergenic
1105510811 13:21050214-21050236 TTTGGGGGTGGAGGGGGTAGGGG + Intronic
1105583856 13:21725902-21725924 ATGGTTGGTGGTGGTGGTGGTGG - Intergenic
1105740969 13:23322772-23322794 TTGGCGGGGGGGGGGGGGGGGGG - Intronic
1105810671 13:23992459-23992481 GTGGCAGGTGCTGGTGGTGGTGG + Intronic
1106080990 13:26500281-26500303 CTGGGAGGTGGAGGTTGTGGTGG + Intergenic
1106134464 13:26963571-26963593 TTAGTGGCTGGAGGGGGTGGGGG + Intergenic
1106278467 13:28239141-28239163 TTGGCGGGGGTGGGGGGTGGGGG - Intronic
1106281059 13:28271830-28271852 GTGGTTGGTGGAGGTGGTGTGGG + Intronic
1106513740 13:30434370-30434392 TTTGTTGGTGGTGGTGGTGGTGG - Intergenic
1106516258 13:30456756-30456778 TGGGCGGGGGGGGGGGGTGGTGG + Exonic
1106547239 13:30741542-30741564 TTGGGGGGTGGGGGTGGGGAGGG - Intronic
1106770139 13:32953783-32953805 TTGGGGGGTGAGGGAGGTGGTGG + Intergenic
1107217174 13:37935055-37935077 TTGGGGAGTGGGGGCGGTGGGGG + Intergenic
1107300554 13:38961544-38961566 CTGGGAGGTGGTGGTGGTGGTGG - Intergenic
1107666189 13:42693550-42693572 TGTTCCGGTGGAGGTGGTGGGGG + Intergenic
1107715961 13:43199645-43199667 TTACCTGGTGGTGGTGGTGGGGG + Intergenic
1107781652 13:43909839-43909861 TTAGGGGGTGGTGGTGGTAGTGG + Intergenic
1108323367 13:49307139-49307161 TTGGGAGGTGGAGATGGGGGTGG - Intergenic
1108363641 13:49689860-49689882 TCGGCTGGTGGCGGTGGCGGTGG + Intronic
1108402807 13:50064987-50065009 TTGGGAGGTGGAGGTTGTGGTGG + Intergenic
1108542003 13:51453406-51453428 TTGGCTGTTGGAGGTGATAGGGG + Intronic
1108699341 13:52930504-52930526 TTCTGGGGTGGAGGTGGAGGGGG + Intergenic
1108825653 13:54408890-54408912 TTGGCGGGGGGGGGGGGGGGGGG - Intergenic
1109127397 13:58534286-58534308 TTGGGAGGCGGAGGTGGAGGCGG + Intergenic
1109225743 13:59692687-59692709 ATGGTTGATGGAGGTGGTGGTGG - Intronic
1109633538 13:65084697-65084719 TTGGGGGGGGGAGGGGGTGGGGG - Intergenic
1109775101 13:67030479-67030501 TTGGTGGGGGTCGGTGGTGGGGG - Intronic
1110010850 13:70331673-70331695 GGAGTGGGTGGAGGTGGTGGTGG + Intergenic
1110065836 13:71104415-71104437 TTGTGGGGTGGGAGTGGTGGGGG - Intergenic
1110608870 13:77466419-77466441 TTTGTGTGTGGAGATGGTGGGGG + Intergenic
1110627609 13:77668815-77668837 TGTTCCGGTGGAGGTGGTGGGGG - Intergenic
1110856107 13:80298606-80298628 TTGGGGGGTGGAGGGGGGGGCGG + Intergenic
1111165765 13:84455526-84455548 GTGGCTGGTGTAGGTGATGGGGG + Intergenic
1111813377 13:93119893-93119915 TTGGAGGGTGAACCTGGTGGGGG - Intergenic
1112017039 13:95339961-95339983 TTGGGGGGGGGAGGCGGTGGGGG + Intergenic
1112278314 13:98040830-98040852 TTGGGGGGTGGGGGTGGGGTGGG - Intergenic
1112412733 13:99178110-99178132 TCCGCGGATGGTGGTGGTGGTGG - Intergenic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1112602424 13:100869406-100869428 TTGGCTGGAGGGGCTGGTGGTGG + Intergenic
1113530701 13:111023602-111023624 TTGGAGGGTGGAGGTTGGGAGGG - Intergenic
1113815832 13:113170295-113170317 TTGGCGGGGGGTGGGGGTGGGGG + Intronic
1113868375 13:113543450-113543472 TGGGCAGGGGGAGGAGGTGGGGG - Intronic
1114073203 14:19131777-19131799 GTGGCAGGGGGAGGTGGAGGTGG + Intergenic
1114089063 14:19268206-19268228 GTGGCAGGGGGAGGTGGAGGTGG - Intergenic
1114289131 14:21273224-21273246 TTGGGGGGTGGGGGTGGGGATGG + Intergenic
1114317664 14:21523194-21523216 CTGTCAGGTGGTGGTGGTGGTGG + Exonic
1114533684 14:23410263-23410285 GCGGGGAGTGGAGGTGGTGGGGG + Intergenic
1114554210 14:23552112-23552134 TTCGCGGGGGGAGATGGGGGAGG - Intronic
1114736628 14:25049696-25049718 TTGGCGGGTGGCGGGAGAGGGGG - Intronic
1115028381 14:28767435-28767457 GCGGCGGGTGGTGGTGATGGTGG - Exonic
1115667744 14:35571711-35571733 TTTGTTGGTGGTGGTGGTGGTGG - Intronic
1116175731 14:41468234-41468256 TTGAGGGGTTGTGGTGGTGGGGG - Intergenic
1116783442 14:49262808-49262830 TTTGTGGGTTGAGGTGTTGGTGG - Intergenic
1116941310 14:50793734-50793756 TGTGGCGGTGGAGGTGGTGGTGG - Intronic
1116954955 14:50913872-50913894 GAGACGGGTGGTGGTGGTGGGGG + Intronic
1117161743 14:52996334-52996356 TTTGTTGGTGGTGGTGGTGGTGG - Intergenic
1117246577 14:53892305-53892327 TGGGGGGGTGGAGGTGGGGTGGG - Intergenic
1117288687 14:54311573-54311595 TCTGCGGGTGGGGGTGCTGGTGG - Intergenic
1117297147 14:54391020-54391042 GTGGGGGGCGGGGGTGGTGGTGG - Intergenic
1117392072 14:55271652-55271674 GGGGCGGGTGGGGGTGGGGGCGG + Intronic
1117399349 14:55344716-55344738 TTGGTGGGTGGTGGGGGTGGAGG - Intronic
1117516022 14:56502132-56502154 GTGGAGGGTGGAGGGGGTGGGGG - Intronic
1117913184 14:60653400-60653422 GTGGGCGGTGGAGGTGGTGGGGG - Intronic
1118008912 14:61590242-61590264 GTGGAGGCGGGAGGTGGTGGGGG + Intronic
1118032027 14:61827164-61827186 TTGGCTGCTGGATCTGGTGGAGG + Intergenic
1118098676 14:62569773-62569795 GTGGTGGGTGGGGGTGGGGGTGG + Intergenic
1118419375 14:65584119-65584141 TTGGGAGGTGGAGGTAGAGGCGG - Intronic
1118458552 14:65966934-65966956 GGGGCGGGAGGGGGTGGTGGTGG + Intronic
1118747783 14:68786362-68786384 TGTGTGTGTGGAGGTGGTGGTGG - Intergenic
1119100151 14:71871965-71871987 TATGGGGGTGGAGGGGGTGGTGG + Intergenic
1119180440 14:72601317-72601339 TTCGGGGGTGGGGGTGGTGAAGG - Intergenic
1119187958 14:72657627-72657649 GTTGGGGGTGGTGGTGGTGGTGG - Intronic
1119414352 14:74459733-74459755 GTGGCTGGTGGCGGTAGTGGGGG - Intergenic
1119425473 14:74532080-74532102 GTGGCGGGAGGTGGTGGGGGTGG - Intronic
1119425474 14:74532083-74532105 TTGGTGGCGGGAGGTGGTGGGGG - Intronic
1119663619 14:76468396-76468418 TTGGGGGGTGGTGGTGTTGGGGG - Intronic
1119702371 14:76763686-76763708 AGGGCGGGGGGTGGTGGTGGAGG + Intronic
1119725558 14:76920084-76920106 TTGCCAGGGGGAGGGGGTGGGGG - Intergenic
1119777937 14:77259765-77259787 TTGGGGGATGGGGGAGGTGGAGG + Intergenic
1119872201 14:78027532-78027554 TTTGTGGGTGGTAGTGGTGGTGG + Intergenic
1119899542 14:78248303-78248325 GTGGCGGGTGGGGGGGGGGGGGG - Intronic
1119923775 14:78472227-78472249 TTGGGATGTGGAGGTGGTGTGGG + Intronic
1120162242 14:81158692-81158714 TTGGGAGGTGGAGGTTGCGGTGG - Intergenic
1120370504 14:83628228-83628250 TTGTGGGGTGGGGGTGCTGGGGG - Intergenic
1120747951 14:88168630-88168652 TTGGAGTGAGGGGGTGGTGGGGG - Intergenic
1120834635 14:89028599-89028621 TAGGGTGGTGGTGGTGGTGGTGG - Intergenic
1120874432 14:89362807-89362829 TGGCCTGGTGGTGGTGGTGGTGG - Intronic
1120885137 14:89445946-89445968 GTGGGGGGTGGCGGGGGTGGAGG + Intronic
1120888919 14:89474345-89474367 TTGGGGTGAGGATGTGGTGGTGG - Intronic
1120974528 14:90237085-90237107 CTGGGGGGTGGAGGTGGTGGGGG - Intergenic
1121218992 14:92271736-92271758 TTGCTTGCTGGAGGTGGTGGTGG + Intergenic
1121617864 14:95325260-95325282 TTGGCGTGTGTAGGTGTTGGTGG + Intergenic
1121703030 14:95970581-95970603 TTGGGGGGTGGTGGTGGTCCTGG - Intergenic
1121717672 14:96087943-96087965 GTGGGGGGTGGGGGTGGGGGTGG - Exonic
1122150322 14:99722064-99722086 TTGGTGGGTGGAGGCCCTGGGGG + Exonic
1122176910 14:99927809-99927831 TGGGGGGGTGGTGGTGGTGGTGG + Intronic
1122314397 14:100817308-100817330 TGGGGGCGTGGAGGTGGTGGGGG - Intergenic
1122342728 14:101038662-101038684 GTGGAGGGTGGTGGTGGTAGGGG + Intergenic
1122446828 14:101775831-101775853 CTGGGGGAAGGAGGTGGTGGGGG - Intronic
1122549823 14:102543950-102543972 TTGTTGGGTGGTGGTGGGGGCGG - Intergenic
1122667133 14:103338422-103338444 TTTGGTGGTGGTGGTGGTGGTGG - Exonic
1122869344 14:104628812-104628834 TCGGGAGGTGGAGGTGGAGGTGG + Intergenic
1123035481 14:105470165-105470187 TTGACGGGCGCAGGTGGCGGTGG - Exonic
1202859255 14_GL000225v1_random:71597-71619 GTGGGGGGTGGGGGTGGTGAGGG + Intergenic
1202942804 14_KI270725v1_random:170511-170533 TTGGCTGGGTGTGGTGGTGGCGG + Intergenic
1123955470 15:25330036-25330058 TTTGAGGGTGGGGGTGGAGGTGG + Intergenic
1124402797 15:29364852-29364874 CTGGCGGCTGGTGGTAGTGGCGG - Intronic
1124467157 15:29949644-29949666 TGTGGAGGTGGAGGTGGTGGTGG - Intronic
1124940647 15:34214326-34214348 GTTGCTGGTGGAGGTGGTGGGGG + Intergenic
1124955885 15:34360085-34360107 ATGGGGGGTGGCGGTGGTGGGGG - Intronic
1125076071 15:35620088-35620110 TTGGGAGGTGGAGGTGGAGGTGG - Intergenic
1126190122 15:45870331-45870353 TTGGCGGGGGGGGGGGGGGGGGG - Intergenic
1126699320 15:51353800-51353822 TTTGTGTGTGGTGGTGGTGGTGG - Intronic
1126704660 15:51396129-51396151 TTGCCAGGTGGAGGTGGTTAAGG - Intronic
1126725759 15:51629973-51629995 TTGTTGTGTGGTGGTGGTGGTGG + Intergenic
1127278633 15:57469711-57469733 TTGGAGGGTGGTGGTGAAGGGGG - Intronic
1127575273 15:60285767-60285789 ATGGTGGGTGGGGGTAGTGGGGG + Intergenic
1127897942 15:63318805-63318827 GTGTGGGATGGAGGTGGTGGTGG + Intergenic
1127905662 15:63374054-63374076 TTGGTGGTAGGAGGTGGAGGGGG - Intronic
1127944038 15:63731988-63732010 CTGAAGGGTGGTGGTGGTGGTGG + Intronic
1128207534 15:65866421-65866443 TTGGGAGGTGGAGGTGGAGGTGG + Intronic
1128383538 15:67130899-67130921 TGGGGGTGAGGAGGTGGTGGTGG + Intronic
1129078914 15:73022535-73022557 TAGGCAGTTGGAGGTGGGGGTGG + Intergenic
1129252908 15:74318605-74318627 TTGGGGGCTGGAGGGGATGGGGG - Intronic
1129567367 15:76637087-76637109 TTAGGTGGTGGTGGTGGTGGTGG - Intronic
1129598260 15:76981669-76981691 TTGGCGGGGGGAGGGGGGGTGGG + Intergenic
1129675384 15:77630433-77630455 TTGGGGGGTTGGGGTGGGGGAGG + Intronic
1129825014 15:78629168-78629190 GGGGCTGGTGGAGGTGGCGGTGG + Exonic
1130052223 15:80493347-80493369 GTGGCGGGGGGTGGGGGTGGGGG + Intronic
1130277457 15:82488935-82488957 TGGACGGGGGAAGGTGGTGGAGG - Intergenic
1130280258 15:82514993-82515015 TTGGGGGGGGGGGGTTGTGGGGG - Intergenic
1130291012 15:82601147-82601169 TTGGGAGGTCGAGGTGGGGGCGG - Intronic
1130459872 15:84152899-84152921 TGGGCAGGTGGAGGTGGCGCAGG - Intergenic
1130469778 15:84216124-84216146 TGGACGGGGGAAGGTGGTGGAGG - Intergenic
1130477266 15:84330687-84330709 TGGACGGGGGAAGGTGGTGGAGG - Intergenic
1130494499 15:84457443-84457465 TGGACGGGGGAAGGTGGTGGAGG + Intergenic
1130550914 15:84889391-84889413 TGGGCAGGGGGTGGTGGTGGGGG + Intronic
1130592067 15:85220748-85220770 TGGACGGGGGAAGGTGGTGGAGG - Intergenic
1130739196 15:86579843-86579865 TTGGTTGGTTGAGGTGGTGAGGG + Intronic
1130911426 15:88273623-88273645 TTGGCGGGGGCGGGGGGTGGGGG - Intergenic
1131214548 15:90526456-90526478 TTAGCGGGGCGTGGTGGTGGCGG - Intergenic
1131222793 15:90598931-90598953 TGAGCAGGTGGAGGGGGTGGCGG - Intronic
1131398455 15:92105507-92105529 TTGGGCGGTGGTGGTGGAGGGGG - Intronic
1131538201 15:93254696-93254718 TTAGCTGTTGGAGGTGGGGGAGG + Intergenic
1131711295 15:95059361-95059383 TTGGCGGGGGGGGGGGGGGGGGG + Intergenic
1131825640 15:96321236-96321258 TTGGGGGGTGGTGGTGGGGGGGG + Intergenic
1131828186 15:96336422-96336444 TCTTGGGGTGGAGGTGGTGGTGG + Intronic
1132074694 15:98810142-98810164 GTGGCTGGCGGAGGGGGTGGTGG + Intronic
1132117111 15:99145568-99145590 ATGGGGGGAGGTGGTGGTGGTGG + Intronic
1132256567 15:100381678-100381700 TTGGCAGGTGAAGGAGGTGAAGG - Intergenic
1132450577 15:101966016-101966038 TGGGTGGGTGCAGGTGGTCGTGG + Intergenic
1132675091 16:1118212-1118234 TGGGGGGGTGCAGGCGGTGGGGG - Intergenic
1132715604 16:1288628-1288650 TCGGCGGGTGGGAGTGGGGGTGG - Intergenic
1132729860 16:1356000-1356022 GTGGCGTGTGGGGGTTGTGGAGG + Intronic
1132801384 16:1756065-1756087 CTGGCGGGTGGTAATGGTGGTGG + Intronic
1132897211 16:2234785-2234807 TGGGCCGGTGGAGGTGGGAGGGG + Intronic
1133366757 16:5216337-5216359 CTGGGGAGTGGAGCTGGTGGTGG + Intergenic
1133425287 16:5683138-5683160 GTTGGGGGTGGAGGTGGAGGTGG + Intergenic
1133555213 16:6900135-6900157 ATTGCTGGTGGTGGTGGTGGTGG + Intronic
1133758369 16:8779246-8779268 GTTGCTGGTGGTGGTGGTGGTGG + Intronic
1133923941 16:10179702-10179724 CTGTGGGGTGGTGGTGGTGGCGG - Intronic
1134264736 16:12683437-12683459 TTGGCAGGTGGAGTTGGTTCAGG - Intronic
1134302621 16:13005130-13005152 CTGGTGTGTGGAGTTGGTGGAGG + Intronic
1134653119 16:15926437-15926459 ATGCGGGGTGGAGGTGGTGGAGG - Intergenic
1135552464 16:23408448-23408470 GTGGCGGGGGGAGGTGGGGCAGG + Intronic
1135748871 16:25040241-25040263 CTGGAAGGTGGAGGTGGTTGTGG + Intergenic
1135749373 16:25044638-25044660 TTGGGAGGTGGAGGTTGTAGTGG + Intergenic
1136334152 16:29600783-29600805 TCTGCCGGTGGAGATGGTGGGGG - Intergenic
1136512762 16:30748994-30749016 TTCGCGGGTGGTGGTGGTGGTGG + Intronic
1136539876 16:30923447-30923469 CTGGAAAGTGGAGGTGGTGGAGG + Intronic
1136586610 16:31190334-31190356 TTTCCCAGTGGAGGTGGTGGCGG + Exonic
1136608102 16:31349928-31349950 TTGGGAGGCTGAGGTGGTGGGGG + Intergenic
1137327381 16:47455519-47455541 TTGGGAGGTGGAGGTGGAGGTGG + Intronic
1137601757 16:49760894-49760916 TTGGAGGGAGGTGGTGGTGACGG - Intronic
1137666797 16:50254806-50254828 TTGGCAGGGGGTGGGGGTGGGGG - Intronic
1138130925 16:54479239-54479261 TTGCAGGGTGGTGGTGGTGGTGG - Intergenic
1138331447 16:56219026-56219048 TTGGGGGGTGGGTGTGGTGAGGG - Intronic
1139136070 16:64206202-64206224 GTGGGGGGTGGGAGTGGTGGGGG + Intergenic
1139139288 16:64241817-64241839 TTGGTGGGGGTAGGGGGTGGTGG - Intergenic
1139215401 16:65121773-65121795 TTGGCGGGGCGGGGTGGTGAGGG - Intronic
1139332319 16:66202944-66202966 AGGACAGGTGGAGGTGGTGGTGG - Intergenic
1139520566 16:67480541-67480563 TTGGCGGGGGGAGGGGGAAGAGG + Intronic
1139578232 16:67855883-67855905 TTGGCGGGGGGGGGGGATGGGGG + Intronic
1139964802 16:70739350-70739372 GTGGCTGGAGGAAGTGGTGGCGG + Intronic
1140172599 16:72622472-72622494 TGGGCGGGGGGCGGTGGGGGCGG + Intergenic
1140275477 16:73504822-73504844 GTGGGGAGTGGAGGTGGTAGGGG + Intergenic
1140313618 16:73872743-73872765 GTGGCGGGGGTTGGTGGTGGTGG + Intergenic
1140313718 16:73873021-73873043 GTGGTGAGTGGCGGTGGTGGTGG + Intergenic
1140313732 16:73873063-73873085 GTGGCGGATGGTGGTGGTGGTGG + Intergenic
1140313746 16:73873103-73873125 GTGGTGGGTGGTAGTGGTGGCGG + Intergenic
1140514932 16:75534994-75535016 TTGGCGGGAAGAGCTGGGGGTGG - Intronic
1140659180 16:77170915-77170937 TTTGCCTGTGGAGGGGGTGGAGG + Intergenic
1140836073 16:78795087-78795109 TTCGAGGGTGGTGTTGGTGGTGG + Intronic
1140870497 16:79102022-79102044 GTGGAGGGTGGTGGGGGTGGGGG + Intronic
1140912647 16:79467922-79467944 TTTGGGGGTGGTGGTCGTGGGGG + Intergenic
1141028854 16:80570866-80570888 GTGGAGGGTGGAAGTGGTGAGGG - Intergenic
1141396360 16:83708582-83708604 TTGGGGAGTGGAGGCGGTGTGGG - Intronic
1141615800 16:85208751-85208773 TTAGCGGATGGGGGTGGGGGTGG + Intergenic
1141634651 16:85307713-85307735 TTGACGTGCGGAGGTGCTGGAGG - Intergenic
1141661647 16:85444811-85444833 TTGGAGGCTGGAGGGGGCGGAGG - Intergenic
1141699229 16:85634875-85634897 TGGGCGGCTGGAGCTGCTGGGGG + Intronic
1141726767 16:85794805-85794827 GTGGTGGGGGGAGGTGCTGGAGG + Intronic
1141754438 16:85982078-85982100 TGGGCTGGAGAAGGTGGTGGAGG + Intergenic
1142073069 16:88102056-88102078 TGGGCGGGGGGCGGGGGTGGGGG - Intronic
1142286486 16:89173499-89173521 GAGGCTGGGGGAGGTGGTGGAGG + Intronic
1142423402 16:89987365-89987387 TGGCCAGGTGGAGGAGGTGGAGG + Intergenic
1142703888 17:1682086-1682108 GTGGGTGGTGGTGGTGGTGGTGG - Intronic
1142703889 17:1682089-1682111 ATGGTGGGTGGTGGTGGTGGTGG - Intronic
1142780162 17:2175329-2175351 TTGGGGGTTGGGGGTGGTGTGGG + Intronic
1142905885 17:3041508-3041530 TTTGGGGGTGGGGGTGGGGGTGG + Intergenic
1143248483 17:5504921-5504943 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
1143428574 17:6861862-6861884 TTGTTTGGTGGTGGTGGTGGTGG + Intergenic
1143468616 17:7156438-7156460 TTGGCGGTGGGATGTGGGGGAGG - Intergenic
1143585541 17:7848614-7848636 TTGGCTAGAGGCGGTGGTGGTGG - Exonic
1143585553 17:7848662-7848684 CTGGGGGGTGGGGGTGGTGGTGG - Exonic
1143989533 17:10944898-10944920 TTGGGGTGGGGAGGGGGTGGGGG - Intergenic
1144051831 17:11503389-11503411 CTGGAGAGTGGAGGTGGGGGTGG + Intronic
1144364486 17:14529148-14529170 TTGGCCTGTGGTGGTGGCGGTGG + Intergenic
1144626258 17:16845795-16845817 CTGGCGGATGGAGGTGGTCATGG + Intergenic
1144765842 17:17731982-17732004 ATTGCTGGGGGAGGTGGTGGTGG + Intronic
1144795595 17:17889152-17889174 TTGGCGGGTTGAGGGGGATGGGG + Intronic
1144850073 17:18239720-18239742 GTGGCGGGTGCAGCTGGGGGTGG + Intronic
1144880175 17:18426925-18426947 CTGGCGGATGGAGGTGGTCATGG - Intergenic
1145152059 17:20517459-20517481 CTGGCGGATGGAGGTGGTCATGG + Intergenic
1145164643 17:20603100-20603122 TTTGTTGGTGGTGGTGGTGGTGG - Intergenic
1145792993 17:27639344-27639366 CTGGGGGGTGGGGGAGGTGGAGG - Intronic
1146271270 17:31487611-31487633 TTAGGGGGTGGAGGCGGCGGCGG + Intronic
1146398007 17:32484092-32484114 TGGGGGTGGGGAGGTGGTGGTGG + Intergenic
1146430009 17:32784167-32784189 TTGGTGGGTGGAAGTGTTGTTGG - Intronic
1146605129 17:34251419-34251441 TTGGTGGGTGGGGGTGATGGTGG - Intergenic
1146619616 17:34387298-34387320 TCTGCCGGTGGTGGTGGTGGTGG - Intergenic
1147153987 17:38533975-38533997 TTTCCAGGTGGTGGTGGTGGTGG - Intronic
1147217672 17:38910454-38910476 TTGGCAGGGGGCGGTGGAGGGGG - Intronic
1147580404 17:41624489-41624511 CTGGCGGATGGAGGTGGTCATGG + Exonic
1147606025 17:41774139-41774161 TGGGCTGGTGGGGGTGGTGAGGG - Intronic
1147957484 17:44144380-44144402 TTGGGAGGTTGAGGTGGGGGCGG - Intronic
1147990024 17:44326833-44326855 CGGGCGGGTGGAGGCGGGGGGGG + Intergenic
1148125185 17:45233072-45233094 CAGGTGTGTGGAGGTGGTGGGGG + Intronic
1148511696 17:48176445-48176467 TTCGGTGGTGGTGGTGGTGGTGG + Intronic
1148588718 17:48799498-48799520 ATGGAGGGTGAAGGTGGAGGTGG - Intronic
1148667249 17:49383883-49383905 TTGCCAGGTGGAGGTAGAGGTGG - Intronic
1148751453 17:49947827-49947849 TTGGGGGATGGAGGTCCTGGAGG + Intergenic
1148771629 17:50070745-50070767 TTGTTGGGTGGGGGTGGGGGTGG + Intronic
1148775186 17:50091250-50091272 TTGGCGTCTGGTGGTGGTTGTGG - Intergenic
1148825271 17:50388550-50388572 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
1149428317 17:56576770-56576792 TTGGGGGCTGGGAGTGGTGGTGG + Intergenic
1149441537 17:56678535-56678557 TTGGGGGGTGGGGGGTGTGGTGG - Intergenic
1149459816 17:56819362-56819384 ATGGAGAGTGGTGGTGGTGGGGG - Intronic
1149548908 17:57525271-57525293 TTGGGGGGGGCAGGTGGGGGAGG + Intronic
1149737737 17:59012239-59012261 GTGGGTGGTGGTGGTGGTGGTGG - Intronic
1149737738 17:59012242-59012264 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
1150009744 17:61492853-61492875 TGGGTGGTTGGAGTTGGTGGAGG - Intergenic
1150148695 17:62792593-62792615 GTGGTTGATGGAGGTGGTGGTGG - Intronic
1150148946 17:62793608-62793630 TGTGGTGGTGGAGGTGGTGGTGG - Intronic
1150476540 17:65480057-65480079 GGGGTGGGTGGGGGTGGTGGGGG - Intergenic
1150724150 17:67637862-67637884 TTGTGGGGTGGGGGTGGGGGAGG + Intronic
1150782309 17:68133829-68133851 TAGGAGGGGGGAGGTGTTGGGGG + Intergenic
1150782791 17:68136371-68136393 TGGGGGGATGGGGGTGGTGGTGG + Intergenic
1150872594 17:68929970-68929992 CTGGGGGGTGGGGGCGGTGGGGG + Intronic
1150973265 17:70054796-70054818 TTTGTTGGTGGTGGTGGTGGTGG + Intronic
1151083051 17:71350491-71350513 TTTGTTGGTGGTGGTGGTGGTGG - Intergenic
1151191395 17:72400511-72400533 TTGGGGGGTGGGGGCGGTGTCGG + Intergenic
1151312222 17:73300286-73300308 TTGGAGGCTGGGGGTGGTGGGGG - Intronic
1151413623 17:73947483-73947505 TTGGGGAGAGGAGGCGGTGGGGG + Intergenic
1151418693 17:73983620-73983642 GTGGGGGGTGGTGGTGGGGGTGG - Intergenic
1151850042 17:76684780-76684802 GTGGGGTGTGGAGGGGGTGGGGG + Intronic
1151928197 17:77213971-77213993 CTGGCTGGAGGAGGTGGTGGCGG - Exonic
1152103179 17:78314468-78314490 TCGGCTGGAGGAGGTGCTGGGGG + Intergenic
1152244525 17:79178128-79178150 ATGGCTGGTGGACGTGGCGGCGG - Intronic
1152336237 17:79701367-79701389 TGGGAGGGTGGAGGAGGGGGAGG + Intergenic
1152336349 17:79701659-79701681 TGGGAGGGTGGAGGAGGGGGAGG + Intergenic
1152597002 17:81242634-81242656 TGGGCGGGTGGGGGGGGGGGAGG + Intergenic
1152634652 17:81425798-81425820 ATGGTGGGTCGTGGTGGTGGTGG + Intronic
1152634702 17:81426040-81426062 GTGGCTCGTGGTGGTGGTGGTGG + Intronic
1152634808 17:81426489-81426511 ATGGCTCGTGGTGGTGGTGGTGG + Intronic
1152871186 17:82753949-82753971 CTGGGAGGTGGAGGTTGTGGAGG - Intronic
1153317738 18:3741179-3741201 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
1153326830 18:3829441-3829463 TTGGGGGTGGGAGGGGGTGGAGG + Intronic
1153805422 18:8705735-8705757 CCACCGGGTGGAGGTGGTGGTGG - Intronic
1154307894 18:13243859-13243881 TGGGCGGGTGGATGTGTGGGTGG - Intronic
1154965418 18:21350972-21350994 TTTGGAGGTGGTGGTGGTGGGGG + Intronic
1155026969 18:21949837-21949859 TTGGCGGGAGGCGGTGGGGCGGG - Intergenic
1155054584 18:22172125-22172147 TCGGATGGTGGTGGTGGTGGTGG - Exonic
1155546847 18:26924468-26924490 TTGGCTGGTGGAGGTGCAGCTGG + Intronic
1155557045 18:27031386-27031408 TTGGGGAGAGGAGATGGTGGGGG - Intronic
1155654429 18:28177433-28177455 TTGGCCGGTGGAGGATGTGGAGG + Exonic
1156108069 18:33690102-33690124 TTGGGAGGTGAAGTTGGTGGCGG - Intronic
1156370806 18:36469805-36469827 TTGGAGGGTTAAGGGGGTGGCGG + Intronic
1156382180 18:36573049-36573071 CAGGAGGGTGGGGGTGGTGGTGG + Intronic
1156858690 18:41812582-41812604 ATGTTGGCTGGAGGTGGTGGGGG + Intergenic
1156961453 18:43036537-43036559 CTGGCGGGGGGAGGTAGCGGGGG - Intronic
1157213030 18:45760126-45760148 TTGGAGGCAGGAAGTGGTGGGGG - Intergenic
1157300785 18:46477579-46477601 CTGGCTGGTGGAGAAGGTGGAGG - Intronic
1157383966 18:47247173-47247195 GCGGGGGGTGGTGGTGGTGGTGG + Intronic
1157468693 18:47970721-47970743 TTGGCGGGTGGGGTCGGGGGAGG - Intergenic
1157574639 18:48735505-48735527 GTGGCAGGTGGAGGATGTGGAGG + Intronic
1157580853 18:48773465-48773487 CTGGCTGGTGGGGGTGGTGGTGG - Intronic
1158251490 18:55492939-55492961 TTTGTGGGTGGAGGTGTTGGTGG - Intronic
1158331462 18:56367755-56367777 TGTTCTGGTGGAGGTGGTGGAGG + Intergenic
1158724411 18:59956383-59956405 GTGGGCGGTGGATGTGGTGGGGG + Intergenic
1159001482 18:62978957-62978979 CAGCCGGGTGGAGGTGGAGGTGG + Exonic
1159916582 18:74193724-74193746 AGGGAGGGTGGGGGTGGTGGGGG - Intergenic
1160029283 18:75244522-75244544 TTGGCTGGTGGAGGAGGCGCTGG + Intronic
1160113182 18:76053298-76053320 TTGGGGGCTGGAGGTGGCTGAGG + Intergenic
1160200667 18:76792807-76792829 TAGGAGGGCTGAGGTGGTGGGGG + Intergenic
1160208658 18:76858677-76858699 GAGGCGGGTGCAGGTGGAGGAGG + Intronic
1160208712 18:76858853-76858875 GAGGCGGGTGCAGGTGGAGGAGG + Intronic
1160208740 18:76858941-76858963 GAGGCGGGTGCAGGTGGAGGAGG + Intronic
1160208782 18:76859073-76859095 GAGGCGGGTGCAGGTGGAGGAGG + Intronic
1160208796 18:76859117-76859139 GAGGCGGGTGCAGGTGGAGGAGG + Intronic
1160208811 18:76859161-76859183 GAGGCGGGTGCAGGTGGAGGAGG + Intronic
1160208838 18:76859249-76859271 GAGGCGGGTGCAGGTGGAGGAGG + Intronic
1160519992 18:79501604-79501626 TTGGCGGGGGGAGGGGGGGTGGG - Intronic
1160844662 19:1161086-1161108 CTGGAGGCTGGAGGTGGGGGTGG + Intronic
1160844819 19:1161534-1161556 TGGGGGGGTGGAAGTGGGGGTGG + Intronic
1160971267 19:1768807-1768829 GTGGAAGGTGGAGGTGATGGAGG + Intronic
1161077820 19:2294804-2294826 GTGGCGGGTGGAGGTGGGGTTGG + Intronic
1161151662 19:2713270-2713292 ATGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151674 19:2713314-2713336 ATGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151763 19:2713666-2713688 ATGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151788 19:2713754-2713776 ATGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151813 19:2713842-2713864 ATGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151837 19:2713930-2713952 ATGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151849 19:2713974-2713996 ATGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151875 19:2714062-2714084 GTGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151912 19:2714194-2714216 GTGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161151951 19:2714326-2714348 ATGAAGGGTGGAGGAGGTGGTGG - Intergenic
1161251897 19:3285156-3285178 TTTGCGGGTATAGGTGGTGGTGG - Intronic
1161607895 19:5224992-5225014 GTGGGGCGTGGTGGTGGTGGTGG - Intronic
1161628823 19:5341059-5341081 TGGGGTGGTGGTGGTGGTGGCGG + Intergenic
1161645164 19:5448811-5448833 GGGGCGGGGGGAGGTGGAGGTGG + Intergenic
1161698647 19:5783681-5783703 TTGGGGGGTGGGGGTGGCAGCGG + Exonic
1161914011 19:7215418-7215440 TGAGTGGGTGGAGGGGGTGGTGG - Intronic
1162089418 19:8269225-8269247 TTGGCAGGTGGGGATGGTGGGGG - Intronic
1162362174 19:10226987-10227009 TTGGTGGGTGGCGATGGGGGGGG - Intronic
1162450445 19:10751120-10751142 ATGGGGGGTGGAGGTGGGAGAGG + Intronic
1162758539 19:12874594-12874616 CTGGGTGTTGGAGGTGGTGGAGG + Exonic
1162909004 19:13839664-13839686 CTTGGGGGCGGAGGTGGTGGTGG - Intergenic
1162927795 19:13938748-13938770 TTTGCGGGGGGAGGAGGGGGCGG - Intronic
1163125691 19:15243127-15243149 TGGGGTGGTGGGGGTGGTGGCGG + Exonic
1163167148 19:15506345-15506367 GTGGGGGGTAGAGGTGGGGGTGG - Intergenic
1163286842 19:16354016-16354038 CTGGGAGGTGGAGGTTGTGGTGG - Intergenic
1163406613 19:17126909-17126931 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1163651564 19:18521196-18521218 TTGGAGAGTGGAAGTGTTGGGGG - Intronic
1163748919 19:19064005-19064027 GTGGCGGCTGGAGGTAGCGGCGG + Exonic
1163753370 19:19091978-19092000 GTGGCGGGTGCTGGTGGTGCTGG + Intronic
1164169286 19:22710193-22710215 TTGGGAGGCGGAGGTTGTGGTGG + Intergenic
1164813937 19:31179724-31179746 ATGGTAGGTGGTGGTGGTGGTGG + Intergenic
1165448246 19:35868533-35868555 GCGGCGGGAGGAGGAGGTGGCGG + Exonic
1165715082 19:38039385-38039407 GCGGGGGGTGGGGGTGGTGGGGG + Intronic
1165721300 19:38081744-38081766 GGGGCGGGTGGTGGCGGTGGCGG - Exonic
1165725858 19:38112366-38112388 GTGGAGGGTTGAGCTGGTGGGGG + Intronic
1165798949 19:38536126-38536148 ATGGCGGGTGGGGGTGGGGTGGG - Intronic
1165861222 19:38910607-38910629 CTGGCTGGTGGTGGTGGTGGTGG + Exonic
1165901104 19:39169769-39169791 TGGGCTGGGGGAGGTGGTGGTGG - Intronic
1166192933 19:41187624-41187646 TAGCGGAGTGGAGGTGGTGGGGG - Intergenic
1166210832 19:41305742-41305764 TAGGCAGGTGGTGGTGGAGGTGG - Exonic
1166231854 19:41429099-41429121 TTGGAGGGTGGACATGCTGGTGG + Intronic
1166295141 19:41885245-41885267 TTGGGGGTTGGAGATGATGGAGG - Intronic
1166357996 19:42238716-42238738 TTGGGAGGTCGAGGTGGGGGCGG + Intronic
1166545828 19:43634596-43634618 TGGGGGGTTGGGGGTGGTGGGGG + Intronic
1166682697 19:44778409-44778431 TCTGAGGGAGGAGGTGGTGGGGG - Intronic
1166704873 19:44903212-44903234 GTGGCAGGGGGAGGTGGAGGTGG - Exonic
1166892739 19:46003514-46003536 TTGGCGGGTTGGGGTGGGAGGGG + Intronic
1166976966 19:46610459-46610481 GTGGGGTGGGGAGGTGGTGGGGG - Exonic
1167120373 19:47513125-47513147 TTGGCAGGGGGCGGTGGTGTGGG - Intronic
1167272118 19:48511591-48511613 CAGGGAGGTGGAGGTGGTGGCGG + Exonic
1167455461 19:49595236-49595258 TGGGCTGGTGGCGGGGGTGGTGG - Exonic
1167457008 19:49601649-49601671 ATGGCTGGTGGAGGTGGCGGCGG - Exonic
1167457018 19:49601682-49601704 GCGGCTGGTGGGGGTGGTGGTGG - Exonic
1167483499 19:49746846-49746868 TTTTGGGGTGGAGGTGGTTGCGG - Intronic
1167499264 19:49836258-49836280 CTGGTGGCTGGAGGTGGTGGAGG - Exonic
1167592629 19:50412712-50412734 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
1167606404 19:50483014-50483036 TGGGCGGCGGGGGGTGGTGGAGG - Exonic
1167637344 19:50662505-50662527 GTGGCGGGTGGACGTGGAGGAGG + Exonic
1167780779 19:51597630-51597652 GTGCAGGCTGGAGGTGGTGGTGG + Intergenic
1168332809 19:55579611-55579633 TGGGCGGGTGGAGGAGGCTGCGG + Exonic
1168480374 19:56715267-56715289 TTGGCGGGGGGGGGGGGGGGTGG - Intergenic
1168501492 19:56897078-56897100 CTGGCCCGTGGAGGCGGTGGTGG + Intergenic
925059892 2:882959-882981 ATGGTGGATGGAGGTGATGGTGG + Intergenic
925209491 2:2034339-2034361 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209501 2:2034392-2034414 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209511 2:2034445-2034467 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209521 2:2034498-2034520 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209551 2:2034655-2034677 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209591 2:2034864-2034886 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209611 2:2034969-2034991 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209631 2:2035074-2035096 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209641 2:2035127-2035149 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209651 2:2035180-2035202 TTGGAGGGTGGAGATGGTTGGGG - Intronic
925209662 2:2035233-2035255 TTGGAGGGTGGAGATGGTTGGGG - Intronic
925209683 2:2035338-2035360 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209693 2:2035391-2035413 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209703 2:2035444-2035466 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209713 2:2035497-2035519 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209723 2:2035550-2035572 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209733 2:2035603-2035625 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209743 2:2035656-2035678 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209765 2:2035761-2035783 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209785 2:2035866-2035888 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209795 2:2035919-2035941 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209814 2:2036025-2036047 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209834 2:2036130-2036152 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209844 2:2036183-2036205 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209864 2:2036288-2036310 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925209874 2:2036341-2036363 TTGGAGGGTGGAGATTGTTGGGG - Intronic
925361843 2:3285325-3285347 CTGGGGGGTGGGGGTGGGGGTGG - Intronic
925543711 2:4994828-4994850 TTTGTGTGTGGTGGTGGTGGTGG - Intergenic
925713787 2:6767036-6767058 TTGGCGGGTGGCGGGGCTAGGGG - Intergenic
925896849 2:8478863-8478885 TTGGCTGGGGGTGGAGGTGGGGG - Intergenic
925903706 2:8526490-8526512 GTGGGCGGTGGTGGTGGTGGTGG - Intergenic
926034915 2:9629057-9629079 TTGGGGGGTGGGGGTGGGGGAGG + Intronic
926055845 2:9773481-9773503 GTGGCGGGTGCAGGAGCTGGAGG - Intergenic
926185251 2:10685490-10685512 TTGGCGGGGGGGGGGGGGGGGGG - Intronic
926540900 2:14180170-14180192 CTGGGAGGTGGAGGTTGTGGAGG - Intergenic
926615480 2:14992793-14992815 ATGGTGGTTGTAGGTGGTGGTGG - Intergenic
926807558 2:16725251-16725273 TAGGAGTGTGGAGGTGGTGAAGG - Intergenic
926809696 2:16745395-16745417 TTGGCTGGTGGGGATGTTGGGGG + Intergenic
927116405 2:19906883-19906905 ATGGATGGTGGTGGTGGTGGTGG + Intergenic
927202148 2:20584480-20584502 TTGGCGGGGGATGGTGGTGCAGG - Intronic
927202252 2:20585047-20585069 TTGGTGGGAGGAGGTGATGAGGG - Intronic
927432726 2:23040691-23040713 TTGGTAGGTGGTGGTGGTGGTGG - Intergenic
927489558 2:23511823-23511845 GTGGCTGGTGGGGGTGGTGGGGG + Intronic
927698661 2:25253538-25253560 TGGGAGGGTGGAGGTGGGCGAGG - Intronic
927764241 2:25790313-25790335 TTGCGGGGTGGGGGTGGGGGGGG + Intronic
927786947 2:25981094-25981116 TCCTCGGGTGGCGGTGGTGGCGG - Exonic
927875416 2:26651955-26651977 GTGGCGGGGCGAGGCGGTGGGGG + Intergenic
928201003 2:29247461-29247483 ATGGTGGGTGGAGGAGATGGGGG + Intronic
928247288 2:29641617-29641639 GTAGGGGGTGGTGGTGGTGGTGG - Intronic
928337713 2:30412317-30412339 TTGGTTGGGGGGGGTGGTGGGGG + Intergenic
928337946 2:30414219-30414241 TTGACAGGTGGAGAAGGTGGGGG - Intergenic
928388363 2:30888909-30888931 TTGGGAGGTGGGGGTGGAGGGGG - Intergenic
928416498 2:31096811-31096833 TTGGATGGTGGTGGTGGTGCTGG - Intronic
928630368 2:33185338-33185360 TTGGTGGATGGAGGTATTGGAGG + Intronic
928858455 2:35827935-35827957 TGGGGGGGTGGGGGAGGTGGGGG + Intergenic
929133645 2:38602652-38602674 CAGGCGGGTGGGGGTGGCGGTGG + Exonic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
929455225 2:42060521-42060543 TTGGTGGGTGGAAGGGGAGGTGG - Intergenic
929466532 2:42149672-42149694 TTGTCGGGGGGAGGGTGTGGGGG - Intergenic
929562833 2:42966424-42966446 GTGGCGGGGGGGGGTGGGGGGGG + Intergenic
929699218 2:44147457-44147479 ATGGTGGCAGGAGGTGGTGGGGG - Intergenic
930167203 2:48214665-48214687 TTGGTGGGTGGGGGGGTTGGGGG + Intergenic
930170606 2:48247518-48247540 TTGGCGGGTGGGGGGGGGGCGGG + Intergenic
930221717 2:48752977-48752999 TTGGCGGGGGGGGGGGGGGGTGG + Intronic
930278640 2:49343012-49343034 TTGGCGGGGGTGGGGGGTGGTGG - Intergenic
930322020 2:49867363-49867385 TTGGCTGCTGAAGGTGGAGGTGG + Intergenic
930568406 2:53052716-53052738 TTGGCGGGCGGAGGGGGTCAGGG + Intergenic
930612756 2:53561933-53561955 TTGGTGGGTGGGGGTAGGGGTGG - Intronic
931064454 2:58569921-58569943 TTGGGGTGCGGTGGTGGTGGTGG + Intergenic
931069919 2:58635017-58635039 CTGGCGGGTTGGGGTGGGGGTGG - Intergenic
931356179 2:61538874-61538896 TTGGCGGGAGCCGGTGGGGGCGG - Intergenic
931547926 2:63409151-63409173 TGTCCTGGTGGAGGTGGTGGGGG - Intronic
931581298 2:63778280-63778302 TTGGAGGGTGGAGGTTGCAGTGG - Intronic
931590374 2:63876365-63876387 TTGAGGGGTGGTGGTGGTAGGGG + Intronic
931716491 2:65032931-65032953 ATGGGGGGTGGGGGTGGGGGTGG + Intergenic
931732706 2:65167165-65167187 TTGGCGGGGCGGGGTGGTGGGGG + Intergenic
931836552 2:66105039-66105061 TTTGCGGGGGGAGGTGCGGGTGG + Intergenic
931847047 2:66214728-66214750 ATGGAGGGTGGATTTGGTGGGGG - Intergenic
932170511 2:69551231-69551253 GGGGCCGGTGGGGGTGGTGGAGG + Intronic
932244212 2:70182846-70182868 TTGGCTGGTGGAGAAGGAGGAGG - Exonic
932475617 2:72003975-72003997 ATGGCAGTTGGAGGTGGAGGCGG + Intergenic
932670235 2:73731187-73731209 TTGGAGGGAGGAGGGTGTGGTGG - Intronic
933228248 2:79775789-79775811 TTAGCTGGTGGTGGAGGTGGTGG - Intronic
933281098 2:80333630-80333652 TTTTCTGGGGGAGGTGGTGGGGG + Intronic
933343472 2:81051850-81051872 TTTGTGGGTGGTGGTGGTGGTGG + Intergenic
933458447 2:82547574-82547596 TTTGGGGGTGGAGGTGGTTCAGG - Intergenic
933729087 2:85443960-85443982 TTGGCTGGGCGAGGTGGTGGTGG + Intergenic
934044887 2:88164755-88164777 GTAGGAGGTGGAGGTGGTGGTGG + Intergenic
934138336 2:89019477-89019499 GTGGAGGGGGGAGGTGGAGGAGG + Intergenic
934144414 2:89077504-89077526 GTGGTGGGGGGAGGTGGAGGAGG + Intergenic
934224837 2:90123045-90123067 GTGGTGGGGGGAGGTGGAGGAGG - Intergenic
934247823 2:90323412-90323434 GTGGCGGGGGGGGGTGGGGGGGG + Intergenic
934492952 2:94774701-94774723 GTGGGGGGTGGGGGTGGTGGGGG - Intergenic
934525346 2:95048395-95048417 CTGGCGGGTACAGGTGGTGTGGG - Intronic
934601752 2:95663442-95663464 TTGGTGGGGGGGGGAGGTGGGGG - Intergenic
934948252 2:98557849-98557871 TTGGCAGGCGGGGGTGGAGGGGG - Intronic
935082704 2:99814242-99814264 TTTGAGGGTGGTGGTGGTGGTGG - Intronic
935100908 2:99995092-99995114 TTGGTGGCTGGAGCAGGTGGGGG + Intronic
935143930 2:100381008-100381030 TTTGTTGGTGGTGGTGGTGGTGG - Intergenic
935240238 2:101171600-101171622 TGGGGGGGCGGGGGTGGTGGTGG - Intronic
935334605 2:102004889-102004911 TTGGCTGGAGATGGTGGTGGGGG + Intronic
935366164 2:102293111-102293133 TTGGCAGGTGGAGGGTGGGGAGG + Intergenic
935638253 2:105267010-105267032 TTGGAGTGTGGGGGTGGTGGGGG + Exonic
936052039 2:109231277-109231299 TTGGTGGGTGGATGTGGGAGAGG + Intronic
936117670 2:109714964-109714986 TGGGGGGGTGGGGGTGGGGGCGG + Intergenic
936444722 2:112586547-112586569 GTGGAGGGTGAGGGTGGTGGTGG - Intronic
937150187 2:119681098-119681120 TTGGAAGGTGAAGGTGGTGAAGG - Exonic
937198787 2:120183306-120183328 TTGGCAGGTGGAGGGGAGGGGGG - Intergenic
937426372 2:121802574-121802596 GTGGCAGGTGGAGATGATGGAGG + Intergenic
937536854 2:122899501-122899523 TTGTGAGGTGGGGGTGGTGGGGG + Intergenic
937910868 2:127075022-127075044 GTTAGGGGTGGAGGTGGTGGGGG - Intronic
937922154 2:127138239-127138261 GTGGGGGGTGGAGGTGGGGGTGG - Intergenic
937967487 2:127525131-127525153 ATGGGGGGTGGGGGTGGTGTTGG + Intronic
937993209 2:127675299-127675321 GTGGCAGGTGGGGGTGGCGGCGG + Intronic
938673892 2:133611275-133611297 TTTGCAGATGGAGGAGGTGGTGG - Intergenic
938745687 2:134276158-134276180 TTGGCGGGCGGCGGGGGTGGGGG - Intronic
938924361 2:136025426-136025448 TAGGTGGGTGGAAGTGGCGGAGG + Intergenic
939064702 2:137468628-137468650 GTGGGGGGTGGGGGTGGGGGCGG + Intronic
939103638 2:137924841-137924863 TTGGCGGGGGTGGGTGGGGGTGG - Intergenic
939278105 2:140027855-140027877 TTAGTGGGTGGTGGTGGTGATGG - Intergenic
939602770 2:144213894-144213916 TTGGTGGGTGGAGGTGCAGAAGG - Intronic
939792339 2:146593508-146593530 TTGGGAGGTGGAGGTCGAGGTGG + Intergenic
939807773 2:146794374-146794396 TTGTGGGGTGGGGGTGGGGGGGG + Intergenic
940212372 2:151268411-151268433 ATGGAGGGTGGAGGAGGGGGAGG - Intergenic
940252389 2:151693418-151693440 TTGGAGGCTGGGGGTGGGGGAGG - Intronic
940442670 2:153736848-153736870 TTGGCAGGGGTGGGTGGTGGTGG - Intergenic
940510870 2:154613076-154613098 TTGGTGGTTGGAATTGGTGGTGG - Intergenic
940540610 2:155010918-155010940 TTGGCGGGGGCGGGGGGTGGGGG - Intergenic
940687706 2:156874816-156874838 CTGGGGGGTGGGGGTGGGGGTGG - Intergenic
940778661 2:157910312-157910334 TTTGGCCGTGGAGGTGGTGGGGG + Intronic
941624237 2:167812982-167813004 GGGGGGGGTGGGGGTGGTGGTGG - Intergenic
942302498 2:174575302-174575324 TTTGGCGGAGGAGGTGGTGGCGG - Exonic
942351364 2:175056887-175056909 CTGGGAGGTGGAGGTTGTGGTGG - Intergenic
942353146 2:175076345-175076367 CTGGTGGTTGGTGGTGGTGGTGG - Intronic
942728083 2:179032352-179032374 TTTGGGGATGGGGGTGGTGGTGG + Intronic
942780461 2:179635379-179635401 TTGGGGGGTGGGGGGGCTGGGGG + Intronic
943120623 2:183730461-183730483 TTTGTTGGTGGTGGTGGTGGCGG - Intergenic
943607039 2:189987992-189988014 TAGGTGGATGGGGGTGGTGGCGG + Intronic
943745436 2:191457015-191457037 TTGGTGGGTGGGGGTGGGGGAGG - Intergenic
943954969 2:194176625-194176647 TGGGGGGGTGGGGGTGTTGGGGG - Intergenic
944160945 2:196658874-196658896 ATGGAGGGTGGAGGAGGTGTTGG + Intronic
944221809 2:197310746-197310768 TCGGCGGGAGGAGGCGGCGGCGG - Exonic
944818033 2:203399510-203399532 TTGGCGGGGGGAGGAGGGGCGGG + Intronic
944821870 2:203440353-203440375 GCTGTGGGTGGAGGTGGTGGTGG + Exonic
944901593 2:204222111-204222133 GTGGGGGGTGGGGTTGGTGGGGG - Intergenic
944948391 2:204717523-204717545 GTGTCTGGTGGAGTTGGTGGTGG + Intronic
944991977 2:205248379-205248401 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
945158302 2:206862116-206862138 GGGGCGGGCGGTGGTGGTGGTGG + Intergenic
945265217 2:207884127-207884149 TTGGGGGGTGGGGGTGGGGACGG - Intronic
945291600 2:208132921-208132943 TTGGGGGTGGGAGGTGGTTGGGG - Intergenic
945374879 2:209068015-209068037 TTTGCTGGTGGAGGTGGGGGTGG + Intergenic
945812175 2:214562145-214562167 TTGGGGGGTGTAGTTGGGGGAGG - Intronic
945859196 2:215101395-215101417 TTGGCATCTGGAGGTGGAGGTGG - Intronic
946026161 2:216673185-216673207 GTGGCGGGAGCAGGTGGTTGAGG + Exonic
946029515 2:216693477-216693499 GGCGGGGGTGGAGGTGGTGGTGG + Intronic
946043723 2:216803877-216803899 GTGGCGGGGGGGGGGGGTGGGGG + Intergenic
946167512 2:217873998-217874020 TTGGGGGGCGGGGGTGGTGGTGG - Intronic
946177336 2:217929657-217929679 GTGGTGGGTGGAGATGGGGGTGG - Intronic
946254897 2:218435233-218435255 TAGGAGGGTGGAGGTAGGGGTGG + Intronic
946417843 2:219549509-219549531 TTGGCGGGTCCAGCTGGTGGGGG + Intronic
946529600 2:220557606-220557628 TTGGCGGGAATAGGTGGTAGTGG + Intergenic
946637660 2:221747516-221747538 TTGGGGTGTGGGTGTGGTGGTGG - Intergenic
946651624 2:221897694-221897716 TTTTGGGGTGGTGGTGGTGGTGG - Intergenic
946834951 2:223763501-223763523 GGGGCAGGTGGAGGGGGTGGAGG - Intronic
946870407 2:224079385-224079407 TTGCCAGGTGGAGGTGGTAAGGG - Intergenic
946912613 2:224480094-224480116 AAGGCAGGTGGTGGTGGTGGTGG + Intronic
947111017 2:226719831-226719853 TTGGCGGGGGCAGGGGGAGGAGG - Intergenic
947215624 2:227747390-227747412 TTGACAGGTGGAGGTGGTTGGGG + Intergenic
947484122 2:230531415-230531437 TTGGGGGGTTGAGGGGCTGGGGG + Intronic
947653733 2:231808776-231808798 TTGGAGGGTGGGGGTGGGGTGGG + Exonic
947691542 2:232141466-232141488 TTGAGGGGTGGAGGAGGAGGAGG + Intronic
947714306 2:232332125-232332147 TTGGCTGGTGGAGGTGGCTCAGG - Intronic
947714545 2:232333125-232333147 GTGGAAGGAGGAGGTGGTGGTGG - Intronic
947717111 2:232346509-232346531 TTTGGGGGTGGTGGTGGTGGTGG - Intergenic
947727918 2:232411095-232411117 ATAGAGGGTGGGGGTGGTGGAGG + Intergenic
947733514 2:232443504-232443526 TTGGCTGGTGGAGGTGGCTCAGG - Intergenic
947800370 2:232925869-232925891 CTGGGTGGTGGTGGTGGTGGTGG - Intronic
947824485 2:233095471-233095493 TTAGCTGGAGGGGGTGGTGGTGG + Intronic
947831459 2:233144526-233144548 GGTGAGGGTGGAGGTGGTGGTGG + Intronic
948110953 2:235455639-235455661 TTGTCTGATGGTGGTGGTGGGGG - Intergenic
948176258 2:235945883-235945905 ATGGCTGGCGGTGGTGGTGGGGG + Intronic
948230250 2:236344055-236344077 TTTGTGGGGGGAAGTGGTGGAGG + Intronic
948453545 2:238093379-238093401 GTGGCGGGTGGAGAGTGTGGAGG - Intronic
948765701 2:240217633-240217655 GGGGTGGGTGGAGTTGGTGGAGG - Intergenic
948765713 2:240217670-240217692 GGGGTGGGTGGAGTTGGTGGAGG - Intergenic
1168799800 20:637047-637069 TGTGCTGGTGGTGGTGGTGGTGG - Intergenic
1168972118 20:1938005-1938027 TTGGGTGGTGGTGGTAGTGGTGG - Exonic
1169118535 20:3082467-3082489 CTGGCCGGTGGGCGTGGTGGCGG + Intergenic
1169215935 20:3794913-3794935 TGGGCGGGTGGTGGTGCGGGGGG - Intronic
1169260056 20:4131041-4131063 TTGGTGGGGGGAGGGGGTGTGGG - Intronic
1169287061 20:4318206-4318228 TTGGCTGGTGCAGGTGGGAGTGG + Intergenic
1169422848 20:5473675-5473697 ATGGCAGGGGGAGGAGGTGGTGG - Intergenic
1169426577 20:5501800-5501822 ATGGCAGGGGGAGGAGGTGGTGG + Intergenic
1169517406 20:6332908-6332930 TTTTCTGGTGGAAGTGGTGGAGG + Intergenic
1169587072 20:7096950-7096972 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1169678971 20:8187841-8187863 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
1169812727 20:9625069-9625091 ATGGCTGGTGGATGTGGTGGTGG - Intronic
1169876232 20:10299904-10299926 TTGTCAAGTGGAGGTGGTGAAGG + Intronic
1170136433 20:13079484-13079506 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
1170386220 20:15820189-15820211 TTGGCAGGAGTAGGGGGTGGGGG + Intronic
1170390945 20:15874059-15874081 TTGGGGGGTGGGGGGGCTGGGGG - Intronic
1170764992 20:19282277-19282299 TTTTCTGGTGGTGGTGGTGGAGG - Intronic
1170969370 20:21103326-21103348 TTGGCGGGTGGAGGGGGCGGTGG + Intergenic
1170985371 20:21253171-21253193 TTGGCGGTGGGGGGTGGGGGAGG - Intergenic
1171035572 20:21710068-21710090 GTTGTGGGTGGTGGTGGTGGTGG + Intronic
1171165645 20:22967798-22967820 TGTTCTGGTGGAGGTGGTGGAGG - Intergenic
1171171134 20:23016312-23016334 TTGGTGGGGGTAGGTGGAGGGGG - Intergenic
1171416004 20:24980862-24980884 CTGGCGTGTAGAGGTGATGGAGG - Intronic
1171567608 20:26209103-26209125 GAGGCGGGTGGACGGGGTGGGGG - Intergenic
1171906865 20:30906416-30906438 TCGCCGGGTGGAGGGTGTGGTGG - Intergenic
1171973808 20:31581302-31581324 TTTTTGGGTGGTGGTGGTGGTGG + Intergenic
1172110419 20:32541488-32541510 TTGGATGGTGGTGGGGGTGGCGG + Intronic
1172194558 20:33083213-33083235 TTGCTGGGTGGCAGTGGTGGGGG + Intronic
1172240829 20:33411487-33411509 GTGGCTGGGGGAGGTGGAGGTGG - Intronic
1172277762 20:33689470-33689492 TTGGTTGGTGAAGGTGGTGATGG - Intergenic
1172287775 20:33753268-33753290 CTCTGGGGTGGAGGTGGTGGAGG - Exonic
1172699365 20:36843432-36843454 TATGAGGGTGGAGGTGGGGGTGG - Intronic
1172718812 20:36983818-36983840 TTGGCCTGTGGAGGAGGGGGAGG - Intergenic
1172891242 20:38266993-38267015 GTGGGGGGTGGGGGTGGGGGGGG + Intronic
1173299779 20:41791868-41791890 CTGGCTGGTGGAGGAGGAGGAGG + Intergenic
1173416464 20:42861004-42861026 TTGGTGGGTGAAAGTGGTGATGG - Intronic
1173467671 20:43296154-43296176 GAGGCGGGGGGTGGTGGTGGGGG - Intergenic
1173547853 20:43913399-43913421 TAGGGGGGTGGTGGTGGTGGTGG + Intergenic
1173565058 20:44032558-44032580 GTGCCAGGTGGTGGTGGTGGTGG + Intronic
1173985553 20:47259003-47259025 TTGGTGGGTGGGCATGGTGGTGG - Intronic
1174231925 20:49052612-49052634 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
1174392165 20:50224372-50224394 GTCGCAGGTGGGGGTGGTGGGGG + Intergenic
1174671701 20:52314003-52314025 GGCGGGGGTGGAGGTGGTGGGGG + Intergenic
1174980695 20:55391372-55391394 TTGGTGGGTGGGGTTGGGGGAGG - Intergenic
1175127753 20:56764964-56764986 TGGGTGGGGGGCGGTGGTGGTGG + Intergenic
1175147049 20:56904841-56904863 TTGGTGGCTGGTGGGGGTGGAGG + Intergenic
1175147052 20:56904844-56904866 GTGGCTGGTGGGGGTGGAGGGGG + Intergenic
1175251065 20:57610508-57610530 GTGGCGGGTGGAGGTGTGGCGGG - Intronic
1175263747 20:57690315-57690337 AGGGCGGGTGGCAGTGGTGGGGG - Intronic
1175337691 20:58206859-58206881 TTGGCTTTTGGTGGTGGTGGTGG - Intergenic
1175503211 20:59464799-59464821 TTGGAGGGAGGACCTGGTGGGGG + Intergenic
1175658889 20:60795151-60795173 TGGCCGGGTGGAGGTGGGTGGGG + Intergenic
1175715961 20:61253978-61254000 CAGGCAGGAGGAGGTGGTGGAGG - Intronic
1175761577 20:61565217-61565239 GTGGTAGGTGGTGGTGGTGGTGG + Intronic
1175908228 20:62392213-62392235 TTGGCGGGCGGTGGAGGTGGGGG + Intronic
1175942948 20:62546289-62546311 GTGGCGGGTGCAGGAGGAGGAGG + Intergenic
1175990308 20:62785372-62785394 TGGGCGGGTGGAGGTGGGTGAGG + Intergenic
1176005372 20:62859793-62859815 CTGGGAGGTGGAGGTTGTGGTGG - Intronic
1176198391 20:63848276-63848298 GTGGGGGCTGGAGGTGTTGGCGG + Intergenic
1176232410 20:64039056-64039078 GTGGCGGGGGGCGGTGGAGGGGG + Intronic
1176233076 20:64041864-64041886 GGGGCCGGTGGCGGTGGTGGGGG - Intronic
1176844200 21:13864314-13864336 GTGGGGGGTGGGGGTGGTAGGGG - Intergenic
1177140568 21:17353370-17353392 TGCTCTGGTGGAGGTGGTGGGGG - Intergenic
1177176519 21:17705360-17705382 TGCTCTGGTGGAGGTGGTGGGGG - Intergenic
1177240091 21:18444480-18444502 TTGGGGGATGGGGGTGCTGGGGG + Intronic
1177408555 21:20701373-20701395 TTCGGTGGTGGTGGTGGTGGTGG - Intergenic
1177469953 21:21548030-21548052 TTTGGTGGTGGTGGTGGTGGTGG + Intergenic
1177499884 21:21940157-21940179 GTAGTGGGTGGTGGTGGTGGTGG + Intergenic
1177499885 21:21940160-21940182 GTGGGTGGTGGTGGTGGTGGTGG + Intergenic
1177636567 21:23795089-23795111 TTGGGGGGTGGGGGTGGGGGAGG - Intergenic
1177995305 21:28089686-28089708 TCTTCTGGTGGAGGTGGTGGAGG + Intergenic
1178105450 21:29313880-29313902 TTGGTTGGGGGGGGTGGTGGTGG + Intronic
1178299256 21:31438264-31438286 CTGGGAGGTGGAGGTTGTGGTGG - Intronic
1178299901 21:31443616-31443638 GTGGTGGGTGGTGGTGGTTGTGG - Intronic
1178340837 21:31784645-31784667 GTGGTTGGTGGTGGTGGTGGTGG - Intergenic
1178340838 21:31784648-31784670 GTGGTGGTTGGTGGTGGTGGTGG - Intergenic
1178484429 21:33009048-33009070 TCGGGGGAGGGAGGTGGTGGGGG - Intergenic
1178494487 21:33075433-33075455 TGGGGGGGTGGGGGTGGGGGGGG + Intergenic
1178771027 21:35504215-35504237 TTGGCGGCTGAGGGTGGAGGTGG - Intronic
1178892987 21:36535313-36535335 CTGGGAGGTGGAGGTTGTGGTGG + Intronic
1179125624 21:38588317-38588339 TTGGAGGGTGGTGGTGGTGGTGG - Intronic
1179139617 21:38713073-38713095 TTGGTGGGGGGAGGGGGGGGCGG + Intergenic
1179217910 21:39383098-39383120 TTAGCCGGTTGTGGTGGTGGTGG - Intronic
1179260980 21:39757963-39757985 GCGGGGGGTGGAGGTGGCGGTGG + Intronic
1179380479 21:40894688-40894710 TTGGCTGGTGGGAGTGGTGGAGG - Intergenic
1179532656 21:42030723-42030745 GTGGAGGGTGGATGTGGGGGTGG - Intergenic
1179535066 21:42046101-42046123 TGGGCGAGGGGAGGTGGGGGGGG + Intergenic
1179622202 21:42624528-42624550 TGGTTGGGTGGAGGTGGGGGAGG - Intergenic
1179649757 21:42800399-42800421 TTTGGTGGTGGTGGTGGTGGTGG + Intergenic
1179951344 21:44710417-44710439 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1180491644 22:15854130-15854152 GTGGCAGGGGGAGGTGGAGGCGG + Intergenic
1180641605 22:17303737-17303759 TTAGTGGGTGGAGGTGATGAGGG + Intergenic
1181007384 22:20020507-20020529 CTGGGGGGTGGAAGTGGGGGAGG + Intronic
1181052982 22:20246439-20246461 GTGGCGGGGGGAGGAGGAGGTGG + Intronic
1181155767 22:20918964-20918986 TTGGCGGGGAGGGGTGGGGGTGG - Intronic
1181161826 22:20964252-20964274 TAGGAGGGTGGTGGTGGTGGGGG + Intergenic
1181359538 22:22323783-22323805 ATGGTGGAGGGAGGTGGTGGAGG + Intergenic
1181369618 22:22405527-22405549 ATGGTGGAGGGAGGTGGTGGAGG + Intergenic
1181439219 22:22927232-22927254 TTGGCGGGGGGTGGGGGTGGGGG - Intergenic
1181528142 22:23501832-23501854 GTGGCGGGTGGTGGAGGCGGTGG - Intergenic
1181528156 22:23501874-23501896 GTGGCGGGTGGCAGAGGTGGTGG - Intergenic
1181528164 22:23501897-23501919 ATGGCGGGTGGTGGAGGTGGCGG - Intergenic
1181528183 22:23501952-23501974 ATGGTGGGTGGTGGAGGTGGCGG - Intergenic
1181553204 22:23652693-23652715 TTGGGGGGTGGAGGGGCTAGAGG + Intergenic
1181917274 22:26291437-26291459 TTGCGGGGTGGAGTTGGGGGAGG + Intronic
1181988249 22:26816692-26816714 TTGGCGGGGGGAGTGGGGGGTGG + Intergenic
1182384048 22:29920970-29920992 TTAGGGGGTGGTGGGGGTGGCGG + Intronic
1182390418 22:29989987-29990009 TTGGCAGGCCGAGGTGGGGGTGG + Intronic
1182437285 22:30338838-30338860 TTGGTGGCTGAAGATGGTGGCGG + Exonic
1182470362 22:30544479-30544501 TTGAGGGGTGGTGGTGGTGGTGG - Intronic
1182856541 22:33522449-33522471 GTGGGAGGTGGAGGTGGAGGCGG + Intronic
1182897655 22:33872508-33872530 TGGGGGGGTGGCGGTGTTGGTGG - Intronic
1183144391 22:35976322-35976344 GGGGGGGGTGGTGGTGGTGGTGG - Intronic
1183196940 22:36360057-36360079 TTAGGTGGTGGTGGTGGTGGTGG - Intronic
1183343266 22:37293758-37293780 TTGGCAGGGGGAGGTGTTAGGGG + Intronic
1183348954 22:37324104-37324126 TTGAGGGGTGGTGGGGGTGGGGG + Intergenic
1183388783 22:37531294-37531316 TTAGCTGGTGGTGGTGGTGGTGG + Intergenic
1183521384 22:38297940-38297962 TAGGCCGGTGGAGGAGGTGGAGG - Intronic
1183720160 22:39557848-39557870 ATGGCGGGAGGAGGAGGAGGCGG - Intergenic
1183829289 22:40409391-40409413 TTGGGGGATGGAGGTGGGGTGGG + Intronic
1183990516 22:41594378-41594400 TGGGGGGGTGGGGGTGGGGGCGG + Intergenic
1184097386 22:42323892-42323914 TATGGTGGTGGAGGTGGTGGTGG + Intronic
1184097411 22:42323985-42324007 TATGGTGGTGGAGGTGGTGGCGG + Intronic
1184176982 22:42794148-42794170 TAGGCGTGGGGAGTTGGTGGGGG + Intergenic
1184274165 22:43400664-43400686 GCGGCGGGTGGTGGCGGTGGTGG + Intergenic
1184291253 22:43499169-43499191 GTGGGAGGTGGAGATGGTGGTGG + Intronic
1184291351 22:43499541-43499563 ATGGTGGGTGGTGGTGGAGGTGG + Intronic
1184353444 22:43960926-43960948 TGTGCGGGTGGAGCGGGTGGTGG + Intronic
1184557413 22:45240847-45240869 TTGGCGGGTGGTGGCGGCGGCGG - Intergenic
1184729740 22:46365886-46365908 TGGGTGGGGGAAGGTGGTGGGGG + Intronic
1184729754 22:46365916-46365938 TGGGTGGGGGAAGGTGGTGGGGG + Intronic
1185171726 22:49298221-49298243 TGGGCGGGTGGAGGCTGCGGCGG + Intergenic
1185285292 22:49997270-49997292 TGGGGAGGTGGGGGTGGTGGCGG - Intronic
1185415315 22:50706150-50706172 TTGGTGAGTGGCGGGGGTGGCGG + Intergenic
949158210 3:851792-851814 TCTGGGGGTGGTGGTGGTGGTGG + Intergenic
949794795 3:7836714-7836736 TTGGCTGTTGGGGGAGGTGGAGG - Intergenic
950210090 3:11116875-11116897 GTGGGAGATGGAGGTGGTGGTGG - Intergenic
950316493 3:12005379-12005401 TTGGAGGGAGAAGGTGGTGGTGG + Intronic
950469335 3:13174836-13174858 GTGGTGGGAGGAGGTGGGGGGGG - Intergenic
950513650 3:13449328-13449350 TTGGGAGGTGGAGGCGGAGGCGG - Intergenic
950728225 3:14933388-14933410 GTGGCGGGTGGGGGTAGGGGTGG - Exonic
950777776 3:15365267-15365289 TTGCCAGGTGGAGGTTGTTGAGG - Intergenic
950785792 3:15434418-15434440 ATAGGTGGTGGAGGTGGTGGTGG - Exonic
950812907 3:15666749-15666771 ATGGTTGGTGGAGTTGGTGGAGG - Intergenic
950941675 3:16898920-16898942 TTGGAGGGTGGAGGGGGAGGGGG + Intronic
951269666 3:20608607-20608629 TGTTCTGGTGGAGGTGGTGGGGG - Intergenic
951507011 3:23458387-23458409 ATCGCTGGTGGTGGTGGTGGTGG + Intronic
952314163 3:32218264-32218286 GTGGGTGGTGGTGGTGGTGGTGG - Intergenic
952427745 3:33192740-33192762 TTAGAAGGTGGAGGTTGTGGTGG + Intronic
952445279 3:33375500-33375522 TTGCCAGGTAGTGGTGGTGGAGG + Intronic
952670235 3:35958165-35958187 TTGTGGGGTGGGGGTGGGGGAGG - Intergenic
952706579 3:36383455-36383477 GTGTAGGGTGGTGGTGGTGGTGG - Intronic
952816309 3:37451049-37451071 TAGGCAGGAGTAGGTGGTGGGGG + Intergenic
953002664 3:38950064-38950086 TGGGCGGGGGGGGGGGGTGGGGG - Intronic
953053329 3:39366231-39366253 TTGGGGGTGGGAGGTGGGGGAGG + Intergenic
953723906 3:45381278-45381300 TGTTCTGGTGGAGGTGGTGGGGG + Intergenic
953800006 3:46015724-46015746 TTGGGGGGCGGGGGTGGGGGAGG - Intergenic
953941968 3:47107716-47107738 GTGGCGGGGGGGGGTGGGGGGGG + Intronic
953943458 3:47124043-47124065 TGGGCAGGTGGAGGCGGTGGAGG + Exonic
954333235 3:49901916-49901938 TTTGTGCGTGGTGGTGGTGGTGG + Intronic
954370356 3:50166840-50166862 TGGGGAGGAGGAGGTGGTGGAGG + Intronic
954661239 3:52227988-52228010 TTGACAGGGGTAGGTGGTGGGGG + Intergenic
954822060 3:53338433-53338455 TTGTGGGGTAGTGGTGGTGGTGG - Intronic
954965074 3:54603253-54603275 TTAGGAGGAGGAGGTGGTGGGGG - Intronic
955060695 3:55489427-55489449 TGTGGGGGTGGAGGTGGGGGAGG - Intronic
955175580 3:56610955-56610977 TGTTCTGGTGGAGGTGGTGGAGG + Intronic
956149931 3:66230452-66230474 TAGGGGGGTGGAGGCGATGGTGG + Intronic
956160799 3:66350232-66350254 TAAGGGGCTGGAGGTGGTGGTGG + Intronic
956499499 3:69866541-69866563 TTTGGGGGTGGGGGTGGGGGTGG + Intronic
956615666 3:71169601-71169623 TTTGCGGGGGGCGGTGGGGGAGG - Intronic
956814395 3:72894741-72894763 TTGCCAGGTGGAGGTTGTTGAGG + Intronic
957236748 3:77602710-77602732 CTGGTGTGTGGTGGTGGTGGAGG - Intronic
958691866 3:97479936-97479958 TTTGGAGGTGGAGGTGGAGGTGG - Intronic
958734069 3:97989260-97989282 TTGGGTGGTGGGGATGGTGGTGG + Intronic
958734115 3:97989446-97989468 GTGGTGGGTGGTGGTGGTGGTGG + Intronic
959189822 3:103097244-103097266 TGAGCTGGTGGTGGTGGTGGTGG - Intergenic
959539747 3:107524822-107524844 AAGGTGGGTGGAGGTTGTGGGGG + Intronic
959564528 3:107820776-107820798 TTGGTGGGGGGAGGTGGGAGAGG + Intergenic
960285353 3:115822433-115822455 TTGGGAGATGGAGGTTGTGGTGG - Intronic
960574736 3:119218506-119218528 TTGAAGGGTGCAGGGGGTGGAGG - Intronic
961055648 3:123786513-123786535 TGGGAGGGTGGGGGTGGGGGAGG + Intronic
961087608 3:124082444-124082466 TTTGGGGGGTGAGGTGGTGGTGG + Intronic
961229447 3:125290032-125290054 GTGGTGGATGGTGGTGGTGGTGG - Intronic
961466687 3:127086015-127086037 GTGGGGGGTGGCGGTGGTTGGGG - Intergenic
961495270 3:127286990-127287012 TGGGTGAGTGGTGGTGGTGGTGG + Intergenic
961517480 3:127446975-127446997 TTGGTGGGTGTGGGTGGTGAGGG - Intergenic
961550452 3:127667967-127667989 TGGGCGGGTGGGAGTGGTGATGG - Intronic
961622612 3:128236412-128236434 ATGGCGGGGGGCGGGGGTGGCGG + Intronic
961660675 3:128467298-128467320 ATGGTGGGTGGAGATGGAGGTGG + Intergenic
961695371 3:128700591-128700613 TTTGTTGGTGGTGGTGGTGGTGG + Intergenic
961855906 3:129870714-129870736 TTGGCGGGGGGGGGGGGGGGGGG + Intronic
962092690 3:132261882-132261904 TTCCCTGGTGGTGGTGGTGGTGG - Intronic
962103356 3:132365737-132365759 TTGGGAGGTGCAGGTGGTGGTGG + Intronic
962212404 3:133490451-133490473 TTGACTGGTGGGGGAGGTGGAGG + Intergenic
962409560 3:135129199-135129221 ATGGGGGGTGGGGGTGGGGGAGG + Intronic
962517718 3:136169227-136169249 TTGGCGGGGGGGGGGGGGGGGGG + Intronic
962605990 3:137033311-137033333 TTGGCAGTTGGGGGTGGTGCTGG + Intergenic
962640373 3:137379272-137379294 TTGGCGGGTGGGGGGGTGGGAGG + Intergenic
962865979 3:139448277-139448299 TTGGAGGGTGGCAGTGGTTGAGG + Intergenic
963350738 3:144148226-144148248 TTGGCGGGTGGAGGTGGTACTGG + Intergenic
963411377 3:144931818-144931840 TGGGCCTGTGGTGGTGGTGGTGG + Intergenic
963555244 3:146779256-146779278 TTGGAGGGTGGAGGTTGTAGTGG - Intergenic
963556530 3:146796000-146796022 GTGGCGGGGGGTGGTGGGGGAGG + Intergenic
963584969 3:147175628-147175650 TTGAGGGGTGGTTGTGGTGGTGG + Intergenic
963606329 3:147414037-147414059 TGGGCGGGGGGAGGGGGAGGGGG + Exonic
963784912 3:149524534-149524556 GTGGCAGGGGGTGGTGGTGGGGG + Intronic
963854675 3:150241263-150241285 TTGGTGGGGGGTGGGGGTGGGGG + Intergenic
963890146 3:150626114-150626136 TTGGGAGGCGGAGGTGGAGGCGG - Intronic
964749314 3:160039864-160039886 TGGGGGGGTGGGGGTGGAGGTGG - Intergenic
965165253 3:165188681-165188703 GAGGATGGTGGAGGTGGTGGTGG - Exonic
965630420 3:170726962-170726984 CTGGCTTGTGGTGGTGGTGGAGG + Intronic
965770817 3:172179559-172179581 GTGGAGGTCGGAGGTGGTGGGGG - Intronic
965896007 3:173576788-173576810 GTGGCGGGGGAGGGTGGTGGAGG + Intronic
966212682 3:177469406-177469428 TTTGAGGCTGGTGGTGGTGGGGG + Intergenic
966738866 3:183212948-183212970 TGGGGGGGTGGGGGGGGTGGGGG + Intronic
966943962 3:184764596-184764618 CTTGAGGGTGGTGGTGGTGGTGG - Intergenic
967056852 3:185836704-185836726 TGGGGGGGGGGCGGTGGTGGTGG - Intergenic
967128151 3:186445219-186445241 TTGGTGGGGGATGGTGGTGGGGG - Intergenic
967158842 3:186717898-186717920 GTGGATGGTGGTGGTGGTGGTGG - Intronic
967158843 3:186717901-186717923 GTGGTGGATGGTGGTGGTGGTGG - Intronic
967158926 3:186718143-186718165 GTGGTGGGTGGCGGTGGTGGTGG - Intronic
967158939 3:186718179-186718201 GTGGTGGATGGTGGTGGTGGTGG - Intronic
967158986 3:186718307-186718329 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
967158999 3:186718340-186718362 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
967159018 3:186718392-186718414 GTGGTGGGTGGCGGTGGTGGTGG - Intronic
967191458 3:186988559-186988581 TTGGGGTGGGGGGGTGGTGGTGG + Intronic
967191462 3:186988565-186988587 TGGGGGGGTGGTGGTGGGGGCGG + Intronic
967269618 3:187722311-187722333 CTGGGGGTTGGGGGTGGTGGGGG - Exonic
967762328 3:193240580-193240602 TTGGCGCGTGGGGGCGGAGGGGG + Intergenic
967772852 3:193353865-193353887 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
967870306 3:194224064-194224086 TTGAAGGGTGCTGGTGGTGGAGG - Intergenic
968221278 3:196942135-196942157 TTGAGCGGTGGTGGTGGTGGCGG - Intronic
968286479 3:197511982-197512004 GTAGCGGGTGTAGGGGGTGGTGG + Exonic
968518356 4:1024154-1024176 CTGGCGGGCGGGGGTGCTGGTGG + Intronic
968624472 4:1620702-1620724 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
968736822 4:2301661-2301683 TTTGCTGCTGGGGGTGGTGGGGG - Intronic
968807942 4:2787359-2787381 CTGGCAGGGGGTGGTGGTGGGGG + Intergenic
969279537 4:6160868-6160890 TAGGCGAGTGGAGGTCGGGGAGG - Intronic
969394871 4:6913988-6914010 TAGCTGGGTGGACGTGGTGGCGG + Intronic
969479788 4:7441728-7441750 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479801 4:7441757-7441779 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479814 4:7441786-7441808 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479827 4:7441815-7441837 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479840 4:7441844-7441866 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479853 4:7441873-7441895 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479866 4:7441902-7441924 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479879 4:7441931-7441953 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479892 4:7441960-7441982 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479947 4:7442105-7442127 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969479960 4:7442134-7442156 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969480002 4:7442250-7442272 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969480067 4:7442424-7442446 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969480092 4:7442482-7442504 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969480105 4:7442511-7442533 TGGGCTGGGGGAGGGGGTGGAGG - Intronic
969599961 4:8170507-8170529 GTGGCTGGTGGAGGAGATGGTGG + Intergenic
969658354 4:8510727-8510749 TAGCAGGGTGGAGCTGGTGGGGG + Intergenic
969755604 4:9148130-9148152 ATGGCAGGTGGCGGTGGGGGGGG - Intergenic
969879118 4:10158264-10158286 CTGGTGGGTGGGGGTGGGGGTGG - Intergenic
969967439 4:11011757-11011779 TTGGGGGGAGGAGCTGGGGGAGG - Intergenic
969998441 4:11339264-11339286 TTTGTGGGTGAAGGTGGGGGTGG - Intergenic
970029931 4:11662944-11662966 GCGGGGGGTGGGGGTGGTGGGGG + Intergenic
971078470 4:23178654-23178676 TTTGGGGGGGGGGGTGGTGGGGG - Intergenic
971237463 4:24855489-24855511 TGGGATGGTGGAGATGGTGGAGG + Intronic
973045164 4:45527910-45527932 ATGGGAGGTGGAGGTTGTGGAGG + Intergenic
973104827 4:46322438-46322460 TGGGTGTGTGGATGTGGTGGGGG - Intronic
973257071 4:48124280-48124302 TTGGAAGGTGGTGGTGGTGTGGG - Intronic
974055577 4:56979440-56979462 TCGGGGGGTGGGGGTGGCGGGGG + Intronic
974271580 4:59656881-59656903 TTTGTTGGTGGTGGTGGTGGTGG - Intergenic
974480968 4:62442437-62442459 TGGGGGAGTGGTGGTGGTGGTGG + Intergenic
974858994 4:67496885-67496907 TTTGGGGGTGGGGGTGGGGGTGG - Intronic
974957723 4:68663757-68663779 TTGGGGGGTGGGGGTGTCGGGGG - Intronic
975558358 4:75686560-75686582 GTGGCGGGGGGTGGGGGTGGGGG + Intronic
976002487 4:80388142-80388164 CTGTGGGGTGGAGGTGGTGAGGG + Intronic
976763647 4:88576651-88576673 TTGGGGTGGGGAGGTGGTAGTGG + Intronic
977125032 4:93154779-93154801 TTTGTTGGTGGTGGTGGTGGTGG - Intronic
977393035 4:96437449-96437471 TAGGGGGTTGGAGGTGGCGGGGG + Intergenic
977934387 4:102784756-102784778 GTGGGGGGAGGAGGTGGAGGAGG - Intergenic
978325332 4:107547488-107547510 TCGGGGGGTGGGGGTGGGGGAGG - Intergenic
979284337 4:118904625-118904647 TGTGGGGGTGGAGGTGGGGGAGG - Intronic
979563312 4:122124594-122124616 ATGGAGGGTGGAGGGGGTTGGGG - Intergenic
979839411 4:125419685-125419707 GTGGCAGCTGGTGGTGGTGGAGG - Intronic
980071974 4:128253213-128253235 TTGTTGGGTGATGGTGGTGGTGG - Intergenic
981034140 4:140152803-140152825 GTTGGGGGTGGTGGTGGTGGTGG - Intronic
981243059 4:142501920-142501942 CTCACGGGTGGAGGTGGAGGGGG - Intronic
981550666 4:145937968-145937990 TTGGTGGGGGGAGGTGGGAGAGG - Intronic
981745643 4:148049850-148049872 GGGGCGGGGGGTGGTGGTGGCGG + Intronic
981768366 4:148278180-148278202 CTGGGAGGTGGAGGTGGAGGTGG - Intronic
981847962 4:149191367-149191389 TTTTGGGGTGGGGGTGGTGGGGG - Intergenic
981898626 4:149835401-149835423 GAGGCGGGTGGAGTGGGTGGAGG - Intergenic
981929635 4:150175605-150175627 TCAACCGGTGGAGGTGGTGGAGG + Intronic
982077186 4:151749507-151749529 TTGTGGGGTGGGGGTGGGGGAGG + Intronic
982123612 4:152165248-152165270 CTGGGGGCTGGTGGTGGTGGTGG - Intergenic
982717732 4:158826607-158826629 TTGGGTGGTAGTGGTGGTGGTGG + Intronic
982761201 4:159286062-159286084 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
983014508 4:162595059-162595081 TTTGGGGGTGGTGGTGGTGAGGG - Intergenic
983058609 4:163129039-163129061 TTTACAGGTGGGGGTGGTGGTGG + Exonic
984625350 4:182001080-182001102 TTGGTGGGTGGTGGTGGTGAAGG - Intergenic
984668011 4:182448860-182448882 CTGGCGGGAGGCGGCGGTGGCGG + Intronic
984704163 4:182835572-182835594 GTGGCTGGTGCAGGTGGTAGTGG - Intergenic
985011494 4:185587495-185587517 GTGGCAGGTGGAGATGGTGACGG + Exonic
985114329 4:186576108-186576130 AAGGGGGGTGGGGGTGGTGGCGG + Intergenic
985452966 4:190070929-190070951 GTGGGGGGGGGGGGTGGTGGGGG - Intergenic
985453955 4:190074222-190074244 GTGGGGGGGGGGGGTGGTGGGGG - Intergenic
985454943 4:190077515-190077537 GTGGGGGGGGGGGGTGGTGGGGG - Intergenic
985456914 4:190084106-190084128 GTGGGGGGGGGGGGTGGTGGGGG - Intergenic
985457902 4:190087402-190087424 GTGGGGGGGGGGGGTGGTGGGGG - Intergenic
985458890 4:190090699-190090721 GTGGGGGGGGGGGGTGGTGGGGG - Intergenic
985636515 5:1038349-1038371 AGGACGGGTGGAAGTGGTGGTGG - Exonic
985669437 5:1200104-1200126 GTGCAGGGTGGAGGTGGGGGCGG + Intergenic
985936837 5:3103726-3103748 GGGGCTGGGGGAGGTGGTGGCGG - Intergenic
986185103 5:5428191-5428213 TTGGTGGGTGGGTGTGGTTGGGG + Intronic
986301614 5:6482358-6482380 CTGGGGGGTGGAGGTGGGCGAGG - Intronic
986560196 5:9053188-9053210 TGGGATGGTGGTGGTGGTGGAGG + Intronic
986728225 5:10615882-10615904 TGGGAGAATGGAGGTGGTGGTGG + Intronic
986863200 5:11952290-11952312 TTGGCGGAGGGACCTGGTGGGGG - Intergenic
987045960 5:14108611-14108633 GTGGCGGATGGTGGTGGGGGCGG - Intergenic
987113353 5:14707645-14707667 TTGGGAGGTGCAGGGGGTGGGGG - Exonic
987152666 5:15057625-15057647 TTGGCTGGGGGATGAGGTGGTGG + Intergenic
987310050 5:16673216-16673238 TTGGGGGGTGGGGGTCGGGGTGG + Intronic
987873591 5:23650527-23650549 TGGGGGGGTGGTGGGGGTGGTGG - Intergenic
988562850 5:32296556-32296578 TTGGAAGGGTGAGGTGGTGGGGG + Intronic
988613481 5:32750621-32750643 TTGTGGGGTGGAGGTGGGGTGGG + Intronic
988809150 5:34767604-34767626 GTGGGGGGTGGTGGGGGTGGTGG - Intronic
988988119 5:36640842-36640864 GTGGTGGGTGTAGGTGGGGGTGG - Intronic
990141257 5:52706898-52706920 TTGCCAGGTGGAGGTTGTTGGGG - Intergenic
990223264 5:53619338-53619360 GTGGCGGGTGCTTGTGGTGGCGG + Intronic
990365513 5:55066500-55066522 TAGGTGGGTGGATGTGGTGGAGG - Intergenic
990588468 5:57237011-57237033 TTTGAGGGTGGGGGTGGGGGTGG + Intronic
990680831 5:58242489-58242511 TAGGGGGGTTGAGGGGGTGGGGG + Intergenic
990870530 5:60426527-60426549 TTGGGGGGTGTGGGGGGTGGGGG + Intronic
991145595 5:63299365-63299387 TTGACAAGTGGAGGTGGAGGAGG - Intergenic
991402810 5:66272163-66272185 GTGGGGGGTGCAGGTGATGGGGG - Intergenic
991585921 5:68201795-68201817 TTGGCGAATGGAGGTGGTGATGG + Intergenic
991633085 5:68676466-68676488 TTGGTGGCTGTAGGTGCTGGGGG + Intergenic
991946619 5:71904014-71904036 TTGACAGGTGGAGATGGAGGTGG + Intergenic
991972396 5:72153596-72153618 GTGGCGTGTGGTGGTGGTGGTGG + Intronic
992062950 5:73074893-73074915 GTGTTGGGTGGAGGAGGTGGTGG + Intronic
992098001 5:73380597-73380619 CTGGGGGGTGGAGGAGGTGGGGG - Intergenic
992430172 5:76703002-76703024 TTTGTGGGGGGAGGGGGTGGGGG + Intronic
992430204 5:76703143-76703165 TTTGTGGGGGGAGGGGGTGGGGG + Intronic
992621858 5:78601755-78601777 TTGGAGGGTGGAGAGGCTGGGGG + Intronic
992726448 5:79612361-79612383 TTGGGGGGTGGGGGGGGTTGGGG + Intronic
993266826 5:85737285-85737307 TTGGTGGGGGGAGGTGGGGATGG - Intergenic
993440851 5:87955151-87955173 TTGGTGGGTGGGGGGGCTGGCGG + Intergenic
993770550 5:91919291-91919313 TGGGGGGGTGGAGATGGTGTGGG + Intergenic
993892608 5:93491368-93491390 TGGGGGGGTGGTGGTGCTGGTGG + Intergenic
994077240 5:95667315-95667337 TGGGGGGGTGGGGGTGCTGGGGG + Intronic
994092910 5:95824420-95824442 ATGGGGAGTGGTGGTGGTGGTGG - Intergenic
994796485 5:104307146-104307168 TGGGCAGGGCGAGGTGGTGGGGG + Intergenic
994974522 5:106784648-106784670 TTGGAGGGTGGAAGTGGGGATGG + Intergenic
995067376 5:107877400-107877422 ACGGCGGGTGGGGGTCGTGGGGG + Intronic
995908740 5:117159616-117159638 TTGGTGGATGGAGTGGGTGGTGG + Intergenic
995988012 5:118203565-118203587 CTTGTGGGTGGAGGGGGTGGTGG - Intergenic
996045555 5:118869114-118869136 ATGGATGGTGGTGGTGGTGGTGG + Intronic
996120485 5:119666316-119666338 TTGTCAGGTGGAGGTAGTTGAGG - Intergenic
996353288 5:122569574-122569596 TTGGAGGTGGTAGGTGGTGGGGG + Intergenic
996542499 5:124645499-124645521 TGTGTGGGTGGCGGTGGTGGGGG + Intronic
996729253 5:126701475-126701497 CAGGCTGGTGGTGGTGGTGGTGG + Intergenic
996871154 5:128194614-128194636 TTGGAGAGTGGTGGTGGTGGTGG - Intergenic
997046256 5:130321656-130321678 CTTGAGGGTGGAGGTGGAGGAGG + Intergenic
997702587 5:135913615-135913637 TTGGGAGGTGGAGGTGGAGGTGG - Intergenic
998149440 5:139748475-139748497 TTTGGGGGTGGTAGTGGTGGTGG - Intergenic
998429141 5:142055269-142055291 TTGGGGGGTGGAGTGGGGGGGGG + Intergenic
998759365 5:145415424-145415446 TTGTGGGGTGGGGGTGGGGGAGG - Intergenic
998843992 5:146287127-146287149 GTGGGGGGTGGAGGTGGGAGGGG + Exonic
999159260 5:149481861-149481883 TTGGGGTGTGCAGGTGGGGGCGG - Intergenic
999393530 5:151212000-151212022 TGCGTGGGTGGTGGTGGTGGGGG + Intronic
999411047 5:151350122-151350144 GGGGAGGGTGGTGGTGGTGGTGG - Intergenic
999480112 5:151940533-151940555 TTGGCAGGAGGAGGTGTGGGGGG + Intergenic
999989141 5:157033579-157033601 GGGGCGGGTGGGGGTGGTGGGGG + Intronic
1000354772 5:160383939-160383961 TAGGGTGGTGGTGGTGGTGGTGG + Intergenic
1000438115 5:161238491-161238513 TGGATGGGGGGAGGTGGTGGAGG + Intergenic
1000448802 5:161358670-161358692 TAGGTGGGTAGAGGTAGTGGTGG + Intronic
1000507237 5:162136469-162136491 GTGTGGGGTGGTGGTGGTGGTGG + Intronic
1000507238 5:162136472-162136494 TGGGGTGGTGGTGGTGGTGGTGG + Intronic
1001026246 5:168226573-168226595 TTGGTGGGGAGAGGTGGTGATGG - Intronic
1001072985 5:168603054-168603076 TTCTGGGGTGGGGGTGGTGGAGG + Intergenic
1001122404 5:168991544-168991566 TTTGCTGCTGGGGGTGGTGGGGG - Intronic
1001270058 5:170304294-170304316 ATGGGAGGTGGGGGTGGTGGAGG + Intergenic
1001342750 5:170862285-170862307 GCGGCGGGTGGAGGGGGCGGGGG + Intronic
1001733064 5:173974201-173974223 GAGGCTGGTGGTGGTGGTGGTGG + Intronic
1002048181 5:176553729-176553751 TTGGGGGAGGGAGATGGTGGTGG - Intronic
1002140075 5:177133034-177133056 TTGGTCTGTGGTGGTGGTGGTGG + Intronic
1002186984 5:177459100-177459122 TGGGCTGGTGGGGGTGGCGGTGG + Exonic
1002190248 5:177473910-177473932 TGGGCGGGGGGAGGTGGGGACGG - Intronic
1002400248 5:178987632-178987654 ATGGCGGTTGCAGGTGCTGGCGG + Intronic
1002562358 5:180090909-180090931 TTGGGAGGCGGAGGTGGGGGGGG - Intergenic
1003034748 6:2632942-2632964 TGGGAGGGTGGAGGGCGTGGAGG - Intronic
1003165054 6:3670315-3670337 TTGGGGTGGGGAGGGGGTGGGGG + Intergenic
1003269064 6:4591420-4591442 TTGCTGGGTTGAGGTGCTGGTGG - Intergenic
1003493999 6:6648161-6648183 GTGAAGGGTGGTGGTGGTGGAGG - Intronic
1003516163 6:6820869-6820891 ATGGGGTGAGGAGGTGGTGGTGG + Intergenic
1003556774 6:7146778-7146800 TGGTGGGGAGGAGGTGGTGGGGG + Intronic
1003816037 6:9841013-9841035 ATGGCAGGGGGAGGGGGTGGTGG + Intronic
1003838362 6:10094742-10094764 TTGGAGGAGGGAGATGGTGGGGG - Intronic
1004013841 6:11714384-11714406 CTGGTGGAGGGAGGTGGTGGAGG - Exonic
1004100207 6:12601964-12601986 TTGGTGGGGGAAGGCGGTGGGGG - Intergenic
1004185183 6:13415420-13415442 AAGGTGGGTGGAGGAGGTGGGGG - Intronic
1004249681 6:14013380-14013402 AAGGCAGGTGGTGGTGGTGGTGG + Intergenic
1004611373 6:17243356-17243378 ATGGGTGGTGGAGGTGGTGGTGG + Intergenic
1004626482 6:17381829-17381851 TTGGAGGGTGGAGGTGGGGATGG + Intergenic
1004818268 6:19336137-19336159 TTGAAGGGTGGTGGTGGTAGTGG + Intergenic
1005147454 6:22707662-22707684 TTAGGGGTTGGGGGTGGTGGTGG - Intergenic
1005715656 6:28544580-28544602 TTGGAGGGGGGAGTTGGAGGGGG + Intergenic
1005863679 6:29922053-29922075 TTGGGGGAGGGCGGTGGTGGGGG + Intergenic
1006051455 6:31348066-31348088 TGGACTAGTGGAGGTGGTGGAGG - Intronic
1006164057 6:32054178-32054200 TTGGGGACTGGAGGTGGGGGAGG - Intronic
1006288546 6:33116655-33116677 CTGGCGGCTGGAGGAGGAGGGGG - Intergenic
1006336313 6:33422624-33422646 TAGGTGGGGTGAGGTGGTGGGGG + Intronic
1006715922 6:36120513-36120535 GTGGGGGGTGGCGGTGGTGGTGG - Intergenic
1006793920 6:36720452-36720474 TGGGCGGCTGGAGGAGGTGCGGG + Exonic
1006871557 6:37256737-37256759 ATGGAGGGTGGGGGTGGGGGTGG + Intronic
1006901805 6:37507699-37507721 TTGGAGGTAGGTGGTGGTGGGGG + Intergenic
1006901873 6:37507848-37507870 TTGGGGGTAGGTGGTGGTGGTGG + Intergenic
1006901880 6:37507864-37507886 GTGGTGGGGGTAGGTGGTGGTGG + Intergenic
1006901895 6:37507903-37507925 GTGGTGGGGGTAGGTGGTGGTGG + Intergenic
1006985483 6:38172954-38172976 TGGGCTGGTGGGGGTGCTGGAGG - Exonic
1006985927 6:38175552-38175574 TTGACTGGTGGTGGTGGTGGTGG + Intronic
1007144324 6:39612384-39612406 TGGGATGGTGGTGGTGGTGGTGG - Intronic
1007210178 6:40187394-40187416 GTGGCGGGGTGAGGGGGTGGTGG + Intergenic
1007411480 6:41664585-41664607 TTGGCGTGTGGTGGTGGTGGGGG - Intergenic
1007437273 6:41823813-41823835 GTGGGCAGTGGAGGTGGTGGGGG + Intronic
1007520894 6:42451483-42451505 TGGGGTGGTGGAGGAGGTGGTGG - Intronic
1007557889 6:42782361-42782383 TGGGTGGGTGATGGTGGTGGTGG + Intronic
1007641011 6:43339631-43339653 GGGGGTGGTGGAGGTGGTGGAGG + Exonic
1007892703 6:45310532-45310554 TGTTCTGGTGGAGGTGGTGGAGG - Intronic
1007920516 6:45605393-45605415 TCGGCTGGTGGGGGAGGTGGAGG - Intronic
1008099646 6:47377335-47377357 TTGAGTGGTGGAGGTGGAGGTGG + Intergenic
1008119507 6:47596004-47596026 TTGGCTATAGGAGGTGGTGGAGG - Exonic
1008578212 6:52881787-52881809 TTGGGGGGTGGGGGAGGCGGGGG + Intronic
1008646453 6:53519417-53519439 CTGGTGGGTGGAGGGGGAGGGGG - Intronic
1009444687 6:63727825-63727847 TTGGGAGGTGGAGGTGGGGGTGG + Intronic
1009497973 6:64374188-64374210 TGGGAGGGTGGAGGTGTGGGGGG + Intronic
1009887290 6:69639128-69639150 GGGGGGCGTGGAGGTGGTGGAGG - Intergenic
1010095375 6:72037133-72037155 TTGGAGGTTGGGGGTGGGGGTGG + Intronic
1010196014 6:73241078-73241100 TTTGTGGGTGGGGGTGGGGGTGG - Intronic
1010211108 6:73363385-73363407 TTGGTGGGTGGGGGAGGGGGCGG + Intronic
1010416502 6:75617517-75617539 TTGGGAGGTGGAGGCGGAGGCGG - Intronic
1010449084 6:75982151-75982173 TTGTAGGATGAAGGTGGTGGTGG + Intronic
1010661216 6:78572624-78572646 GTGGGGGGTGGGGGTGCTGGGGG + Intergenic
1011198956 6:84813665-84813687 TTGGCGGGTGGTGGGGAGGGAGG - Intergenic
1011278158 6:85649985-85650007 TTAGGGGGTGGAGGAGGTGTTGG + Intergenic
1011462909 6:87624838-87624860 TTGGTGGGTGGGGGTGCTGGGGG - Intronic
1011479360 6:87778900-87778922 TTGGGGGGGGGTGGTGGTGGTGG + Intergenic
1011640638 6:89413083-89413105 TAGGGGAGTGGCGGTGGTGGGGG + Intergenic
1012392011 6:98752449-98752471 TTGGCGGGTGGGGGTGCTAGGGG - Intergenic
1012398373 6:98824936-98824958 GCGGGGGGTGGAGGAGGTGGCGG - Intergenic
1012500265 6:99880781-99880803 TTGGGGGTGGGTGGTGGTGGTGG + Intergenic
1012793796 6:103734664-103734686 TGTTCTGGTGGAGGTGGTGGGGG - Intergenic
1012919041 6:105201893-105201915 TTGGGGGGTCGAGTTGGGGGAGG + Intergenic
1012922726 6:105235725-105235747 TGTTCCGGTGGAGGTGGTGGAGG - Intergenic
1012937883 6:105387145-105387167 TTGCCGGGTGGAGGTTGCAGTGG + Intronic
1013229873 6:108152539-108152561 ATGGGGGGTGGGGGTGGTTGGGG + Intronic
1013711814 6:112909694-112909716 TTGTGGGGTGGGGGTGCTGGGGG + Intergenic
1014122358 6:117740058-117740080 CTGGCTGGTGGCGGCGGTGGGGG - Intergenic
1014336879 6:120147758-120147780 GTGGAGGGTGGAGGTGGTGGGGG - Intergenic
1014855514 6:126396321-126396343 TGGGCCTGAGGAGGTGGTGGTGG - Intergenic
1015628158 6:135203381-135203403 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
1015717413 6:136206702-136206724 TTGGCTGGGGGTGGTGGAGGAGG + Intergenic
1015749685 6:136548086-136548108 GTGGGGGGGGGTGGTGGTGGTGG - Intronic
1015750425 6:136553108-136553130 TTAGGGGGTGGTGGTGGTGATGG - Intergenic
1015877920 6:137842756-137842778 TGTTCTGGTGGAGGTGGTGGAGG + Intergenic
1015965935 6:138694768-138694790 TTGGCCGGGCGTGGTGGTGGGGG + Intergenic
1016032697 6:139354461-139354483 TTGTGAGGTGGAGGTGGGGGCGG - Intergenic
1016987012 6:149903409-149903431 TTGGCGGGAGTGGGTGGGGGTGG - Intergenic
1017041227 6:150310093-150310115 GGGGCGGGTGGAGGTGGGGTTGG - Intergenic
1017087771 6:150730316-150730338 AGGGTGGGTTGAGGTGGTGGGGG + Intronic
1017146649 6:151240766-151240788 TTTGGGGGTGGGGGTGGGGGTGG + Intronic
1017195928 6:151700206-151700228 TTAGTGGGTTGAAGTGGTGGAGG + Intronic
1017422744 6:154289957-154289979 TTCCTGGGTGGTGGTGGTGGTGG - Intronic
1017443591 6:154486983-154487005 TTTGCGGGGGCAGGTGGTGAGGG + Intronic
1017447345 6:154518774-154518796 GTGGGGGGCGGGGGTGGTGGGGG - Intergenic
1017751265 6:157492289-157492311 TTAGCGAGTTGAGGTGGTGCAGG - Intronic
1017814336 6:158005852-158005874 TGGGCGGGTAGTGGTGGTGCAGG - Intronic
1017956895 6:159186204-159186226 TTGGCGGGTGGTGGGGAAGGAGG + Intronic
1017978979 6:159382043-159382065 TTGAGGGGTGGTGGGGGTGGTGG - Intergenic
1017981049 6:159401518-159401540 TTGCCGGGTGGAGGTGGTTAGGG - Intergenic
1018064345 6:160115196-160115218 GTGGTGAGTGGATGTGGTGGGGG + Intergenic
1018186892 6:161273564-161273586 TGGGCGGGGGGTGGTGGTGGGGG - Intronic
1018292231 6:162303853-162303875 GTGGTGGATGGAGGTAGTGGAGG + Intronic
1018650099 6:165986170-165986192 CTCGAGGGTGGAGGAGGTGGCGG - Intronic
1018699586 6:166416088-166416110 GTGGATGGTGGAGGTGATGGAGG - Intronic
1018829630 6:167433241-167433263 ATAGTGGATGGAGGTGGTGGTGG + Intergenic
1018829660 6:167433368-167433390 ATAGTGGATGGAGGTGGTGGTGG + Intergenic
1018829667 6:167433397-167433419 GTGGATGGTGGTGGTGGTGGTGG + Intergenic
1018851074 6:167590505-167590527 GTGTAGGGAGGAGGTGGTGGTGG - Intergenic
1018851140 6:167590975-167590997 TGGGGTGGTGGAAGTGGTGGTGG - Intergenic
1019440562 7:1044392-1044414 TTGGGGGGCGGTGGCGGTGGAGG - Intronic
1019443026 7:1056856-1056878 TTGGCGGGGTGGGGGGGTGGGGG + Intronic
1019477153 7:1249567-1249589 ATGGCTGGTGGGGGGGGTGGGGG - Intergenic
1019631368 7:2051628-2051650 TGGGGGGGTGGGGGAGGTGGGGG - Intronic
1019713514 7:2528067-2528089 TGGGAGGGTGGGGGTGGGGGAGG + Exonic
1019754724 7:2760662-2760684 TTGGAGGGTGGAGGTTGGGAAGG - Intronic
1019783840 7:2960839-2960861 TTGTAAGGTGGTGGTGGTGGTGG - Intronic
1019920830 7:4162332-4162354 GGGGTGGGTGGTGGTGGTGGTGG + Intronic
1019920831 7:4162335-4162357 GTGGGTGGTGGTGGTGGTGGTGG + Intronic
1019929676 7:4215270-4215292 TTGGTGGGTGGTGAAGGTGGAGG + Intronic
1020105926 7:5422330-5422352 TTGGGGGGTGGTTGTGGGGGGGG - Intronic
1020262593 7:6538963-6538985 TTGTAGGGTGGAGGTCGAGGGGG + Intronic
1020277717 7:6635075-6635097 GTGGTTGGTGGTGGTGGTGGTGG - Intergenic
1020277718 7:6635078-6635100 GTGGTGGTTGGTGGTGGTGGTGG - Intergenic
1020664791 7:11026166-11026188 CTGACGGATGGGGGTGGTGGTGG - Intronic
1021076008 7:16305578-16305600 TTGGCTGGGCGTGGTGGTGGTGG + Intronic
1021678373 7:23104765-23104787 TTTGGTGGTGGTGGTGGTGGTGG - Intergenic
1022038560 7:26557558-26557580 TTGGACAGTGGAAGTGGTGGGGG + Intergenic
1022189502 7:28003684-28003706 TTGGCAGGTGGAGGTGGGATAGG - Intronic
1022356032 7:29615405-29615427 TGTTAGGGTGGAGGTGGTGGTGG - Intergenic
1022603972 7:31790306-31790328 TTGGAGGGTGGAGGTGGGCGGGG - Intronic
1022747534 7:33188110-33188132 GTGGCGGGTGGGGGTGGGGTAGG + Intronic
1023334622 7:39155250-39155272 TTGGGGGGTGGGGGTTGGGGGGG + Intronic
1023382604 7:39623658-39623680 TGGGCGGCTGGAGGAGGAGGAGG - Exonic
1023544928 7:41308405-41308427 TTGGCAGGTGGTGGGGTTGGGGG + Intergenic
1023752604 7:43386383-43386405 TTGGAGGTTGAAGGTGGAGGAGG + Intronic
1024049760 7:45610990-45611012 TGGAAGTGTGGAGGTGGTGGTGG + Intronic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1024317168 7:48031872-48031894 TGGGTGTGTGGTGGTGGTGGGGG + Intergenic
1024334364 7:48191123-48191145 TTGGGGTAGGGAGGTGGTGGGGG - Intronic
1024462655 7:49674568-49674590 TTTGTGGTTGGTGGTGGTGGGGG - Intergenic
1024606321 7:51025233-51025255 TGGGAGGGTGGAGGGGGTGGTGG + Exonic
1024777660 7:52806469-52806491 TTGGGAGGTGGAGGTGGTTGCGG + Intergenic
1026038139 7:66844557-66844579 CTGGCTGGAGGAGGTGTTGGGGG + Intergenic
1026050544 7:66942863-66942885 TTGGTGGGTGGAGGTGGGGGTGG + Intronic
1026256208 7:68714158-68714180 TTGGGGGGTGGAGTAGGGGGAGG - Intergenic
1026469346 7:70681604-70681626 TGGGCGGGTTGGGGTGGTAGTGG - Intronic
1026482502 7:70790600-70790622 ACAGCGGGTGGTGGTGGTGGTGG - Exonic
1026854103 7:73741938-73741960 TTGGTGGGTGAAGGGCGTGGGGG + Intergenic
1026938962 7:74275648-74275670 TTGCTGGGTGGTGGGGGTGGAGG - Intergenic
1027298972 7:76809923-76809945 TTGGAGGGTGGCAGTGGTTGGGG - Intergenic
1027529821 7:79316259-79316281 TTGGAGTGGGGGGGTGGTGGTGG - Intronic
1027564902 7:79779584-79779606 TTGGAGGGGTGAGGTGGTGGTGG - Intergenic
1027881863 7:83849649-83849671 TTTGGCGGTGGAGGTAGTGGAGG + Intergenic
1028374010 7:90126049-90126071 TTGGTGGGGGGTGGGGGTGGGGG + Intergenic
1028874550 7:95806481-95806503 TTGGAGGCTGCAGGTAGTGGAGG + Intronic
1029020361 7:97358515-97358537 CTGGGAGGTGGAGGTTGTGGTGG + Intergenic
1029099174 7:98114147-98114169 TTGGTAGGAGGGGGTGGTGGTGG + Intronic
1029137046 7:98380792-98380814 TTGGGTGGTGGCGATGGTGGTGG - Intronic
1029196798 7:98811032-98811054 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1029196799 7:98811035-98811057 GTGGGTGGTGGAGGTGGTGGTGG + Intergenic
1029196914 7:98811529-98811551 GTAGTGGGTGGTGGTGGTGGTGG + Intergenic
1029196923 7:98811563-98811585 ATGGTTGGTGGTGGTGGTGGTGG + Intergenic
1029211291 7:98910233-98910255 GTGGCAGGTGGGGGTGGGGGCGG - Exonic
1029413898 7:100431197-100431219 GTGGGTGGTGGTGGTGGTGGCGG - Exonic
1029424821 7:100488877-100488899 TTGGCAGCAGGAGGTGGAGGCGG - Exonic
1029608777 7:101615487-101615509 GGTGCGGGTGGAGGTGGTGTAGG - Intronic
1029676890 7:102075999-102076021 GGGGCGGGTGGGGATGGTGGGGG - Intronic
1029858290 7:103541076-103541098 GTGTGGGGTGGTGGTGGTGGTGG + Intronic
1030311549 7:108073947-108073969 GGGGCGGGTGGTGGTGGTGGTGG + Intronic
1030348445 7:108457467-108457489 TTGGAGGCTGGGGGTGGAGGAGG - Intergenic
1030844864 7:114396664-114396686 TGAGAGGGTGGTGGTGGTGGTGG + Intronic
1030856306 7:114562060-114562082 CAGGTGGGTGGAGGTGGTGGTGG - Intronic
1030954695 7:115837599-115837621 GTGGCGGGGGGAGGGGGTGGGGG + Intergenic
1031119081 7:117700039-117700061 GTTGGGGGTGGTGGTGGTGGTGG + Intronic
1032087195 7:128890617-128890639 GTGGGGGCTGGAGGTCGTGGGGG + Intronic
1032138743 7:129307380-129307402 TAGGCCTGTGGTGGTGGTGGTGG - Intronic
1032172990 7:129601325-129601347 GTGGAGGTTGGAGGTGGAGGTGG - Intergenic
1033130331 7:138740508-138740530 TTGGGGGGTGGGGGTGGCGGAGG - Intronic
1033199940 7:139359956-139359978 CTGGCGGGTGGCGGTGTTGAAGG + Exonic
1033250073 7:139751337-139751359 AAGGTGGTTGGAGGTGGTGGTGG - Intronic
1033356958 7:140607766-140607788 GTGGAGGGTGGTGGCGGTGGTGG - Intronic
1033402438 7:141039416-141039438 TTGGAGGGTGGATGTGGGGGAGG - Intergenic
1033573045 7:142652603-142652625 TTGGGGGGTGGAGTGGGGGGAGG + Intergenic
1033777775 7:144631905-144631927 TTGTGTGGTGGTGGTGGTGGTGG - Intronic
1034350865 7:150413976-150413998 CTGGAGGGTGGGGGTGGCGGTGG - Intergenic
1034400520 7:150858660-150858682 TTGGCTGTTGGATGTGGTGGAGG + Intronic
1034498151 7:151434012-151434034 TTGGCAGTGGGAGGTGGTGGAGG + Intronic
1034535705 7:151724541-151724563 TTGGAGGGTAGAGCTGGTGCTGG + Intronic
1035011485 7:155720755-155720777 TTGGTGGCTGGAGGTGCTGCAGG + Intronic
1035160176 7:156944428-156944450 TTGGGGGCTGGAGGTGCAGGGGG + Intergenic
1035618663 8:1021891-1021913 GTGGGGGGTGGAGATGGTCGTGG - Intergenic
1035620518 8:1033377-1033399 CTGGGGGTTGGGGGTGGTGGTGG + Intergenic
1036133341 8:6136550-6136572 GGTGCGGGTGGTGGTGGTGGGGG - Intergenic
1036133345 8:6136556-6136578 TCGGGGGGTGCGGGTGGTGGTGG - Intergenic
1036592754 8:10183768-10183790 TGAGCTGGTGGTGGTGGTGGTGG + Intronic
1036751334 8:11445315-11445337 GTGGTGGGTGGAGGTGGTGAGGG - Intronic
1036777629 8:11624592-11624614 TTAGAGTGTGGAGGTGATGGTGG + Intergenic
1037424804 8:18743980-18744002 CTGGGTGGTGGTGGTGGTGGTGG - Intronic
1037735302 8:21561133-21561155 TTTGCAGGTGAGGGTGGTGGTGG - Intergenic
1037806917 8:22063133-22063155 TTGACAGGTGGAGGTTGTAGTGG - Intronic
1037867644 8:22459177-22459199 TTGGGAGGTGTAGGTGGAGGCGG - Intronic
1037961149 8:23099270-23099292 TTTGTTGGTGGTGGTGGTGGTGG - Intronic
1038230646 8:25696285-25696307 TTTTGGGGTGGAGGAGGTGGTGG + Intergenic
1038231719 8:25706749-25706771 GTGGGGGGTGGGGGTGGTGGGGG - Intergenic
1038231722 8:25706752-25706774 TTGGTGGGGGGTGGGGGTGGTGG - Intergenic
1038567142 8:28629148-28629170 TTGGAGGGTGGGGGTGGGGGAGG - Intronic
1038574229 8:28690455-28690477 TTTCTGGGTGGTGGTGGTGGTGG + Intronic
1038574230 8:28690458-28690480 CTGGGTGGTGGTGGTGGTGGTGG + Intronic
1038875701 8:31546494-31546516 TTGGTGGGTGGGGGTGCGGGGGG + Intergenic
1039172181 8:34760222-34760244 TTAGCTGGGGGAGGTGGTGTAGG + Intergenic
1039328545 8:36511887-36511909 TTGGGTGGTGGAGGGCGTGGGGG - Intergenic
1039458975 8:37727568-37727590 TTGGGGGGAGGTGGTGTTGGAGG - Intergenic
1039462327 8:37755564-37755586 TTGGCGGGGGGGGGGGGTGGGGG - Exonic
1039562228 8:38521817-38521839 TTGGCTGGTGGGTGTGGTGTGGG + Intronic
1039567984 8:38564760-38564782 GTGGCGGGGTGAGGCGGTGGGGG - Intergenic
1039714682 8:40094712-40094734 TAGGTGGGGGAAGGTGGTGGTGG - Intergenic
1039860861 8:41456229-41456251 CTGGGAGGTGGAGGTTGTGGTGG - Intergenic
1039886513 8:41657090-41657112 TTGTGGGGTGGAGGTGTTGAGGG - Intronic
1039967393 8:42293260-42293282 TTGGCCGGAGGAGGAGGAGGAGG - Intronic
1040009781 8:42651873-42651895 TTAGAGGGTGGAGGTGGAGTGGG - Intergenic
1040373821 8:46803307-46803329 TTGTGGGGTGGGGGTGGGGGAGG + Intergenic
1041007343 8:53508085-53508107 GTGATGGGTGGTGGTGGTGGTGG - Intergenic
1041054894 8:53974515-53974537 TTGGGGGGTAGTGGGGGTGGGGG + Intronic
1041142973 8:54842783-54842805 TTGGGGGCAGCAGGTGGTGGCGG - Intergenic
1041175358 8:55191197-55191219 ATGGCTGGAGGAGGAGGTGGAGG - Intronic
1041193508 8:55377091-55377113 TTTCCAGGTGGTGGTGGTGGCGG - Intronic
1041277862 8:56181567-56181589 TTGGCAGGGGGTGGGGGTGGGGG + Intronic
1041285805 8:56260550-56260572 TTGTCGGGTGGGGGTAGGGGGGG - Intergenic
1041625467 8:60020926-60020948 TTGAGGGGTGGGGGAGGTGGAGG - Intergenic
1042256427 8:66808942-66808964 TGGGGAGGTGGAGGTTGTGGTGG - Intronic
1042462203 8:69082716-69082738 AAGGTGGGTGGTGGTGGTGGTGG - Intergenic
1042651835 8:71051502-71051524 GTTGCTGGTGGCGGTGGTGGTGG + Intergenic
1042981645 8:74536251-74536273 GTTGGGGGTGGAGGTGGTGGGGG - Intergenic
1043197013 8:77307942-77307964 TTGGTGGGTATAGTTGGTGGTGG + Intergenic
1043864799 8:85362450-85362472 GTGGCGTTTGAAGGTGGTGGTGG + Intronic
1043954226 8:86342695-86342717 GTGGCGCGTGGACGGGGTGGGGG + Intergenic
1044212907 8:89571560-89571582 TTTGGTGGTGGTGGTGGTGGTGG + Intergenic
1044759827 8:95506534-95506556 TTGGAGGGTGGAGTTGGACGTGG + Intergenic
1044761156 8:95519042-95519064 GTGGCGGGGGGCGGCGGTGGGGG + Intergenic
1045138456 8:99249908-99249930 CTTGCGGTTGGGGGTGGTGGGGG + Intronic
1045406385 8:101870889-101870911 TTGGGGGGGGGGGGTGGGGGCGG - Intronic
1045417141 8:101978639-101978661 TGTGCAGGTGGTGGTGGTGGTGG + Intronic
1045447837 8:102285983-102286005 TTGGCGGGGGGAGGTGGCGTGGG - Intronic
1045480338 8:102586547-102586569 AAAGGGGGTGGAGGTGGTGGGGG - Intergenic
1046520682 8:115321178-115321200 TTTGGGGGGGGAGGTGGAGGCGG - Intergenic
1046544581 8:115633368-115633390 TCTGCTGGTGGTGGTGGTGGTGG + Intronic
1046559198 8:115816344-115816366 ATGCGGGGTGGAGGGGGTGGGGG - Intergenic
1047040164 8:120984858-120984880 ATGGCGGCACGAGGTGGTGGTGG + Intergenic
1047172314 8:122505705-122505727 GTGTTGGGAGGAGGTGGTGGAGG + Intergenic
1047416573 8:124669117-124669139 TTGGTGTGTGTAGGTGGTAGGGG - Intronic
1047494338 8:125398939-125398961 TTGGGAGGTGGAGGTGGAGGTGG - Intergenic
1049102221 8:140588016-140588038 TTGGAGGATGGAGGAGATGGGGG - Intronic
1049168402 8:141141397-141141419 CAGGGGGCTGGAGGTGGTGGGGG + Intronic
1049357729 8:142196962-142196984 TGGGAGGGTGGAGGCGGTGGAGG - Intergenic
1049542061 8:143213146-143213168 TTTGAGGCTGGAGCTGGTGGGGG + Intergenic
1049600078 8:143503622-143503644 TTGGGTGCTGGAGGAGGTGGTGG - Intronic
1049600086 8:143503654-143503676 TTGGGTGCTGGAGGAGGTGGTGG - Intronic
1049671064 8:143870070-143870092 CTGGCATGGGGAGGTGGTGGTGG + Exonic
1049936059 9:503235-503257 TTGGGGCGGGGTGGTGGTGGTGG + Intronic
1049942947 9:566010-566032 ATGGAGGGTGGAGGTTGGGGAGG - Intronic
1049958665 9:716979-717001 TCTGTGGGTGGGGGTGGTGGGGG + Intronic
1050160247 9:2711378-2711400 TTGGTGGGGGGGGGGGGTGGGGG + Intergenic
1050293997 9:4186142-4186164 TTGTGGGGTGGGGGTGGGGGAGG - Intronic
1050324271 9:4485011-4485033 TGGGGGGGTGGGGGTGGTGGGGG + Intergenic
1050439602 9:5647931-5647953 GGGGTGGGTGGTGGTGGTGGTGG + Intronic
1050439603 9:5647934-5647956 GTGGGTGGTGGTGGTGGTGGTGG + Intronic
1050502739 9:6315558-6315580 TATTCCGGTGGAGGTGGTGGTGG - Intergenic
1050690570 9:8222530-8222552 TTAGCCGGTTGTGGTGGTGGGGG + Intergenic
1050749962 9:8925561-8925583 TTGGTTGGCGGGGGTGGTGGGGG - Intronic
1051151904 9:14089272-14089294 TTGGGGGTTGGGGGTGTTGGAGG + Intronic
1051340022 9:16102487-16102509 TTGGGGGGGGGCGGGGGTGGGGG + Intergenic
1051547892 9:18296986-18297008 GAGCCTGGTGGAGGTGGTGGTGG - Intergenic
1051594521 9:18811159-18811181 TTTGCTGGTGCAGGTAGTGGTGG - Intronic
1051609828 9:18950354-18950376 GTGGGGGATGGTGGTGGTGGTGG - Intronic
1051930059 9:22374229-22374251 TTGGTGGGTTGAGGAGGTGGGGG - Intergenic
1052051040 9:23850221-23850243 GGGGGGGGTGGTGGTGGTGGTGG - Intergenic
1052092415 9:24345146-24345168 AGGGAGGGTGGAGGTGTTGGGGG + Intergenic
1052901980 9:33801195-33801217 TTTGGTGGTGGTGGTGGTGGTGG - Intergenic
1052904165 9:33818364-33818386 TTGGGGGGTGGGGGTGGGGGTGG + Intronic
1053106462 9:35413295-35413317 TTGTCTTGTGGTGGTGGTGGTGG - Intergenic
1053186358 9:36019885-36019907 TTTGGTGGTGGTGGTGGTGGTGG + Intergenic
1053410634 9:37914263-37914285 GTGGTGGGTGGCGGTGGTGGCGG - Intronic
1054451048 9:65403848-65403870 TTGGGGGGTGGAGGTGTGTGGGG - Intergenic
1054456480 9:65434004-65434026 TTGGTGGGTGGGGCAGGTGGAGG - Intergenic
1054835451 9:69671794-69671816 GTGGCGGACGGAGGTGTTGGGGG - Intronic
1054946900 9:70805220-70805242 TGGGGTGGGGGAGGTGGTGGTGG + Intronic
1055276003 9:74617078-74617100 TTTGCGGGGGGAGCGGGTGGTGG - Intronic
1055497365 9:76868829-76868851 TTGGGGGGTGGGGGGGGGGGCGG + Intronic
1055820373 9:80254698-80254720 TTTGGGGGTGGAGGTGAGGGGGG - Intergenic
1056045884 9:82715380-82715402 TTTGTTGGTGGTGGTGGTGGGGG + Intergenic
1056151519 9:83794906-83794928 TTGGTAGGTGGAGGTGGGGAGGG + Intronic
1056214156 9:84392621-84392643 TTGGACCGTGGTGGTGGTGGAGG + Intergenic
1056322677 9:85451784-85451806 TGATCTGGTGGAGGTGGTGGAGG + Intergenic
1056487434 9:87073039-87073061 TTGGCGGGGTGACTTGGTGGAGG + Intergenic
1056598019 9:88023638-88023660 CTGGCTGTTGGTGGTGGTGGGGG + Intergenic
1056709606 9:88980079-88980101 GTGGGGGGTGGGGGTGGGGGTGG + Intergenic
1056714030 9:89013859-89013881 TTGGTTGGTGAAGGTGGAGGAGG - Intronic
1056799547 9:89681503-89681525 GTGGCGGGGGGTGGCGGTGGCGG - Intergenic
1056945987 9:90997214-90997236 TTGGAGGGTGGATGTGGTTTTGG - Intergenic
1056979092 9:91291308-91291330 TGGGGGGGTGGGGGTGGAGGCGG + Intronic
1057038928 9:91833513-91833535 CTGGCGTGTGGCGGTGCTGGTGG - Intronic
1057122357 9:92587669-92587691 TTGGTGGGTGGTGGTTGTTGGGG + Intronic
1057514032 9:95705765-95705787 GTGGTGGGTGGTGATGGTGGTGG - Intergenic
1057776237 9:98012717-98012739 TTTCGGGGTGGTGGTGGTGGTGG + Intronic
1057885058 9:98823649-98823671 TTGGCCAGTGGAGGTGATGTAGG + Intronic
1057891008 9:98869913-98869935 TGGCGGGGTGGAGGGGGTGGGGG - Intergenic
1057952205 9:99378065-99378087 TGGGGGGGTGGCAGTGGTGGTGG + Intergenic
1057964344 9:99488617-99488639 TTGGGGGGTGGAGGATGAGGAGG + Intergenic
1058083198 9:100720984-100721006 TTGGTGGGGGGGGGTAGTGGTGG - Intergenic
1058128723 9:101225735-101225757 ATAGGGGGTGGGGGTGGTGGTGG - Intronic
1058599933 9:106658367-106658389 GTGGAGGGTGGAGGTGCAGGTGG - Intergenic
1058956229 9:109951235-109951257 TTGGTTGGTGGGGGTGGGGGTGG + Intronic
1059038208 9:110782701-110782723 TGGGTGGGTGGTGGTGGTAGGGG - Intronic
1059429935 9:114243824-114243846 ATGTGGGGTGGGGGTGGTGGAGG + Intronic
1059519908 9:114931416-114931438 TCGGAGGGTGGAGGTGGAAGTGG - Intergenic
1059577379 9:115505139-115505161 TTGGGCGGTCGTGGTGGTGGGGG - Intergenic
1059664853 9:116437056-116437078 TTGTGGGGTGGGGGTGGGGGAGG + Intronic
1060066254 9:120503845-120503867 TTGTGGGGTGGTGGTGGTGGTGG - Intronic
1060259056 9:122057812-122057834 TAGGAGGGTGGAGGTGGGGATGG - Intronic
1060404668 9:123367424-123367446 TGGGGGGGTGGGGGGGGTGGGGG - Intronic
1060405617 9:123371583-123371605 GTGTCTGGTGGCGGTGGTGGTGG + Intronic
1060736163 9:126067659-126067681 TTGGGGGATGGTGGTGGTGGTGG + Intergenic
1060755721 9:126211863-126211885 TGGGTGGATGGAAGTGGTGGTGG + Intergenic
1060767102 9:126303170-126303192 TTGTGTGGTGGTGGTGGTGGTGG + Intergenic
1060803284 9:126558059-126558081 GTGGTGGTTGGGGGTGGTGGTGG - Intergenic
1060909435 9:127337507-127337529 ATGGTGGGTGGAGGTGGAAGGGG + Intronic
1061163932 9:128911646-128911668 TTGGCGGGAGGAGCTGGGGGTGG - Intronic
1061218442 9:129235375-129235397 GTGGGGGGTGGGGGTGGTGACGG - Intergenic
1061249800 9:129420139-129420161 TTGGAGGGTGGAAGTGTTGTGGG + Intergenic
1061255889 9:129454069-129454091 GTGGTGGGTGGAGGTGGTGGAGG + Intergenic
1061255897 9:129454091-129454113 GTGGTGGGTGGAGGTGGTGGAGG + Intergenic
1061255911 9:129454129-129454151 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061255917 9:129454145-129454167 GTGGTGGGTGGAGGTGGTGGAGG + Intergenic
1061255931 9:129454181-129454203 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061255932 9:129454184-129454206 GTGGGTGGTGGAGGTGGTGGAGG + Intergenic
1061255940 9:129454206-129454228 GTGGTGGGTGGAGGTGGTGGAGG + Intergenic
1061255951 9:129454237-129454259 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061255960 9:129454260-129454282 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061255966 9:129454276-129454298 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061255977 9:129454308-129454330 ATGGTGGGTGGAGGTGGTGGAGG + Intergenic
1061255986 9:129454333-129454355 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061255996 9:129454362-129454384 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061256009 9:129454394-129454416 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061256015 9:129454410-129454432 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061256028 9:129454442-129454464 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061256029 9:129454445-129454467 GTGGGTGGTGGAGGTGGTGGAGG + Intergenic
1061256037 9:129454467-129454489 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061256043 9:129454483-129454505 GTGGTGGGTGGTGGAGGTGGTGG + Intergenic
1061256044 9:129454486-129454508 GTGGGTGGTGGAGGTGGTGGAGG + Intergenic
1061256066 9:129454551-129454573 GTGGTGGGTGGAGGAGGTGGTGG + Intergenic
1061330443 9:129889077-129889099 GTGGCGGGGGGGGGGGGTGGTGG + Exonic
1061366576 9:130175080-130175102 TGGGCCGTTGGAGGTGGCGGTGG + Intronic
1061669773 9:132182302-132182324 GTGGAGGGTGCAGGGGGTGGAGG + Intronic
1061743902 9:132726026-132726048 ATGGCTGGTGATGGTGGTGGTGG - Intronic
1061935555 9:133855633-133855655 TGTGCGGGGGGAGCTGGTGGCGG - Intronic
1061980041 9:134097237-134097259 TTTGCGGGTGGGGGTGGGGATGG + Intergenic
1061985944 9:134130261-134130283 TTAGCCGGGGGAGGTGGTGCAGG + Intergenic
1062023666 9:134330649-134330671 CTGCAGGATGGAGGTGGTGGTGG + Intronic
1062035671 9:134381532-134381554 GGGGCTGGTGGAGATGGTGGGGG + Intronic
1062051220 9:134448031-134448053 TTGGAGGTTGGATGGGGTGGGGG + Intergenic
1062316142 9:135967748-135967770 CTGGAGGGGCGAGGTGGTGGGGG + Intergenic
1062361156 9:136188813-136188835 CTGGGGGGTGGGGGTGGGGGCGG + Intergenic
1062529546 9:136993886-136993908 CAGGCAGGTGGAGGTGGTGGCGG - Exonic
1062631808 9:137466483-137466505 TTAGATGGTCGAGGTGGTGGTGG - Intronic
1062631832 9:137466581-137466603 TGAGTTGGTGGAGGTGGTGGTGG - Intronic
1185603830 X:1355647-1355669 CTGGGGGGCGGAGGTGGGGGAGG + Intronic
1185678554 X:1868779-1868801 CTGGGAGGTGGAGGTTGTGGTGG + Intergenic
1185927213 X:4160922-4160944 TTGGCGGAGGCAGGTGGTGAGGG + Intergenic
1185940200 X:4309391-4309413 GTTGGGGGTGGAGGAGGTGGTGG + Intergenic
1186317015 X:8382030-8382052 ATGGTGGGTGGAGGTGGAAGGGG + Intergenic
1186816765 X:13245966-13245988 TTAGCAGGTGAAGGAGGTGGCGG + Intergenic
1186964389 X:14772133-14772155 TTGGGGGCTGGAGGGGTTGGGGG + Intergenic
1187181747 X:16949068-16949090 TTTGGTGGTGGTGGTGGTGGTGG + Intronic
1187200346 X:17128393-17128415 TAGGCTGCTGGAGGTGGGGGTGG + Intronic
1187224411 X:17361914-17361936 TTGCGGGGTGGGGGTGGAGGGGG + Intergenic
1187285083 X:17897409-17897431 TAGGTTGGTGGATGTGGTGGTGG - Intergenic
1187357982 X:18596321-18596343 TGTGGGGGTGGAGGTGGGGGAGG + Intronic
1187489238 X:19735720-19735742 TTGGCGGGGGGGGGGGGTGGGGG + Intronic
1187504185 X:19865417-19865439 ATAGAGGGTGGAGGTGGAGGAGG + Intronic
1187511664 X:19925209-19925231 TTGGGGAGTGGTGGCGGTGGTGG - Intronic
1187612921 X:20961657-20961679 TGGGCCTGTGGTGGTGGTGGTGG + Intergenic
1187688435 X:21839746-21839768 GTCGCTGGTGGTGGTGGTGGTGG + Exonic
1187929923 X:24284637-24284659 TTTGGGGGGGGTGGTGGTGGTGG + Intergenic
1187993942 X:24905418-24905440 TGGGGGGGTGGGGGTGGGGGAGG + Intronic
1189073075 X:37885902-37885924 TTTGAGGGAGGGGGTGGTGGTGG + Intronic
1189253538 X:39620003-39620025 TTGTGGGGCGGTGGTGGTGGAGG - Intergenic
1189288199 X:39866892-39866914 TTGGGGGGTGGGGGTGGGGGAGG - Intergenic
1189309582 X:40010112-40010134 TTTGAGGGTGGAGGTGGGGAAGG - Intergenic
1189320595 X:40084708-40084730 TTCGGTGGTGGTGGTGGTGGGGG - Intronic
1189384925 X:40529459-40529481 ACGGATGGTGGAGGTGGTGGGGG - Intergenic
1189413645 X:40794826-40794848 TGTTCTGGTGGAGGTGGTGGAGG - Intergenic
1189644848 X:43116905-43116927 TAAGGGGGTGGAGGGGGTGGTGG + Intergenic
1189726186 X:43969900-43969922 CTGGCGGGAGGAGGTGGAGGAGG + Intronic
1189834456 X:45005964-45005986 GTGGGGGGTGGGGGGGGTGGGGG - Intronic
1189974075 X:46445099-46445121 CGGGCGGGTGGAGGTTGGGGAGG + Intergenic
1190042530 X:47082781-47082803 GGGGCGGGTGGTGGTGGGGGCGG - Intronic
1190042531 X:47082784-47082806 TTGGGGGCGGGTGGTGGTGGGGG - Intronic
1190213480 X:48466090-48466112 ATGGCTGGTGCAGGTGGGGGAGG + Exonic
1190245147 X:48685960-48685982 TTGGCTGGTGTTGGTGGTGGGGG - Exonic
1190715956 X:53103768-53103790 GTGGTGGTTGGATGTGGTGGTGG - Intergenic
1190732446 X:53234593-53234615 TGGGCTGGTGCAGGGGGTGGCGG + Exonic
1190736500 X:53258874-53258896 TTTGGTGGTGGTGGTGGTGGTGG - Intronic
1190744306 X:53312376-53312398 TTGGGTGGAGAAGGTGGTGGTGG - Intronic
1190981200 X:55457946-55457968 TTGGGTGGGGCAGGTGGTGGTGG + Intergenic
1190981202 X:55457952-55457974 GGGGCAGGTGGTGGTGGTGGTGG + Intergenic
1190987496 X:55515228-55515250 GGGGCAGGTGGTGGTGGTGGTGG - Intergenic
1190987498 X:55515234-55515256 TTGGGTGGGGCAGGTGGTGGTGG - Intergenic
1191182063 X:57574787-57574809 TTGGCTGCTGGAGGGGTTGGAGG - Intergenic
1191714493 X:64185000-64185022 GTGGTGGGTGGAGGTGGAGTAGG - Intergenic
1191863281 X:65683424-65683446 CTGGGTGGTGGTGGTGGTGGTGG - Intronic
1192169201 X:68844056-68844078 ATGGGGGGTGGAGGTGGGGAGGG - Intergenic
1192194888 X:69021501-69021523 TTTAAGGGTGGGGGTGGTGGTGG + Intergenic
1192201089 X:69067270-69067292 GTGGCGGCTGGGGGTAGTGGTGG - Intergenic
1192452778 X:71253953-71253975 TAGCCGGGAGGCGGTGGTGGGGG - Intronic
1192611599 X:72572597-72572619 TTTGGGGGTGGGGGTGGGGGCGG - Intronic
1192795998 X:74424087-74424109 CTAGAGGGTGGGGGTGGTGGTGG + Intronic
1193420861 X:81280423-81280445 TGGTCTGGTGGAGGAGGTGGAGG - Intronic
1193649869 X:84117936-84117958 GTGGCAGGGGGTGGTGGTGGTGG - Intronic
1193654550 X:84183815-84183837 TGGGGTGGTGGTGGTGGTGGTGG - Intronic
1193769349 X:85570491-85570513 TTTGGGGTTGGAGGAGGTGGAGG - Intergenic
1193804774 X:85982251-85982273 TTTGGTGGTGGTGGTGGTGGAGG - Intronic
1194748467 X:97656510-97656532 AGGGCCGGTGGTGGTGGTGGTGG + Intergenic
1194926867 X:99836240-99836262 TGTTCTGGTGGAGGTGGTGGAGG + Intergenic
1195037404 X:100982343-100982365 TTGGCTGGGTGTGGTGGTGGGGG + Intronic
1195284101 X:103366710-103366732 TGGGGGCGTGGGGGTGGTGGGGG - Intergenic
1195303844 X:103558836-103558858 TTGGGGGTTGATGGTGGTGGTGG + Intergenic
1195389868 X:104350453-104350475 TGGGGGAGTGGGGGTGGTGGGGG - Intergenic
1195410495 X:104564632-104564654 TTGGCGGGAGGTGGTAGTGAAGG + Intergenic
1195415460 X:104615372-104615394 TTGGGGGGTGGGGTTGGGGGAGG - Intronic
1195465132 X:105171716-105171738 TGGGAGGGTGGTGGGGGTGGGGG + Intronic
1195570370 X:106393321-106393343 TGGGTGGGTGGAAGGGGTGGAGG - Intergenic
1195582183 X:106517706-106517728 TTGTAGGGTGTAGGGGGTGGAGG - Intergenic
1195802562 X:108730313-108730335 TGCGGGGGTGGGGGTGGTGGTGG - Intronic
1195906359 X:109848519-109848541 TTGGTGGATGGAGGGGGTGGAGG - Intergenic
1195992546 X:110696866-110696888 TTGGGGGCTGGAGTGGGTGGTGG + Intronic
1196044795 X:111246023-111246045 GTGGTGAGTGGTGGTGGTGGTGG + Exonic
1196085469 X:111679124-111679146 TTGGGAGGTGGAGGCGGAGGCGG + Intronic
1196251312 X:113463467-113463489 TGGGGGGCTGGAGTTGGTGGGGG - Intergenic
1196402431 X:115330487-115330509 ATGGCGGGGGGAGGGGGAGGTGG + Intergenic
1196737541 X:118992773-118992795 TGTTCTGGTGGAGGTGGTGGTGG - Intronic
1197204130 X:123774938-123774960 CTGGGAGGTGGAGGTTGTGGTGG + Intergenic
1197415928 X:126172729-126172751 TGGGCGGCGGGAGGTTGTGGGGG - Intergenic
1197588960 X:128384506-128384528 TGTTCTGGTGGAGGTGGTGGTGG - Intergenic
1197721930 X:129751099-129751121 TTGCCGGGGGGGGGGGGTGGGGG - Intronic
1197997833 X:132398800-132398822 TTTGATGGTGGTGGTGGTGGTGG - Intronic
1198096007 X:133380343-133380365 TTGGGGGGTGGGGGTGGGGGTGG - Intronic
1198186475 X:134258411-134258433 TTGGCCAGGGGTGGTGGTGGTGG + Intergenic
1198200040 X:134407168-134407190 GTGGTGGGTGGAGGGGGTGTTGG + Intronic
1198474607 X:136983411-136983433 ATGGGGGATGGAGGTGCTGGGGG + Intergenic
1198637025 X:138711805-138711827 TGGGGGGGTGGGGGTGGGGGTGG - Intronic
1198673654 X:139108832-139108854 TTGGGGGGTGGGGTTGGGGGAGG - Intronic
1199057801 X:143318779-143318801 TGTTCTGGTGGAGGTGGTGGGGG + Intergenic
1199156180 X:144551394-144551416 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1199238114 X:145513571-145513593 TTGGGGGGTGTGGGTGGGGGAGG - Intergenic
1199428885 X:147736191-147736213 TGGGCGGGTGGGGGTTGGGGCGG - Intergenic
1199680392 X:150220402-150220424 TGGGCAGGTGGTGGTGGTAGTGG - Intergenic
1199762121 X:150912966-150912988 GAGCCAGGTGGAGGTGGTGGCGG - Intergenic
1200063620 X:153494738-153494760 GAGGGGGGGGGAGGTGGTGGGGG + Intronic
1200129980 X:153836458-153836480 TTGGAGTGGGGAGGTGGTGTTGG - Intergenic
1200135302 X:153871859-153871881 GTGGCGGGGGGAGGGGGGGGCGG - Intronic
1200258507 X:154599001-154599023 TTGGGGGGTGGGGGCGGAGGTGG - Intergenic
1201179984 Y:11333941-11333963 GTGGTGGGTGGTGGTGGGGGTGG - Intergenic
1201365736 Y:13204617-13204639 TTAGCTGGTGAAGGTGGTAGAGG - Intergenic
1201949058 Y:19542947-19542969 TGTGTGGGTGGTGGTGGTGGTGG - Intergenic
1202379372 Y:24262267-24262289 TGGGCAGGTGGAGGTGGTGCAGG + Intergenic
1202491410 Y:25407854-25407876 TGGGCAGGTGGAGGTGGTGCAGG - Intergenic